text
stringlengths 4
518k
|
|---|
EL4 tumour cells maintained in culture were separated by FACS analysis to Ly-6.2 negative and Ly-6.2 positive subsets. The Ly-6.2 negative subset gained expression of this determinant on repeated in vivo passage in C57BL/6 mice. Both subsets injected intraperitoneally or intramuscularly in syngeneic mice induced identical changes in lymphocyte profiles. There was generalised lymphocytolysis in both T- and B-cell compartments. The Lyt-1+, 2- T-lymphocytes were more susceptible to cytolysis causing an alteration of the proportional representation of the Lyt-2+ subset from 30% of splenic T-cells to over 90% of remaining T-lymphocytes in tumour bearing mice. There was thymic regression in both groups of mice with a resultant thymocyte population expressing the range of phenotypes of mature medullary cells. In spite of similar rates of growth both in vivo and in vitro and identical effects on the lymphoid system the Ly-6.2 negative and Ly-6.2 positive tumour subsets were different in their metastatic potential. Mice injected intramuscularly with either subset had enlarged spleens by the second week of tumour growth caused largely by the accumulation of Ig, Lyt-1 and Thy-1 negative cells. Tumour cells were present only in the group injected with the Ly-6.2+ subset. These mice died of their tumour load a week earlier than those injected with the Ly-6.2- tumour cells. |
Sir,et al for their interest in our paper , and most (12 of the 16) reported evidence supporting the rural–urban population-mixing hypothesis mixing, each of unknown degree. While the choice of measure used is often dictated by the type of data available, where possible it would be valuable to compare results within and across data sets using multiple measures, in part, to note their lack of independence, and in part, as a type of sensitivity analysis.To regard the various studied examples of rural population mixing as unsatisfactory because they involve different definitions is hardly reasonable. What is relevant is that all (including our own) were prompted by the same basic hypothesis; people come together in a variety of different settings and, accordingly, so do outbreaks occur of infection-based illnesses. Parslow |
Rift Valley fever (RVF) is an arthropod-borne viral zoonosis. Rift Valley fever virus (RVFV) is an important biological threat with the potential to spread to new susceptible areas. In addition, it is a potential biowarfare agent.We developed two potential vaccines, DNA plasmids and alphavirus replicons, expressing the Gn glycoprotein of RVFV alone or fused to three copies of complement protein, C3d. Each vaccine was administered to mice in an all DNA, all replicon, or a DNA prime/replicon boost strategy and both the humoral and cellular responses were assessed. DNA plasmids expressing Gn-C3d and alphavirus replicons expressing Gn elicited high titer neutralizing antibodies that were similar to titers elicited by the live-attenuated MP12 virus. Mice vaccinated with an inactivated form of MP12 did elicit high titer antibodies, but these antibodies were unable to neutralize RVFV infection. However, only vaccine strategies incorporating alphavirus replicons elicited cellular responses to Gn. Both vaccines strategies completely prevented weight loss and morbidity and protected against lethal RVFV challenge. Passive transfer of antisera from vaccinated mice into naïve mice showed that both DNA plasmids expressing Gn-C3d and alphavirus replicons expressing Gn elicited antibodies that protected mice as well as sera from mice immunized with MP12.These results show that both DNA plasmids expressing Gn-C3d and alphavirus replicons expressing Gn administered alone or in a DNA prime/replicon boost strategy are effective RVFV vaccines. These vaccine strategies provide safer alternatives to using live-attenuated RVFV vaccines for human use. Rift Valley fever virus (RVFV) is an arthropod-borne phlebovirus associated with abortion storms, neonatal mortality in livestock and hemorrhagic fever or fatal encephalitis in a proportion of infected humans. Requirement of multiple booster immunizations to maintain the level of protective immunity with the inactivated vaccines and the ability of live-attenuated vaccines to cause detrimental side-effects are major limitations preventing the widespread use of current vaccines. In this paper, we describe the use of DNA and alphavirus replicon based vaccination approaches to elicit a protective immune response against RVFV. While both vaccines elicited high titer antibodies, DNA vaccination elicited high titer neutralizing antibodies, whereas the replicon vaccine elicited cellular immune responses. Both strategies alone or in combination elicited immune response that completely protected against not only mortality, but also illness. Even though the delivery vectors elicited some protection on their own, they did not prevent severe morbidity. These promising vaccines provide an alternative RVFV vaccine for livestock and humans. Phlebovirus of the family Bunyaviridae and was first discovered in the Rift Valley of Kenya in 1931 Rift Valley fever (RVF) is an arthropod-borne viral zoonosis. The causative agent Rift Valley fever virus (RVFV) belongs to the genus The virus genome is composed of three single-stranded negative-sense RNA segments. The large (L) segment (∼6.4kb) encodes for the RNA-dependent RNA polymerase RVFV is an important zoonotic pathogen with the potential to emerge in new areas through the spread of infected insect vectors or livestock or though intentional release as a bioterror agent. Given limitation of existing RVFV vaccines, there is a need to explore alternative vaccine approaches. Previous studies have shown that DNA vaccines can elicit protective anti-RVFV immunity. Studies from our group and others have demonstrated that the molecular adjuvant C3d can significantly enhance antibody responses against DNA vaccine delivered antigens Alphavirus replicon vectors are single hit vectors capable of eliciting potent systemic and mucosal immune responses against a wide range of pathogens, including hemorrhagic fever viruses, such as Lassa and Ebola r) for selection in antibiotic media.pTR600, a eukaryotic expression vector, has been described previously HindIII and BamHI restriction endonuclease sites. This Gn segment encoded a region from amino acids 131 to 557 (427 amino acids) and terminated in the sequence VAHCP. The vectors expressing Gn fused to three tandem repeats of the mouse homologue of C3d were cloned in frame and designated Gn-C3d, similar to constructs previously described 4S)2] were fused at the junctures of Gn and C3d and between each C3d repeat. Potential proteolytic cleavage sites between the junctions of Gn and the junction of C3d were mutated by ligating BamHI and BglII restriction endonuclease sites to mutate an Arg codon to a Gly codon The gene sequence encoding for the RVFV, isolate ZH548 (Genbank DQ380206), Gn glycoprotein was used to PCR amplify a soluble form of Gn (Gn) without the transmembrane and cytoplasmic tail . The Gn Escherichia coli DH5α; purified by using endotoxin-free, anion-exchange resin columns ; and stored at −20°C in distilled H2O. Plasmids were verified by appropriate restriction enzyme digestion and gel electrophoresis. Purity of DNA preparations was determined based on the optical density (O.D.) at wavelengths of 260 and 280 nm.The plasmids were amplified in A soluble form of RVFV Gn lacking the transmembrane and cytoplasmic tail (see above) was introduced behind the 26S subgenomic promoter of the VEE replicon plasmid pVR21 as outlined in 5 cells/transfection) with 5µg of DNA by using Lipofectamine 2000 according to the manufacturer's guidelines. Supernatants were collected and stored at −20°C. Cell lysates were collected in 500µl of 1% Triton X-100 buffer and stored at −20°C.The human embryonic kidney cell line, 293T, was transfected and loaded onto a 10% polyacrylamide–SDS gel. The resolved proteins were transferred onto a nitrocellulose membrane and incubated with a 1∶5,000 dilution of anti-RVFV mouse sera in phosphate-buffered saline (PBS) containing 0.05% Tween 20 and 5% skim milk powder. After an extensive washing, bound mouse antibodies were detected by using a 1∶5,000 dilution of horseradish peroxidase-conjugated goat anti-mouse antiserum and enhanced chemiluminescence .2. For replicon immunizations mice were given one dose at week 6 or three doses at weeks 0, 3, and 6 of 1×105 infectious unit (IU) of replicons by foot pad route. Blood samples were collected at at weeks 0, 2, 5, and 8 post-vaccination. A schematic of the vaccine regimen is listed in Six-to-eight week old female BALB/c mice were used for inoculations. Mice, housed with free access to food and water, were cared for under U.S. Department of Agriculture guidelines for laboratory animals. Mice were anesthetized with 0.03 to 0.04ml of a mixture of 5ml of ketamine HCl (100 mg/ml) and 1ml of xylazine (20 mg/ml). Gene gun immunizations were performed on shaved abdominal skin by using the hand-held Bio-Rad gene delivery system as described previously 5 PFU) 2 weeks or 8 weeks prior to infection .The attenuated strain RVFV MP12 (MP12) and ZH501 was propagated and titrated using Vero cells. A pre-titrated RVFV MP12 was inactivated with 1% beta-propiolactone to a final concentration of 0.1% to make a whole virus inactivated preparation (WIV MP12). To ensure complete inactivation, an aliquot of inactivated virus was used to infect Vero cells and verify the lack of cytopathic effect (data not shown). BALB/c mice (n = 5) received a single intraperioteneal injection (i.p.) of MP12 were used at varying concentrations determined by optimization.Endpoint ELISA was performed on collected serum samples to assess the anti-Gn immunoglobulin G (IgG) response. Briefly, plates were coated with 100µl of inactivated RVFV MP12 overnight at 4°C, blocked with 5% non-fat dry milk in PBS-T (1h) at 25°C, and then extensively washed with PBS-T. Serial dilutions of mouse antisera were allowed to bind (1h) and the plates thoroughly washed with PBS-T. Subsequently, the primary antisera were detected by anti-mouse IgG conjugated to horseradish peroxidase . The reaction was detected using tetramethybenzidine (TMB) substrate (1 h) at 25°C. IgG isotypes were also assessed by ELISA as previously described 5). Cells were incubated for 1h at 37°C and 5% CO2 and overlaid with nutrient medium containing 0.8% agar, 5% fetal bovine serum, 200U penicillin/ml, and 200mg streptomycin/ml. The plates were incubated at 37°C and 5% CO2. After 4 days of incubation, cells were fixed with 10% formalin and stained with 1% crystal violet for visualization of plaques. The neutralizing antibody titer of a serum was considered positive at the highest initial serum dilution that inhibited >50% of the plaques as compared to the virus control titration.Antibody-mediated neutralization of RVFV ZH501 was measured using plaque reduction and neutralization test (PRNT) 5/well) isolated from vaccinated mice. Cells were stimulated (48h) with peptides (15mers overlapping by 11 amino acids) representing the ectodomain of Gn glycoprotein. IL-2 was added to all wells (10 units/ml). Control wells were stimulated with PMA (+) (50 ng)/ionomycin (500 ng) or were mock stimulated (−). Plates were washed with PBS-T (3×) and were incubated with biotinylated anti-mIFN-γ and incubated (4°C for 16h). The plates were washed and incubated (25°C for 2h) with strepavidin conjugated to alkaline phosphatase. Following extensive washing, cytokine/antibody complexes were incubated (25°C for 1h) with stable BCIP/NBT chromagen. The plates were rinsed with dH2O and air-dried (25°C for 2h). Spots were counted by an ImmunoSpot ELISpot reader .The number of anti-Gn specific murine INF-γ (mINF-γ) secreting splenocytes was determined by enzyme-linked immunospot (ELISpot) assay . Briefly, pre-coated anti-mIFN-γ plates were incubated (25°C for 1h) with RPMI (200µL) supplemented with 10% fetal calf serum and then incubated with splenocytes . All manipulations with infected mice and/or samples involving RVFV ZH501 were performed under strict BSL-3 enhanced conditions. The animals were examined twice daily for visual signs of morbidity or mortality, using a lab validated scoring system as previously described At week 8 of the study, a challenge dose containing 1×103 PFU). Mice were observed daily for 8 days post-transfer for signs of morbidity and mortality.Sera from vaccinated mice were diluted 1∶10 in sterile PBS and 100µl of the diluted sera was injected (i.p.) into new, naïve BALB/c mice. One hour following transfer, the mice were challenged (i.p.) with virulent RVFV ZH501 , ** (P<0.01), *** (P<0.001). Statistical analyses were done using GraphPad Prism software.1 and Th2 response, whereas mice vaccinated with three doses of WIV MP12 had a Th2-restricted immune response efficiently secreted from cells transfected with DNA plasmid and replicon vector . RVFV Gnresponse . Mice varesponse . In cont vaccine . Intereseplicons . These t50) RVFV ZH501, while priming mice with Gn-C3d-DNA and then boosting with Rep-Gn did not significantly enhance the neutralizing titers compared to Gn-C3d-DNA or Rep-Gn alone specific for Gn. Mice vaccinated with Rep-Gn or Gn-C3d/Rep-Gn had responses to pools B and C . A unique peptide representing this region of Gn elicited similar mINF-γ cellular immune response as the four individual peptides as indicated in The peptides in these pools B and C were further analyzed to determine the peptides responsible to eliciting these responses in replicon-vaccinated mice. Using a matrix format, 4 out of 10 pools (5 peptides/pool) were identified . From th3 PFU) ofRVFV ZH501. All the mice vaccinated with an all Gn-C3d-DNA or Rep-Gn strategy or in a DNA prime/replicon boost strategy were protected from virulent virus challenge with no body weight loss or development of clinical signs into unimmunized mice, which were then challenged with a lethal dose of RVFV ZH501 . Eighty One of the goals of an effective RVFV vaccine is to elicit protective neutralizing antibodies. In recent years, several RVFV vaccines strategies have been employed to elicit a potent neutralizing antibody responses To overcome the limitations discussed above, we have developed two promising vaccine candidates based on DNA plasmid and alphavirus replicon vectors that express the virus envelope glycoprotein, Gn. Each vaccine was tested alone or in a DNA prime/replicon boost strategy formulation to elicit protective immune response against virulent RVFV infection in mice. DNA vaccines have been licensed for veterinary use In addition to the DNA vaccine strategy, we also used a DNA prime/alphavirus replicon boost strategy to expand the repertoire of elicited immune responses. Previously, our group used a Sindbis virus replicon vectors expressing the RVFV Gn and Gc glycoproteins, as well as the non-structural NsM protein to induce protective immune responses in mice against RVFV 50 value of <1∶10 succumbed to lethal infection and a PRNT50 value of ≥1∶40 was sufficient to prevent clinical signs. This indicates that the clinical sickness score more accurately reflected vaccine efficacy in preventing RVFV infection and may be a useful tool for future vaccine studies.Even though both MP12 infection and the WIV vaccination elicited the highest anti-Gn titers, only the live MP12 infection elicited strong neutralizing antibody responses Fig. 4. The issue of survival from control DNA or mock vaccination is curious, but has been observed in previous publications. Spik et al. www.immuneepitope.org]. Although, both Rep-Gn alone or in a DNA prime/replicon boost approach Gn-C3d/Rep-Gn induced a combination of humoral and cell mediated immune responses and therefore this strategy may warrant further evaluation in large animals and humans.To further explore the ability of factors in the sera to protection mice from RVFV infection, passive transfer of serum from vaccinated mice to naïve mice demonstrated that humoral immune response play a major role in anti-RVFV immunity [40]. No |
Overweight increased among Filipino mothers and offspring from 1994 to 2005 however, a higher rate of increase among mothers resulted in a prevalence 4 times higher than that among offspring in 2005. Our aim was to explore the differential effects of changing income, assets, maternal education, and urbanicity on dietary behaviors of mothers and offspring that may affect overweight risk.The study included a cohort of Filipino offspring and their mothers participating in the Cebu Longitudinal Health and Nutrition Survey at four time points from 1994 to 2005 . The effect of socioeconomic factors and urbanicity, on dietary behaviors including energy adequacy, percent fat and carbohydrates were examined using longitudinal random-effects regression models.Mothers and offspring were consistently more likely to consume more calories relative to basal needs as well as a higher percent of calories from fat and a lower percent from carbohydrates with higher socioeconomic status and urbanization. Despite the substantially higher rates of overweight among mothers compared to offspring, offspring consumed a significantly more obesogenic diet than mothers experiencing the same increases in wealth and urbanicity.Family-based interventions should be developed to counteract the shift towards a more obesogenic diet observed for both Filipino mothers and offspring. In developing countries undergoing rapid urbanization and social and economic change increases in the consumption of processed foods, animal fats, and simple sugars, as well as an overall increase in total energy intake reflect the nutrition transition . SimultaThe Philippines, like many developing countries, has experienced rapid modernization in recent decades. There is also evidence that the nutrition transition has affected this population. A study based on data from the Cebu Longitudinal Health and Nutrition Survey (CLHNS) found that the prevalence of overweight increased significantly among mothers and a cohort of their offspring during a 14 year period . Howeverst, 1983 and April 30th, 1984 there were 3,080 singleton births identified. Information was collected once during the third trimester of pregnancy, at delivery and bimonthly for 24 months. The survey was extended to include rounds in 1991–2, 1994–5, 1998–2000, 2002, and 2005–6 where the average age of the index offspring were 8.5, 11.5, 15.5, 18.7, and 21.5 years, respectively. For convenience, we refer to these rounds as 1991, 1994, 1998, 2002 and 2005. For each survey year, the analysis samples were restricted to mother/offspring pairs living together in the same household, and included cases where the offspring was a singleton, and neither the mother nor the offspring was pregnant, incapacitated or institutionalized during the given year. Of the pairs who were not included in each survey year, a majority were left out due to the separation of mother and offspring into different households. Maternal education, household income and community urbanicity was lower for these pairs at baseline (1983) than those retained in the study. However, previous studies using the CLHNS show no significant bias due to these differences. Our final sample, comprised of a closed cohort panel, included repeated measurements for mother/offspring pairs in 1994 , 1998 , 2002 , and 2005 . To ensure comparability across survey years, the 1991 survey was not included in this analysis. Unlike in subsequent surveys, in 1991 mothers were used as a surrogate to recall offspring diet. Prior to the 1994 survey, offspring were too young to have a substantial impact on their dietary choices independent of maternal preferences. The CLHNS protocols were reviewed and approved by the Institutional Review Board of the University of North Carolina at Chapel Hill.Participants were recruited from metropolitan Cebu, Philippines, which includes Cebu City (the second largest city in the country) and several smaller urban as well as mountainous and coastal rural communities. All pregnant women in 17 urban and 16 rural randomly selected barangays (administrative units) were invited to participate in the study . Between May 1Dietary information was collected using 24-hour dietary recalls. One day of intake was recorded from mothers in all years and from offspring in 1994. From 1998 to 2005, two days of dietary recall are available for offspring. Data were collected during in-home interviews performed by highly trained local field staff. All data were checked by editors, and implausible intake values were verified by sending interviewers back to question respondents. To minimize loss of information and maximize the probability of obtaining unbiased estimates , offspriTotal energy intake was calculated using year-appropriate Philippines Food Composition Tables from the Food and Nutrition Research Institute. To create a comparable measure of total energy for mothers and offspring, total intake was divided by BEE to adjust for body size. BEE was estimated using the following most recent WHO/FAO equations based on doubly labeled water studies , which a(1) Normal weight mother BEE: (255 - 2.35*age + 361.6*height + 10.12*weight)(2) Overweight mother BEE: (247 - 2.67*age + 401.5*height + 8.60*weight)(3) Normal weight daughter BEE: (189 - 17.6*age + 625*height + 7.9*weight)(4) Overweight daughter BEE: (515.8 - 26.8*age + 347*height + 12.4*weight)(5) Normal weight son BEE: (68 - 43.3*age + 712*height + 19.2*weight)(6) Overweight son BEE: (419.9 - 33.5*age + 418.9*height + 16.7*weight)Height was measured to the nearest 0.1 cm using portable stadiometers and weight was measured to the nearest 0.1 kg using portable scales. Overweight was defined for mothers and children ages 18 and older as a BMI of ≥ 25. For children < 18 years of age , the International Obesity Task Force (IOTF) sex and age-specific cut points developed by Cole et al were used to determine overweight . Any chaPercentage of calories from fat (%FAT) or carbohydrates (%CHO) were calculated by multiplying the total gram intake from the 24-hr recalls by 9 and 4 respectively and dividing by the total 24-hour kcal intake. Both %FAT and % CHO were represented in the final models as continuous variables.For each round of the CLHNS, maternal education was recorded as the highest year of education completed. Observations tended to cluster around primary school and secondary school graduation therefore; indicator variables were created to represent: less than primary school graduate, primary school graduate, some high school, and high school graduate and beyond. However, few women attained additional education after the 1983 baseline survey so there is minimal change over time in maternal education.th percentile of the sample income distribution .Total household income included the sum of both cash income from all household members over 6 years of age and the value of in-kind earnings. For comparability over time, income values were deflated to January 1983 values using year-appropriate Philippines consumer price indices from 1994 to 2005. For all analyses, a continuous variable of household income was truncated so that right-skewed outliers were given the value at the 99A proxy for wealth was created using household assets represented by the sum of the number of selected possessions ranging from small items such as electric fans to house ownership and construction material. The resulting index took on values from 0 to 11. Previous research has shown that a simple summation of ownership of material goods is an accurate and robust estimate of SES in a developing country context .Recent studies based on the CLHNS have found substantial heterogeneity in the common urban-rural dichotomy ,18, To mA binary variable indicated whether the participant was a mother (0) or offspring (1). Within each household there was a maximum of 4 observations per household member (one per survey year).Given that the four survey years included in this study were not equally spaced, a series of indicator variables were created to represent 1994, 1998, 2002 and 2005. Significant coefficients on time variables also indicate dietary trends over time.Descriptive statistics were used to characterize sample characteristics for each survey year. Our aim was to identify whether change SES and urbanicity over time, had a differential effect on diet patterns of mothers versus offspring. To directly compare the dietary patterns of mothers and offspring over time, separate datasets were created for mothers and offspring, with a maximum of 4 observations per person (representing the 4 survey years). The two datasets were then appended, and a binary indicator household member variable identified the intake value as belonging to the mother or the offspring within each family. Since the mother-offspring pairs resided in the same household, the value for each independent variable was the same for both household members within each survey year. Therefore, we were able to evaluate possible differences in dietary patterns of mothers versus offspring living in the same environmental conditions.We used random-intercept mixed models to control for unobserved characteristics associated with clustering of repeat measurement occasions within individuals and for multiple individuals within families. Three separate sets of models were constructed to explore the effect over time of SES and urbanization on EEA, %FAT and %CHO. Our intention was to answer four distinct questions, 1) Do EEA, %FAT and %CHO differ in mothers and offspring residing in the same household? 2) Do changing household income and assets and community level urbanization significantly alter dietary patterns? 3) Is the relationship the same in mothers and their offspring? 4) Do the relationships vary over time? To answer these questions, each model included main effects of member, SES and urbanicity and year, two-way interactions of member with SES and urbanicity and member with time, and 3-way interactions of member, time, and the SES and urbanicity variables.th percentile of sample level of income, assets and urbanicity and maternal education level = high school graduate+), or low SES and urbanicity . All analyses were performed using Stata 9.2 [The coefficients for main effects in each model represented the average effect of SES and urbanicity on maternal diet. Interactions of SES and urbanicity with household member represented the added effect of those variables on the diet of offspring versus mothers. Time interactions tell whether SES and urbanicity affected diet changed over time. Triple interactions of time, member status, and SES and urbanicity tell whether there were differential effects of SES and urbanicity on offspring versus mothers change over time. Preliminary analyses showed a significant interaction between offspring gender and household member status on diet outcomes, therefore analyses were stratified by offspring gender. Results were considered significant at a p value ≤ 0.05 for main effects, and interactions were assessed using partial F tests and considered significant at p ≤ 0.10. To avoid artificially large standard errors of interaction terms due to substantial covariance, backwards deletion was used to eliminate the interaction terms with the time variables that showed minimal impact (T-statistic < |1.0|). All models were adjusted for maternal age using both a continuous and squared age term due to a curvilinear relationship between maternal age and all three diet outcomes. Given that complex longitudinal analyses were performed with multiple time and offspring interactions, the coefficients for the individual interactions are essentially uninterpretable. Therefore, to facilitate the interpretation of the models, we predicted diet outcomes under contrasting circumstances, representing for each year, profiles of high SES and urbanicity may have biased our estimates. We did not have data to estimate physical activity duration and intensity and therefore could not accurately estimate energy expenditure from physical activity. Previous findings using the CLHNS data show that a greater number of sons participate in occupational and leisure moderate/vigorous activity than mothers and daughters suggesting that use of BEE may have inflated the extent to which energy need was exceeded in this study, particularly for sons.2 threshold which defines overweight. In parallel with the decline in EEA, we observed a decrease over time in %FAT, which is not based on weight status. The apparent paradox of increased body weight with decreased EEA over time may be explained by a disproportionately greater decrease in energy expended in physical activity compared to energy intake which could still result in continued weight gain over time.Our results show a decrease in EEA over time for mothers despite a continued increase in overweight. This brings in to question our method for estimating EEA for mothers. We assumed that weight changes from 1994–2005 primarily reflected increases in fat mass rather than fat free mass, particularly in light of our observation that occupational and leisure time physical activity declined during this period . Since aIn our study, BEE was calculated using equations based on data from an American population. Previous studies have found that Asians tend to have higher fat mass and less fat free mass compared to Americans with the same BMI; therefore the estimation equations may have overestimated actual BEE . However, since our population is ethnically homogenous the extent to which BEE may be overestimated is probably consistent across the sample and therefore we do not expect significant differential misclassification in the ranking of individuals by BEE levels.As with all longitudinal studies, there is always the possibility of selection bias due to attrition. Previous studies using the CLHNS have found no significant affect of selection bias due to attrition; however attrition may have reduced the generalizability to the original source population. Another possible limitation of this study was the assumption that the accuracy of dietary intake reports was the same for mothers and offspring. In developed countries, studies have found that overweight and obese individuals are more likely to underreport calorie and fat intakes possibly in response to social pressures to be thin -38. HoweThere are several unique strengths of this study. Previous research has documented dietary behavior changes in developing countries such as increased total energy intake from processed foods high in sugar and fat intake from animal sources. However no studies to date have explored a possible differential response in dietary behaviors of adults and offspring to changing SES and urbanization that might explain discrepant weight status. Because of the detailed environmental, socioeconomic, and demographic information of the CLHNS from individual, household and community-levels, we had the unique opportunity in this study to explore intergenerational responses to changing community and household level conditions indicative of modernization. Additionally, the wealth of data of the CLHNS allowed for a detailed exploration of multiple dimensions of diet. Finally, this study documents dietary trends through important period of development from adolescence to adulthood for offspring.Several studies have identified the coexistence of overweight and underweight in developing countries ,27,29. HThe authors declare that they have no competing interests.AJ conceived the study hypothesis, conducted data analyses and wrote the manuscript. LA was responsible for data management of the Cebu Longitudinal Health and Nutrition Survey and contributed to data analyses and the writing of the manuscript. |
Pulmonary involvement and skin involvement are rare complications of plasma cell neoplasms. Here we describe what may be the first reported case of a patient with relapse in both of these sites following autologous peripheral blood stem cell transplantation. We report a 58-year-old man with diffuse pulmonary parenchymal plasma cell infiltration and skin nodules. Five years previously he had been treated successfully with VAD chemotherapy and an autologous peripheral blood stem cell transplant for multiple myeloma. Four years later he relapsed with anemia, hypercalcemia, and an IgG of 6170 mg/dl. Skeletal survey showed no lytic lesions, the marrow was 30% infiltrated by plasma cells with a t and a del 13q14.3 abnormality. The paraprotein level transiently responded to thalidomide-dexamethasone, but he in turn developed hyperammonemia, which responded to the addition of bortezomib and liposomal pegylated doxorubicin to the regimen.rd cycle of this regimen, subcutaneous nodules appeared on all four extremities, and a needle aspirate revealed plasma cells (figure During the 3s figure . The WBCs figure . Bronchos figure . He soonIn plasma cell neoplasms, pulmonary complications are common, but infection is the most common cause. In a series of 958 patients with myeloma, 10% had pulmonary findings, but in only 1 case was plasma cell involvement demonstrated histologically, and the clinical course was suggestive of plasma cell involvement in only 3 other cases -4, whereThe authors declare that they have no competing interests.All authors were involved in the provision of clinical care of the patient and the collection of data and the review of the manuscript. RW performed immunohistochemical analysis. YY drafted the manuscript and reviewed the literature, as did DA, who performed the final edits.The Institutional IRB approved the submission of this manuscript, which was considered by the editors to be a proxy for the patient's informed consent for the publication of the manuscript and accompanying images, in light of the fact that the patient had expired. A copy of the written documentation of this is available for review by the Editor-in-Chief of this journal. |
Embryonic stem (ES) cells self-renew as coherent colonies in which cells maintain tight cell-cell contact. Although intercellular communications are essential to establish the basis of cell-specific identity, molecular mechanisms underlying intrinsic cell-cell interactions in ES cells at the signaling level remain underexplored.Here we show that endogenous Rho signaling is required for the maintenance of cell-cell contacts in ES cells. siRNA-mediated loss of function experiments demonstrated that Rock, a major effector kinase downstream of Rho, played a key role in the formation of cell-cell junctional assemblies through regulation of myosin II by controlling a myosin light chain phosphatase. Chemical engineering of this signaling axis by a Rock-specific inhibitor revealed that cell-cell adhesion was reversibly controllable and dispensable for self-renewal of mouse ES cells as confirmed by chimera assay. Furthermore, a novel culture system combining a single synthetic matrix, defined medium, and the Rock inhibitor fully warranted human ES cell self-renewal independent of animal-derived matrices, tight cell contacts, or fibroblastic niche-forming cells as determined by teratoma formation assay.These findings demonstrate an essential role of the Rho-Rock-Myosin signaling axis for the regulation of basic cell-cell communications in both mouse and human ES cells, and would contribute to advance in medically compatible xeno-free environments for human pluripotent stem cells. Supporting this idea, despite their phenotypic changes, they retained strong expression of Oct3/4 in the individual cells . To evalin vivo by the chimera assay with mES cells that had been passaged in the presence of Y27632 at a low density for 3 weeks with occasional freezing and thawing. The microinjected cells were able to integrate into the host blastocyst and contributed to the generation of live chimeras derived from mouse embryonic fibroblasts (MEF) [44] werin vitro by analysis of embryoid body formation , focal islands of pancreatic and hepatoid tissue elements (endoderm), and ossifying foci (mesoderm) ormation and in vesoderm) . To testesoderm) .The observed tight cell contact-free growth on NTC plates may be advantageous to achieving spatiotemporally high-resolution analyses of the stem cell replication. To further explore the potential application of this method, we used a reporter hES line in which GFP is driven by Oct3/4 promoter. Through this system, the dynamic process of symmetric cell division as judged by equal inheritance of Oct3/4 transcriptional activity into two daughter cells was captured at a single-cell resolution independent of physically contacting neighboring cells . Becausein vivo multi-lineage differentiation capacity was confirmed after a series of passaging and cryopreservation by teratoma formation assay .2. When ES cells formed relatively small sizes of colonies, each of which consisted of approximately 30 to 100 cells, cells were subjected to chemical treatment or transfection experiments. For the animal-derived extracellular matrices-free culture, hES cells were plated at approximately 10000 cells/ cm2 on non-tissue culture-treated plates (BD Bioscience) with CM supplemented with Y27632 at 10 µM, or on poly-D-lysine-coated plates (BD Bioscience) with mTeSR supplemented with 10 µM of Y27632. Cells were passaged by using trypsin-EDTA in a relatively short period (3 to 4 days) to avoid the formation of small cell clusters. For the cell number count, cells were plated on 6-well plates in triplicates under the same condition as shown above. Cells were periodically harvested, stained with trypan blue, and counted by the hemocytometer.Three independent mES cell lines, CJ7 , E14 , and J1 , were used for the experiments. mES cells were maintained on gelatin-coated dishes with the standard medium in the presence of leukemia inhibitory factor (LIF) at 1400 U/ml as described in detail elsewhere Cells grown on culture vessels were fixed in 4% paraformaldehyde . After washing with PBS/BSA, the samples were incubated with primary antibodies recognizing the target proteins at 4°C overnight. The primary antibodies used in the study include Oct3 (BD Biosciences), Nanog , Rho A (Santa Cruz Biotechnology), E-cadherin (Millipore Corporation), myosin IIA , myosin IIB (Covance), MYPT1 (Santa Cruz Technologies), Nestin (Millipore), Smooth muscle actin (Millipore), IGF1R (abcam). The samples were washed for three times, and incubated with appropriate secondary antibodies conjugated with Alexa Fluorophore (Invitrogen) at room temperature for 30 min. After three times washing, the samples were counterstained with 4′,6-diamidino-2-phenylindole , and examined by Nikon TE-2000-U fluorescent inverted microscope equipped with CFI Fluor 40X objective or Zeiss LSM 510 confocal microscopy equipped with Apochromate water-immersion lenses . For the measurement of cell-contact index (CCI), E-cadherin and Oct3/4 localizations were visualized by a combination of each primary antibody and secondary antibody conjugated with Alexa Fluophore 488 and 555, respectively. The presence of intensified linear accumulation of E-cadherin at the cell-cell border of neighboring Oct3/4 positive cells was used as readout to assess the mature cell-cell junctions between the adjacent undifferentiated ES cells. The representative fluorescent images from each condition were initially taken by both confocal microscope and fluorescent inverted microscope to compare the consistency of the acquired images between the two different equipments. As their results were consistent in the evaluation of the above criteria, we decided to take advantage of the convenient operation of the conventional fluorescent microscope to take sufficient numbers of images required for the statistical analysis. Fluorescent images of approximately 50 to 100 cells in at least 5 different areas of each condition in three independent experiments were captured, and the total number of Oct3/4-positive cells and the number of Oct3/4-positive cells that met the above criteria were calculated in each image, and subjected to statistical analysis.4 for 1 hr followed by dehydration in a series of graded ethanol. Cells were subjected to the infiltration for Spurr resin, and microsectioning. The samples were analyzed by Tecnai 12 transmission electron microscope .Mouse or human ES cells were grown on Thermanox plastic cover slips that have been coated with gelatin, Matrigel, or poly-D-lysine as necessary. After rinsed with buffer , cells were fixed in 2% paraformaldehyde and 2.5% Glutaraldehyde for 1 hr. After washing, cells were post fixed with 1% OsOsiRNAs specific for each target gene (siGENOME or ON-TARGETplus SMARTpool) were purchased from Dharmacon . The scrambled control or FAM-tagged siRNA was transfected into cells at a final concentration of 40 nM by using Lipofectamin 2000 and OptiMEM (Invitrogen) according to the manufacturer's protocol. Each siRNA targeting a single molecule was used at a concentration of 40 nM for each well of 6-well plates. When two distinct siRNAs were combined to deplete two different genes in the same well, each siRNA was reduced to 25 nM to keep the final concentration consistent throughout the experiment. The transfected cells were subjected to morphological or molecular analyses such as quantitative real-time PCR or Western analysis at 24 or 48 hrs after transfection. The sequences of siRNAs used in the study are shown in Supporting Information .Total RNA was isolated from cells by using Qiashredder and RNAeasy mini kit . The extracted RNA sample was quantified by UV spectrophotometer, and qualified by the RNA Nano Lab chip .Two µg of total RNA was reverse-transcribed using SuperScript III RT-PCR system (Invitrogen) according to the manufacturer's protocol. Each cDNA sample in triplicates was PCR amplified with specific PCR primers and FullVelocity SYBR Green QPCR master mix using MyiQ real-time PCR detection system . Each cycle threshold (CT) value was determined by iQ5 optical system software (BioRad), and normalized by the β-actin expression level. The primer sequences were designed by Primer Express software , and their potential crossreactivity with other sequences were prescreened by In Silico PCR . The full sequences of the primers are posted in Supporting Information .2EDTA, 1 mM EGTA, 1% NP-40, 1% sodium deoxycholate, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na3VO4, and protease inhibitors). Protein concentrations were determined by BCA Protein Assay kit . 50 µg of protein was separated by 10% SDS/PAGE and transferred onto a PVDF membrane . The membrane was blocked in Odyssey blocking buffer , and subsequently incubated with primary antibodies against Rho A , E-cadherin (BD Biosciences), Rock I (BD Biosciences), Rock I (Millipore Corporation), Rock II (BD Biosciences), Stat3, phosphorylated Stat3 (tyr705), Akt, phospho-Akt, ERK1/2, phospho-specific ERK1/2 (Thr202/204) , or β-actin at 4°C overnight followed by incubation with peroxidase-conjugated goat anti-mouse IgG or goat anti-rabbit IgG , and developed with ECL reagent .Total protein was extracted with RIPA buffer . The cell lysates extracted from ES cells treated with or without Y27632 at 10 µM for 24 hrs were incubated with kinase reaction buffer in the presence of ATP at 10 µM, and subsequently added to the substrate -coated multiwell plate. The phosphorylated substrate was recognized by horseradish peroxidase-conjugated phospho-MBS threonine-696-specific antibody that catalyzes the chromogenic substrate (tetra-methylbenzidine), and subjected to the colorimetric measurement by Spectramax microplate reader .7 cells/ 10 cm dish) in the absence of Y27632, and grown in non-conditioned medium for 7 days. For the detection of differentiated derivatives, hES cell-derived EBs were plated on gelatin-coated 12-well plates to allow them to adhere, grown in DMEM (Invitrogen) containing 10%FBS or Primary Neuron Growth Media (Lonza) to induce further differentiation for 14 days, and fixed in 4% paraformaldehyde followed by immunocytochemical analyses.hES cells were harvested by using dispase or trypsin-EDTA, plated on non-tissue culture treated dishes (approximately 106 cells) grown under animal-derived extracellular matrices-free culture conditions for multiple passages with occasional freezing and thawing were subcutaneously injected into severe combined immunodeficient (SCID)/ beige mice . After four to eight weeks, the developed teratomas were excised, fixed in 4% paraformaldehyde or 10% formalin, and subjected to histological section preparations.All animal-related protocols were approved by Institutional Animal Care and Use Committee. hES cells (approximately 2×102) in ESGRO Complete Clonal Grade medium in the presence or absence of Y27632 at 10 µM for 6 to 7 passages over 3 weeks with occasional freezing and thawing. Approximately ten to fifteen cells were microinjected into each blastocyst harvested from C57/Bl6 background mice. The injected blastocysts were introduced into foster mice. Chimerism of live offspring was confirmed by evaluation of their mixed coat color. Germ-line transmitters were determined by mating male chimeras with wild type C57/Bl6 female mice.mES cells (E14 or CJ7) were plated on gelatin or poly-D-lysine-coated plates (BD Biosciences) at a low density were subjected to statistical analysis by using analysis of variance (ANOVA) or paired t-test. The statistical significance was shown as the probability value such as **p<0.001. Data points are shown as mean±standard deviation (SD).Table S1Evaluation of germ-line transmitters in chimeras derived from the Rock inhibitor-treated ES cells.(0.03 MB DOC)Click here for additional data file.Table S2siRNA sequences.(0.11 MB DOC)Click here for additional data file.Table S3Real-time QPCR primer sequences.(0.06 MB DOC)Click here for additional data file.Figure S1Evaluation of cell-cell contact states by ultrastructural and fluorescent microscopic analyses. (A) Representative images of undifferentiated mES cells grown under the control condition or in the presence of C3 exoenzyme for 24 hrs evaluated by transmission electron microscope (TEM). Specialized junctional complexes are indicated by arrows. (B) Immunofluorescent images of ES cells treated with or without C3 exoenxyme. E-cadherin and Oct3/4 localizations were determined by using specific primary antibodies in combination with secondary antibodies conjugated with Alexa Fluophore 488 (green) and 555 (red), respectively. Arrows indicate the intensified linear accumulation of E-cadherin in C3-treated cells. (C) A summary of the total number of cells that have undifferentiated stem cell features (high nuclear/cytoplasmic [N/C] ratio) and the number of undifferentiated cells that possess specialized junctional complexes as determined by TEM. Similar results were obtained from three independent experiments. Scale bars, 15 µm.(4.60 MB TIF)Click here for additional data file.Figure S2siRNA-mediated gene silencing in mES cells. To determine the transfection efficiency of siRNA in mES cells, cells were transfected with green fluorophore (FAM)-tagged siRNA at 40 nM with use of Lipofectamine 2000, and 24 hrs later, cells were evaluated on fluorescent inverted microscope. Virtually almost all cells incorporated fluorophore-tagged siRNA. Inset denotes the phase contrast image. To evaluate the level of knockdown of endogenous genes by siRNA treatment, mES cells were transfected with each siRNA targeting specific gene at 40 nM or at 25 nM when two distinct siRNAs were combined. 24 hrs later, cells were harvested, and subjected to Western or QPCR analysis. For Western analysis, β-actin was used as a loading control. Although the effect of Rock I siRNA appeared to be isoform-specific, Rock II siRNA affected both isoforms in a similar manner. Hence, the effect of Rock siRNA on the cell-cell contact was evaluated only when both Rock I and Rock II were simultaneously depleted by the cotransfection of Rock I and Rock II siRNAs. For the QPCR analysis, the data were normalized to the expression level of β-actin. The endogenous mRNA level of myosin IIC in mES cells was two orders below that of other myosins (data not shown). Although myosin IIC-specific siRNA treatment further reduced the expression level down to 40% that of the control, no substantial effects on cell-cell contact was observed (data not shown). Scale bars, 25 µm.(1.63 MB TIF)Click here for additional data file.Figure S3Morphological dynamics of mES cells triggered by Y27632 treatment or removal. (A) Morphology of E14 mES cells grown in the presence or absence (control) of Y27632 at 10 µM for 48 hrs. (B) mES cells were grown in the presence of Y27632 at 10 µM for 3 days. Subsequently, the compound was removed from the medium, and cells were photographed at 24 hrs and 48 hrs after the compound removal. Note that cells fully restore the normal cell-cell contact state at 48 hrs after Y27632 removal. Scale bars, 25 µm.(4.47 MB TIF)Click here for additional data file.Figure S4Activation states of the signal transduction pathways in mES cells. mES cells were grown in the presence or absence of Y27632 at 10 µM for several passages, and subjected to Western analysis using antibodies specific for major effector molecules downstream of each pluripotency-related signaling pathway.(0.96 MB TIF)Click here for additional data file.Figure S5hES cells grown in the absence of animal-derived extracellular matrices. (A) hES cells expressing GFP under the control of the Oct3/4 promoter were plated on non-tissue culture-treated dishes with conditioned medium supplemented with Y27632 at 10 µM. The GFP expression and morphology were sequentially captured by fluorescence microscopy. Note that GFP expression representing Oct3/4 promoter activity is equally inherited to two daughter cells. (B) Additional representative images showing the expression of IGF1 receptor (IGF1R) and Oct3/4 in hES cells passaged for an extended period on the PDL plate with mTeSR medium containing Y27632 at 10 µM (PDL). Note that no Oct3/4-negative fibroblastic cells physically surround the Oct3/4-positive undifferentiated cells grown on the PDL plate. The images on the bottom (low power view of the same area shown in (5.99 MB TIF)Click here for additional data file. |
Recent data show that cells from many cancers exhibit massive chromosome instability. The traditional view is that the gradual accumulation of mutations in genes involved in transcriptional regulation and cell cycle controls results in tumor development. This, however, does not exclude the possibility that some mutations could be more potent than others in destabilizing the genome by targeting both chromosomal integrity and corresponding checkpoint mechanisms simultaneously. Three such examples of "single-hit" lesions potentially leading to heritable genome destabilization are discussed. They include: failure to release sister chromatid cohesion due to the incomplete proteolytic cleavage of cohesin; massive merotelic kinetochore misattachments upon condensin depletion; and chromosome under-replication. In all three cases, cells fail to detect potential chromosomal bridges before anaphase entry, indicating that there is a basic cell cycle requirement to maintain a degree of sister chromatid bridging that is not recognizable as chromosomal damage. Due to recent advances in genome analysis, we now have access to genome-wide association studies in many cancer types ,2, and, While the role of environmental damaging factors is well known in cancer and other complex diseases, the deregulation of internal cellular mechanisms that may interfere with genome stability is poorly understood. The fact that hundreds of complex syndromes are associated with chromosomal rearrangements including breaks, translocations, and tandem repeat instability, many of which occur at very specific hot spots of variability, indicates that disruption of global mechanisms of genetic homeostasis may be an underlying cause of such syndromes. Particularly, perturbations of high fidelity chromosome segregation during cell division may be involved. Thus, chromosome instability is apparently not just a signature (a "passenger") of many complex diseases, but also one of inherent causes ("drivers"). The severity and pathway specificity of the underlying mutation(s) in the genome homeostasis network therefore could be one of the key factors in the final clinical outcome of overt neoplasia.A search for both universal and disease-specific mechanisms leading to multiple, rapidly-occurring genome-wide changes mandates the dissection of these mechanisms into specific biochemical/genetic pathways. While it is agreed that transcriptional deregulation is at the core of the final pathological pattern of most multigene diseases, chromosome rearrangements of a particular type, such as loss of heterozygocity (LOH) at different genomic regions, may make a very specific contribution to particular cases of aberrantly altered expression patterns. Behind such specificity are particular chromosomal zones that are destabilized if a given genome homeostasis pathway is disabled. For example, expansion of trinucleotide repeats, chromosomal translocations, and microsatellite instability all occur due to the dysfunction of distinct DNA housekeeping processes.As a rule, cancer "tumor-suppressor" genes are defined based on the two-hit paradigm of Knudsen with a mutation in one allele accompanied by LOH . HoweverConventional wisdom suggests that two key changes are needed for sporadic genome reorganization: 1) a source of dramatically increased instability such as a mutation in a gene that results in global chromosome damage; and 2) the relaxation of checkpoint controls that normally detect and neutralize defects in DNA metabolism or integrity Fig. . In thisSister chromatids are held together from the first steps of replication until the moment when the signal is given to enter anaphase. At least two types of locks are present in sister chromatids: true topological interlocks via DNA catenation as a result of its replication, and the "cohesion", or "glue", links composed of proteins, best exemplified by the activity of the SMC complex called cohesin . In the Cohesin is proteolytically cleaved at the metaphase to anaphase transition, likely primarily at centromeres, releasing the interlocks between sister chromatids. If CDK1 is inactivated, this cleavage is sufficient to initiate chromosome segregation . Thus, dESP1 and cut1 genes [In contrast to the premature loss of SCC that is effectively recognized by mitotic checkpoint, separase inactivation leads to complex chromosomal instability. This instability likely results from: 1) interlocks between sister chromatids generated by the failure to cleave even a small proportion of cohesin molecules (hence the dominant phenotype of noncleavable RAD21/SCC1/MCD1), and 2) invisibility of separase failures to the spindle checkpoint. Indeed, while activation of separase is under impressively multilayered control, it does not appear that there is any way for a cell to tell whether separase is fully active before initiation of anaphase. Furthermore, from the initial pioneering studies of t1 genes ,21, whict1 genes . Howevert1 genes , nor in t1 genes , human [t1 genes , or moust1 genes cells. At1 genes . Mouse ft1 genes because t1 genes . One cant1 genes . It is at1 genes can tolet1 genes . One expNoncleavable cohesin phenotype raises the question as to why are chromatids locked by unresolved SCC are not recognized by checkpoints? In the case of centromeric SCC, a recent study shows that cleavage of cohesin is sufficient to separate sister chromatids, but insufficient to segregate them, unless Cdk1 is inhibited independently . This inWhen cohesin is not removed from chromosomal arms in the course of the so-called prophase pathway , a simplIt is not surprising that cohesin defects have been implicated in cancers as well as other syndromes -33, consAnother possibility for how locks between sister chromatids can be carried into anaphase is the unresolved topological links between chromatids. For example, without type II topoisomerases, chromatids cannot segregate and may potentially break during mitosis. However, the very same activity of topoisomerase II is also required for transcription and DNA replication. Therefore, topoisomerase II-defective cells do not have the ability to bypass checkpoints because of the checkpoint-recognizable DNA damage that occurs prior to mitosis. While DSB do occur in topoisomerase II-inactivated cells, it is very likely that they are of non-mitotic origin, that is they correspond to the sites of incomplete topoisomerase reactions. In contrast, the SMC complex called condensin -39 has aAs a result of both condensin binding to DNA and its Following initial reports that suggested a specific requirement of condensin at centromeres ,50-52, mXenopus chromosomes [X. laevis and humans, evidently become defective upon the loss of condensin, while smaller kinetochores of chicken cells and single-microtubule kinetochores of budding yeast had proper morphology. The observed condensin knock down phenotype in C. elegans chromosomes [While condensin mutants in yeast were shown to induce mitotic checkpoint arrest , ample domosomes . This kiomosomes , indicatomosomes , with thomosomes .Merotelic attachments are thus becoming the key to explaining the fact that human cells do not maintain substantial metaphase arrest upon depletion of condensin. These cells enter anaphase because merotelic attachments are not recognized by checkpoints. The failure to detect all merotelic attachments even in wild type cells is evident from the fact that merotely is not completely corrected prior to anaphase, and few remaining mis-attachments are still seen in anaphase . Two simWith respect to the initial premise of this review, genes encoding condensin subunits appear to clearly group with genes that we defined as one-hit drivers of genome destabilization. As was suggested above, mutations of these genes may be potentially associated with cancer genomes. Support for membership of condensin in this family has come from the fact that 8 (5%) of 159 sequenced cancer genomes and exomes in the COSMIC database contain missense mutations in condensin subunits Fig. . It remaChromosomes of eukaryotic cells fully replicate strictly once per cell division, ensuring that a daughter cell receives only one complete set of genes - no more and no less. The licensing mechanisms that prevent over-replication by limiting origin firing to once per cell cycle were investigated in depth . At the S. pombe gene, cdc20, did maintain a functional checkpoint [cdc20 mutants, however, were shown to have a very slow DNA replication [At the same time, it appears that the signal of DNA replication termination genome-wide is not as robust as one might expect. For example, as was convincingly shown in budding yeast, DNA replication that is slowed but does not produce stalled forks or abnormal replication intermediates is not recognized by any known checkpoint. Slow moving forks could be generated by drugs, naturally-occurring slow replication zones, licensing of an inadequately low number of origins, and some specific but relatively minor defects in the replication machinery itself. For example, deletions and mutations of the carboxy-terminal domain in the main subunit of DNA polymerase epsilon POL2 resulted in under-replication unrecognized by checkpoints ,72. Furteckpoint . cdc20 mlication . These rsic1 deletion in budding yeast. SIC1, a universal stoichiometric inhibitor of CDKs, is also required for setting up replication origins in G1 [sic1 mutants, indicating that two putative prerequisites for bypassing the detection of under-replication took place: slow genome-wide replication with structurally normal replication forks.Substantial support for this hypothesis was obtained upon analysis of the ns in G1 . When SIns in G1 . Incidencdc14 mutants. In budding yeast, CDC14 is a multifunctional protein phosphatase that is essential for anaphase progression and exit from mitosis [cdc14 mutants have a "classic" chromosomal bridge phenotype, with telomeres and the nucleolar organizer failing to disjoin. Even though conditional cdc14 mutations induce a tight late anaphase arrest due to the CDC14 requirement for exit from mitosis, the cells have very low viability when returned to permissive temperature, an indication of massive damage that is irreparable in anaphase. Extensive new data indicate that DNA under-replication is the essence of this damage as well as is the chief cause of chromosome mis-segregation in cdc14 mutants [cdc14 mutants enter anaphase. Especially affected are regions that normally replicate from late firing origins. Investigation of the mechanisms underlying this abnormality showed that the core defect appears to be linked to a substantial decrease in the amount of replication proteins in the nucleus, causing them to become a limiting factor for timely genome replication [sic1 mutants, analyses of the physical structure of replication forks in cdc14 mutants did not reveal any abnormalities except for a minor elongation lag, a feature consistent with RPA insufficiency. Thus, it is likely that slow moving replication itself results in incomplete genome replication being unrecognized by checkpoints.Recently, another striking example of incomplete replication undetected by checkpoints was uncovered during studies in budding yeast of the mechanistic basis for anaphase chromatid non-disjunction in mitosis -78. It i mitosis ,80. In y mutants . While elication . This delication ,82. Secolication . As a recdc14 mutants. It appears to be counter-intuitive, because CDC14 actually inactivates the anaphase-inhibiting phosphorylations generated by the S-phase-specific CDKs [cdc14 mutants, both of these processes are notably disrupted in the rDNA cluster; however a genome-wide investigation of a possible correlation between these processes has not been conducted. This hypothesis would require the assumption that CDC14 activity is not fully restricted to anaphase, that the final stages of DNA replication overlap with mitosis, or that these processes are preset in the preceding mitosis, all of which are rather controversial.One could only speculate as to why the whole genome cannot be replicated from the early origins in fic CDKs . While ofic CDKs . An altefic CDKs . The sumfic CDKs ,85,86; afic CDKs . In casecdc14 mutants is especially puzzling, considering the high degree of damage. A simple explanation is that a massive nucleo-cytoplasmic protein imbalance throws off the corresponding signaling mechanism. For example, the bulk of RFA2 was not phosphorylated by ATR/MEC1 in response to DNA damage in cdc14 cells [The failure of DNA integrity checkpoints to detect under-replication in 14 cells . Another14 cells . There i14 cells , placent14 cells , and mul14 cells . All the14 cells . The exi14 cells .cdc14 and pol2 mutants; however the role of losing individual ATR phosphorylation sites in general checkpoint responses remains to be investigated.Some more exotic explanations for the apparent lack of an identifiable signal for replication termination could be based on topological and structural chromosomal constraints instead of signaling cascades. For example, no special feedback signaling may be needed for the end of replication, if centromeres were to finish replication last, generating an automatic safety mechanism preventing the segregation of un-replicated chromosomes. This idea was discounted based on the demonstration of early replication of some centromeres in budding yeast . HoweverAs discussed previously, cell division mechanisms in general and genome integrity specifically are surprisingly vulnerable to defects that reveal themselves only in anaphase as exemplified by chromosomal bridges/locks. Both DNA damage and mitotic checkpoints are inactivated in anaphase, so that even theoretically they could neither stop chromosome segregation in its tracks nor pull back to the metaphase. The so-called NoCut checkpoint, which involves Aurora B function , also caThe key problem is then why is such a lax quality-control of chromosomes for potential anaphase bridges maintained by natural selection? Providing a general answer to this question is seemingly impossible without invoking a multilayered weakness originating from the compelling need to keep sister chromatids together and then to separate them at once (the "price of speed"). Hence, it is easy to generalize why chromosome interlocks are not recognized as damage at metaphase; it is because there is no actual DNA or kinetochore/microtubule damage before chromosomes start moving to the poles. It is much more difficult to answer why there is no efficient "intra-anaphase checkpoint" to deal with the chromosomal bridge problem. The apparent technical impossibility to pullback the runaway train of anaphase chromosome segregation to a metaphase-like state for repairs is likely to be at the core of this weakness. This basic biological inability to hold/reverse anaphase once it has started may be due to the very biochemical basis that enables both high speed and synchrony of chromosome segregation: the regulation of anaphase by protein degradation and proteolytic cleavage such as in the cases of cohesin, securin, B-cyclins and other molecules that are destroyed just before and during anaphase. To deal with this challenging task, eukaryotic cells developed a way to compact and separate their sister chromatids ahead of time, long before anaphase, due to a consorted action of condensins, topoisomerases, and other proteins via the process rather superficially designated as mitotic chromosome condensation. Cells also chose to repair damage revealed in anaphase without an arrest, "on the fly" as it were, with DNA breaks, merotelic mis-attachments, and residual catenations being continuously healed/eliminated throughout anaphase.Depending on how the chromosomal bridges are generated, there could be more specific biological reasons for uncoupling certain processes from checkpoint controls. For example, cleavage of cohesin and removal of all inter-chromatid catenations may be unrecognizable by checkpoints because residual interlocking of sister chromatids is actually needed for proper timing of anaphase. This idea is supported by the fact that late-segregating rDNA loci in yeast do segregate faster and the C. elegans cells with large kinetochores.In the case of merotelic attachments, it is clear that cells pay a price for kinetochore complexity. While budding yeast, with a single microtubule to kinetochore attachment, have no problem with merotely in mitosis, even though molecularly-related syntely is possible, higher cells have to deal with this challenge proportionally to the size of kinetochore, which relates to the number of microtubule-binding modules and their spacing Fig. . Once agWith respect to under-replication, it is extremely puzzling that ongoing replication apparently does not always send a "stop anaphase" signal. One can envision several rationales for this. One is a requirement for reparative DNA synthesis to occur throughout the cell cycle. Indeed, site-specific DNA replication is required to repair some internally generated damage after the completion of S-phase, such as during erasing of DNA methylation ,97, or pThe author declares that he has no competing interests. |
Poor methodological quality and reporting are known concerns with diagnostic accuracy studies. In 2003, the QUADAS tool and the STARD standards were published for evaluating the quality and improving the reporting of diagnostic studies, respectively. However, it is unclear whether these tools have been applied to diagnostic studies of infectious diseases. We performed a systematic review on the methodological and reporting quality of diagnostic studies in TB, malaria and HIV.We identified diagnostic accuracy studies of commercial tests for TB, malaria and HIV through a systematic search of the literature using PubMed and EMBASE (2004–2006). Original studies that reported sensitivity and specificity data were included. Two reviewers independently extracted data on study characteristics and diagnostic accuracy, and used QUADAS and STARD to evaluate the quality of methods and reporting, respectively.Ninety (38%) of 238 articles met inclusion criteria. All studies had design deficiencies. Study quality indicators that were met in less than 25% of the studies included adequate description of withdrawals (6%) and reference test execution (10%), absence of index test review bias (19%) and reference test review bias (24%), and report of uninterpretable results (22%). In terms of quality of reporting, 9 STARD indicators were reported in less than 25% of the studies: methods for calculation and estimates of reproducibility (0%), adverse effects of the diagnostic tests (1%), estimates of diagnostic accuracy between subgroups (10%), distribution of severity of disease/other diagnoses (11%), number of eligible patients who did not participate in the study (14%), blinding of the test readers (16%), and description of the team executing the test and management of indeterminate/outlier results (both 17%). The use of STARD was not explicitly mentioned in any study. Only 22% of 46 journals that published the studies included in this review required authors to use STARD.Recently published diagnostic accuracy studies on commercial tests for TB, malaria and HIV have moderate to low quality and are poorly reported. The more frequent use of tools such as QUADAS and STARD may be necessary to improve the methodological and reporting quality of future diagnostic accuracy studies in infectious diseases. Tuberculosis (TB), malaria and human immunodeficiency virus (HIV), the ‘big three’ among infectious diseases, are major global causes of morbidity and mortality. Together, they cause more than 3.5 million deaths per year.Recently, simple and robust technological platforms that allow rapid diagnostic testing at the primary health care level have greatly increased diagnostic capability, particularly in developing countries. The use of such tests for HIV is well-established, and the use of rapid diagnostic tests (RDT) in malaria control programmes is increasing.The increasing number of diagnostic tests for TB, malaria and HIV leaves regulatory authorities, policy makers and health care professionals with the difficult task of choosing the tests that would best fit their patient populations and health-care delivery systems. In order to make evidence-based decisions, they often use published diagnostic accuracy studies as a way of gathering evidence about their options. In 2003, two tools were developed with the objective of providing researchers with a standardized and validated format for assessing quality of diagnostic studies and a template for improving reporting: QUADAS and STARD (STAndards for the Reporting of Diagnostic accuracy studies).Both tools are slowly gaining acceptance in the diagnostic literature. In April 2008, it was estimated that more than 200 biomedical journals encouraged the use of the STARD statement in their instructions for authors.We searched PubMed and EMBASE (OVID interface) for primary diagnostic accuracy studies published between January 2004 and December 2006. We chose these databases because together they have a wide coverage of the health literature and would therefore enable us to obtain a fairly representative sample of indexed diagnostic studies published in the time period of interest. We limited the search to the period between 2004 and 2006 because we wanted to determine the methodological and reporting quality of diagnostic studies following the publication and dissemination of QUADAS and STARD.Mycobacterium tuberculosis’ (explode) OR ‘(tuberculosis or tuberculous).ti’] OR [‘malaria’ (explode) OR ‘Plasmodium’ (explode) OR ‘malaria.ti’] OR [‘HIV’ (explode) OR ‘HIV seropositivity’ (explode) OR ‘HIV infections’ (explode) OR ‘acquired immunodeficiency syndrome’ (explode) OR ‘HIV.ti’]} AND [‘sensitivity and specificity’ (explode) OR ‘specificity.ti’ OR ‘specificity.ab’ OR ‘accuracy.ti’ OR ‘diagn$.ti’]}. The search was limited to studies in humans.The keywords and search terms that were used included {[‘tuberculosis’ (explode) OR ‘We included diagnostic accuracy studies on commercial tests for TB, malaria and HIV that aimed to determine sensitivity and specificity of a given diagnostic test for one of these three infections. To be eligible, the studies had to be original, describe their methods, report sensitivity and specificity data and be published between January 2004 and December 2006. Languages were restricted to English, French, Spanish and Portuguese (languages that our study team was able to cover). Because commercial tests are standardized and usually test methods are well reported and easily defined, we restricted the study to commercial kits. In addition, commercial tests are more likely to be used in routine clinical practice than exclusively for research.Initially, one reviewer (PSF) screened the titles and abstracts of the citations retrieved by the electronic search (first screen). Citations that were identified as diagnostic accuracy studies were classified according to the disease .One researcher (PSF) reviewed the full text of all potentially eligible studies. A second researcher (NPP) independently reviewed 20% of all full text articles considered relevant in the first screen. Disagreements among reviewers were resolved by consensus. Two researchers (MP and PSF) created a data extraction form to be used in this review. The initial form was piloted by two reviewers (PSF and NPP) with 5% of the included publications. Based upon experience gained in the pilot, we modified and finalized the data extraction form.Data extracted only included information explicitly stated in the text. Data retrieved included the following: year of publication, journal, disease of interest, type of commercial diagnostic test, reference standard employed, and data on quality of methods and reporting (listed below). When data were unavailable or not stated explicitly, the reviewers coded the information as “not reported”. Any remaining disagreements were resolved by consensus before finalizing the data extraction.We assessed the methodological quality of studies using QUADAS.The quality assessment items included in QUADAS are: spectrum composition, description of selection criteria and reference standard, disease progression bias, partial and differential verification, incorporation bias, description of index and reference test execution, test and reference standard review bias, clinical review bias, and description of uninterpretable test results. The definition of the items listed above can be found in The quality of the reporting was evaluated using the STARD criteria.Three STARD items were scored using other criteria: the item “participant recruitment” was scored as “recruitment based on symptoms” or “other recruitment/unclear”, while the item “participant sampling” was classified as “consecutive sampling” or “other sampling strategy/unclear”. Finally, the item “data collection” was scored as “prospective” and “retrospective”.Eight out of the 25 STARD reporting items were considered essential by our group for the purposes of our project: reporting of the sampling strategy used, reference standard test, data collection methods, blinding, proportion of eligible patients that did not participate in the study, inclusion and exclusion criteria, participant recruitment and description of clinic and demographic characteristics of the study population. These items were used to compare the quality of reporting of studies after stratifying them by disease .In order to determine the frequency of use of STARD in diagnostic accuracy studies, we searched the full-text of all the included papers for any explicit mention of their use by the authors. Furthermore, in September 2008, we accessed the sections containing “information for the authors” (author guidelines) on the websites of all the journals in which the included papers were published. In doing so, we wanted to determine if the use of STARD was required when submitting a diagnostic accuracy manuscript to these journals.Descriptive statistics were used to summarize the number and proportion of included studies that met the QUADAS and STARD criteria. We carried out a qualitative synthesis of the study characteristics, and quality of the methodology and reporting. Since the studies were heterogeneous with respect to diseases , we decided to present overall results, as well as results stratified by disease subgroup. We also stratified the results by year of study publication in order to capture any temporal change since the publication of the STARD and QUADAS guidelines.We identified a total of 3,529 potentially relevant citations from the database searches. After the first and second screens, a total of 90 full-text studies were eligible for inclusion in this systematic review .The characteristics of the included studies are shown in No study explicitly mentioned using STARD for preparing the manuscript . When the journal websites of the 46 journals that published the included papers were searched in September 2008, only 10 of them (22%) required the authors to use STARD when submitting diagnostic accuracy study manuscripts.The overall results of the quality assessment using QUADAS, as well as the results after stratification by disease and year of publication are presented in The majority of studies used an adequate reference standard test (96%), and did not suffer from incorporation and partial or differential verification biases . Reference standard tests considered “adequate” for TB, malaria and HIV were, respectively, sputum culture, blood smear examination and ELISA and/or Western Blot. Nevertheless, all 90 studies included in this systematic review had at least one design flaw. The most commonly noted problems were associated with poor description of test execution, withdrawal of patients, and interpretation and reporting of test results.Quality items that were reported in less than 25% of the studies included description of withdrawals (6%), adequate description of the reference test execution (10%), absence of index test review bias (19%), report of uninterpretable results (22%), and absence of reference test review bias (24%). Two other quality items were clearly described in less than 50% of the papers: index test execution (28%) and absence of clinical review bias (38%). Finally, a clear description of selection criteria and adequacy of spectrum composition, which are essential quality items for diagnostic accuracy studies, were reported in only 51 and 62% of studies, respectively.Specific problems with some quality items were detected after we stratified the studies by disease and year of publication. In TB and HIV diagnostic accuracy studies, a clear description of selection criteria was present in less than 50% of time . Moreover, the same item was reported in only 48% of the study sample published in 2006.Furthermore, the results stratified by disease showed that HIV diagnostic accuracy studies met fewer of the methodological quality criteria when compared to those of TB and malaria. HIV studies were affected by higher prevalence of important biases such as partial (19%) and differential (37%) verification, incorporation (7%) and clinical review (70%) biases.Finally, when the results were analyzed according to year of publication, we observed that in 2006, compared to previous years, a greater number of studies adequately described the index (37%) and reference standard (22%) tests used, as well as withdrawals (11%). These numbers, however, can still be considered very low.Nine STARD items were reported in less than 25% of the studies: methods for calculation and estimates of test reproducibility (0%), adverse effects of the diagnostic tests (1%), estimates of diagnostic accuracy between subgroups (10%), distribution of severity of disease/other diagnoses in study participants (11%), number of eligible patients who did not participate in the study (14%), blinding of the test readers (16%), and description of the team executing the test and management of indeterminate, invalid/outlier results (both 17%).Two other STARD items were poorly reported (less than 50% of time): participant sampling method (31%) and statistical methods to calculate diagnostic accuracy and uncertainty/precision (47%). When specifically analyzing the reporting of results' uncertainty, we observed that only 22 of the studies (24%) presented 95% confidence intervals.When stratifying the studies by disease, HIV diagnostic accuracy studies met fewer of the reporting standards compared to those of TB and malaria diagnostics. Reports of HIV diagnostic accuracy studies failed, more frequently, to describe 5 out of 8 reporting items considered essential by our group: sampling strategies used (reported in 22% of studies), reference standard test , data collection methods (reported in 78% of studies), blinding and proportion of eligible patients that did not participate in the study (reported in only 7% of studies). The 3 other reporting items considered essential were inclusion and exclusion criteria, participant recruitment and description of clinic and demographic characteristics of the study population.Analysis by year of publication, revealed that in 2006, a greater number of studies reported the recruitment strategies used (63%), technical specifications of material and methods (100%), characteristics of study population (70%), number of eligible patients that did not undergo index/reference standard test (24%), distribution of severity of disease (24%) and estimate of diagnostic accuracy and 95% confidence intervals (100%) compared to previous years. However, it is important to highlight that the more frequent reporting of items such as description of material and methods does not mean that the quality of the report was adequate.TB, malaria and HIV are major killers with enormous global burden. High-quality evidence on diagnostics is critical for the development of evidence-based policies on diagnosis, and, ultimately, for effective control of these global epidemics.Our results show that diagnostic studies on TB, malaria and HIV commercial tests published between 2004 and 2006 had moderate to low methodological quality and were often poorly reported. Sources of bias and variation were present in all the studies, and important criteria for determining the presence of bias were often either not mentioned or unclearly reported. At least for TB and malaria, these results are consistent with previous observations made by several researchers.Most worrisome is the fact that essential methodological elements, such as selection of a representative population and blinding, were not used and/or not reported by many researchers. Furthermore, only a small proportion of the studies adequately described the execution of both reference (10%) and index (28%) tests, and no study reported on reproducibility. The implications of the under-reporting of these elements are several. For example, the value of sensitivity and specificity estimates are unclear in the absence of clear information about test reproducibility. Moreover, if a reference standard is imperfect or poorly done, then this can potentially under-estimate or over-estimate the accuracy of a test. If the index test is poorly described, other researchers cannot replicate the study results .The major strength of this study is the systematic search for diagnostic accuracy studies via PubMed and EMBASE, two of the most widely used health literature databases. Furthermore, we used rigorous methods to select studies and abstract data, the latter independently conducted by two trained researchers.The use of both QUADAS and STARD to evaluate diagnostic accuracy studies is also a strength of this systematic review. Both tools were developed by experts with the respective aims of assessing the quality of diagnostic studies included in systematic reviews and improve the quality of reporting of diagnostic studies in general. Furthermore, QUADAS and STARD are well standardized and easy to implement.An important limitation of our study is that we did not compare our results to a sample of studies published before the publication of QUADAS and STARD instruments . Consequently, we can provide information about the current quality of methods and reporting of diagnostic studies, but not about changes in quality or reporting over time.Wilczynski and colleagues compared the quality of report of papers published in journals that endorsed STARD versus those that did not .Another limitation of our study is the fact that we decided to only record information that was clearly stated in the paper, coding as “not reported” when data were not available. Thus, it may be possible that methodological quality items were met in the actual study, but not reported. Because we did not contact all the authors, we were unable to resolve this issue.Poor quality of diagnostic studies is a recognized problem. After the publication of QUADAS and STARD in 2003, the expectation was that the methodological quality of diagnostic studies, and the quality of their reporting, would improve over the years. Unfortunately, this objective seems to be far from being achieved, at least with respect to diagnostic studies on major infectious diseases.Uniform Requirements for Manuscripts Submitted to Biomedical Journal (URM) created by the International Committee of Medical Journal Editors (ICMJE), which recommends authors to use “reporting guidelines relevant to their specific research design”, such as STARD.Our results suggest that STARD is probably not used by researchers as often as expected or desired, at least in the field of infectious diseases. Furthermore, we have shown that, based on the results of a search performed in September 2008, only 22% of the journals in our study sample required authors to use STARD when submitting a diagnostic accuracy manuscript for publication. Consequently, we hypothesize that fact that not many journals require authors to use STARD may be one of the causes behind the lack of improvement of reporting of diagnostic studies over time. When we repeating this search in October 2009, we observed that this number increased to 50%, probably due to the adoption of the Decreasing the burden of TB, malaria and HIV is a priority worldwide, and the provision of universal, high-quality and affordable diagnostic tests to affected populations is the first key step to achieve this goal. Regulatory authorities, policy makers and healthcare professionals frequently use diagnostic accuracy studies to decide which test should be implemented in a particular setting. However, choices based on biased study results may lead to detrimental consequences.Lack of methodological rigour in diagnostic trials is a cause for concern as it may prove to be a major hurdle for effective application of diagnostics in controlling TB, malaria and HIV. Depending on how the presence of bias affects the estimates of diagnostic accuracy, a large number of patients could be harmed by not being properly diagnosed and consequently not receiving adequate care. Thus, due to the negative implications that biased studies can present, efforts are urgently needed to improve quality of diagnostic research as well as quality of reporting. The more frequent use of tools such as QUADAS and STARD could aid in this process. While not designed with this intent, QUADAS, for example, could be used by researchers as a guideline when designing diagnostic studies, as it describes all the quality elements that should be present in this type of study. QUADAS can also be used as an educational tool, to help train researches in improving research design. STARD can be very useful at the manuscript development stage. However, because voluntary use of tools such as QUADAS and STARD is likely to be limited, their widespread use will probably only happen if more journals explicitly required and mandated authors to use these tools.While improving diagnostic accuracy studies is a good starting point, efforts must also be made to go beyond test accuracy and generate evidence on patient-important outcomes that can inform policy and guideline development. For example, much of the existing evidence-base in TB is focused on test accuracy In conclusion, our data suggests that recently published diagnostic studies on commercial tests for TB, malaria and HIV are of moderate to low quality and are poorly reported. Essential methodological and design elements were often either not reported or poorly reported. The more frequent use of tools such as QUADAS and STARD may be necessary to improve methodological quality and reporting of future diagnostic accuracy studies in infectious diseases. This may happen only when more journals require authors to use instruments such as STARD. |
The NiII ion, lying on an inversion centre, is four-coordinated in a square-planar geometry by two phenolate O and two imine N atoms from two symmetry-related 2-iminomethyl-5-methoxyphenolate ligands. In the crystal, molecules are linked into corrugated layers parallel to (100) by N—H⋯O hydrogen bonds.The title compound, [Ni(C DOI: 10.1107/S1600536809039233/ci2923Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
We compare the direct electron imaging performance at 120 keV of a monolithic active pixel sensor (MAPS) operated in a conventional integrating mode with the performance obtained when operated in a single event counting mode. For the combination of sensor and incident electron energy used here, we propose a heuristic approach with which to process the single event images in which each event is renormalised to have an integrated weight of unity. Using this approach we find enhancements in the Nyquist frequency modulation transfer function (MTF) and detective quantum efficiency (DQE) over the corresponding integrating mode values by factors of 8 and 3, respectively. From Eq. The signal to noise ratio in an electron microscope image of a radiation sensitive sample is limited by the small number of incident electrons that can be used to form the image before radiation damage destroys the specimen. In the study of radiation sensitive samples the electron detector performance therefore assumes a greater importance than with less radiation sensitive samples. A convenient way to measure the performance of a detector is with the detective quantum efficiency (DQE). At zero spatial frequency this is defined asMonolithic active pixel sensors, MAPS, show great promise as direct detectors of electrons with energies between 100 and 300 keV typically used in an electron microscope In a MAPS detector, incident electrons or photons are detected via the voltage drop across a capacitor resulting from the collection of mobile charge associated with electron–hole pair excitations generated in a sensitive layer consisting of a highly ordered epitaxially grown semiconductor. To maximise the response and minimise the reset noise, the associated capacitance is usually kept as small as possible The performance of a MAPS detector in recording electrons can be optimised through the choice of pixel size as well as the thickness of the passivation, sensitive layer and substrate together with the use of low noise readout. When operated in integrating mode the performance is limited by a number of factors. In particular the intrinsic variability of the energy deposited along the stochastic trajectory followed by an incident electron through the sensitive layer and the blurring of the resulting signal by the diffusion of charge carriers within the sensitive layer. In this paper we show that it is possible to minimise these factors and produce improved images by computational analysis of the signals from individual incident electrons.2Images were recorded on an experimental MAPS detector fabricated as part of the MI3 collaboration The detector was mounted at the plate camera position in a Philips CM12 microscope operating at 120 keV. The electron dose was calculated from the microscope exposure meter which was cross calibrated, via film images, with a Faraday cup on an adjacent microscope. The actual number of electrons per frame was controlled by varying the magnification of the microscope. Single event images were typically collected using approximately 1 electron per 500 pixels so that a data set with a total of 15 electrons per pixel requires 55 s to collect, consists of nearly 8000 frames and requires 4 GB of storage. While it is useful to retain all the images it was also possible to retain only the single events or simply the final processed image. The detector does not employ correlated double sampling and all images are dark subtracted and gain normalised.To find the single events we first search for a seed pixel in which the signal is above a fixed threshold relative to the background. Having found a seed pixel the remainder of the corresponding event is obtained by including all neighbouring pixels that either have signal above the threshold, or are within a given distance of any other pixel that is above the threshold. Because of the high signal to noise, the choice of threshold is not critical. The threshold is typically taken to be as low as possible, so as to minimise the number of true events missed, but yet sufficiently high, so as to avoid generating false events. As the size of each event is limited, the search can be carried out in a cache efficient manner along a row following a few rows behind the current rolling shutter readout window. This enables the finding and processing of the individual events to be carried out during the acquisition of images, though in practice the analysis presented here was done off-line.Single event images can be analysed in many ways. Simply counting those pixels in which the signal exceeds a given threshold mimics the behaviour of the Medipix2 hybrid pixel detector see Eq. . With thThe MTF was measured using the well-known edge method The 3In A comparison of the measured The enhanced imaging performance possible by using the single electron mode is further illustrated in 4When operating in electron counting mode the DQE performance at 120 keV presented in Even with the improved performance available through using the electron counting mode, any practical detector for use in low dose applications such as single particle cryoEM or cryo-tomography will require a larger field of view than is available with the Vanilla sensor used here. While it is possible to compensate for sample drift during image acquisition, higher frame rates would be advantageous in reducing the overall time for an exposure. Higher frame rates would also increase the apparent rad-hardness of a detector due to the reduction of the integrated leakage current contribution in an individual frame. On the other hand, longer exposure times enforce a welcome increase in spatial coherence and corresponding improved microscope envelope function.The Vanilla detector does not employ a radhard design and, on top of the increase in leakage current, the exposure to the direct beam results in transient hot pixels. In particular, while the use of a hard reset minimises any image lag, occasionally there is a noticeable long lasting response in a pixel after an event. As this can be above the threshold it will lead to erroneously recording duplicated events. Fortunately such events are typically restricted to a single pixel and can be distinguished from true events, such as those illustrated in In this paper we have shown that it is possible to obtain both higher MTF and DQE performance from a MAPS detector by operating it in an electron counting mode. We show that using renormalised single event images as an effective probability distribution for the incident electrons arrival position provides an efficient and effective method for processing single electron events. This method, as opposed to choosing the position of the maximum signal or centroid of an event, leads to an improvement in the DQE over all spatial frequencies. We believe that, despite the more than |
Acetonitrile was used to simultaneously deproteinize rat plasma and extract metformin. The assay was linear in the concentration range of 0.33 μg-16.6 μg/ml with co-efficient of correlation 0.994. The retention time was 4.7 min. The method was found to be precise (% CV < 15%), accurate and suitable for pharmacokinetic study of orally administered metformin in rats.A simple reverse phase high-performance liquid chromatographic method has been developed for determining the concentration of metformin in rat plasma. The method employs C As itsMetformin was a generous gift by Zim Laboratories Ltd., Nagpur, India. Acetonitrile (HPLC grade) and ammonium acetate (AR grade), were purchased from Ranbaxy Chemicals, India (Rankem). Freshly double distilled, deionised water filtered through 0.45 μ nylon filter in Millipore unit (USA) was used throughout the experiments. Standard solution of metformin (1 mg/ml) was prepared in mobile phase and kept at 4-8°. Fresh stock solutions were prepared every week. The serial dilutions of stock solution were made to obtain working standard solutions of 0.5, 1.0, 2.0, 5.0, 10.0, 15.0, 20.0, 50.0 μg/ml strength. These solutions were freshly prepared every week and stored at 4-8°.ad libitum. The Institutional Animal Ethics Committee (IAEC) approved the use of animals. Whenever required, blood (1.0 ml) was withdrawn by micro-capillary technique from retro-orbital plexusSprague-Dawley rats (220-250 g) of either sex housed under the controlled conditions of temperature and humidity with dark/light (12/12 h) cycle and received a standard pelleted diet and water 18 column at a rate of 1 ml/min. Detection of metformin was carried out at 236 nm at ambient temperature. The data were interpreted using CSW (chromatographic work station) data acquisition software. The chromatographic study was carried out using Shimadzu 10AT/Vp HPLC system, having in-built degasser unit (DGU 14A), mixer unit (FCV 10AL) attached to solvent delivery module with low-pressure gradient pump (LC 10AT), Rheodyne injector port and UV/Vis detector (SPD 10A). The mobile phase was prepared by mixing 0.15 M ammonium acetate (pH 5.5) and acetonitrile in the ratio of 90:10; it was filtered through 0.45 μ membrane filter. The elution was carried out on C Calibration curve was established by spiking rat plasma (500 μl) with known amount of metformin to obtain 0.33, 1.66, 3.33, 5.0, 6.66, 16.60 μg/ml. The lowest concentration of the analyte that gives at least 5 times the response as compared with blank was considered as the limit of quantitation (LOQ). Quantitation of metformin in rat plasma was done by reading the analyte response against the calibration curve.In order to determine the intra-day and inter-day accuracy and precision, the concentration of metformin present in five replicates of plasma spiked with 3.33, 5.00, 6.66 μg/ml metformin was estimated by HPLC within a day or on three consecutive days. 85-115% accuracy and coefficient of variation values < 15% except at LLOQ (accuracy 80-120% and CV ≤20%) were considered acceptable.Recovery of metformin from plasma was estimated at 3.33, 5.00, 6.66 μg/ml concentrations by comparing peak area of spiked plasma standards with those of corresponding plain standards containing the corresponding concentration in mobile phase that represent 100% recovery.Analyte stability in plasma was tested at 3.33, 5.00, 6.66 μg/ml concentrations in replicates of three for one freeze-thaw cycle, long term (30 days), and short term (24 h) stabilities. Initially, a plasma standard containing above concentrations were prepared and divided into four fractions. One fraction was analyzed immediately and its area was noted. The other three fractions were stored, two at -20°, and remaining at room temperature. The sample kept at room temperature was analyzed after 24 h. One of the samples kept at -20° was analyzed after one freeze-thaw cycle and the other was analyzed after one month storage. The peak area at the end of the study was compared with that of the standard and stability was calculated.For studying the pharmacokinetics of metformin by using the above developed method, metformin (320 mg/kg) was administered orallyIn the present method, acetonitrile was used to deproteinize plasma and simultaneously extract metformin. The recovery studies indicate18 column using 0.15 M ammonium acetate (pH 5.5) and acetonitrile in the ratio of 90:10 as mobile phase, hled to a distinct curve for metformin at 4.7 min with good linearity indicating the preciseness and accuracy of the developed method. Most of the methods used potassium dihydrogen phosphate and acetonitrile in the mobile phase and used cyano or C8 column. However, our preliminary attempts revealed that use of ammonium acetate instead of potassium hydrogen phosphate in the mobile phase gives better resolution of metformin. This may be because metformin is a biguanide and possess amino groups and hence amino group possessing component in the mobile phase may be responsible for giving better resolution.When metformin extracted by acetonitrile from plasma was injected onto CIt was further noted that concentration of acetonitrile in mobile phase played a major role in the resolution of peak. At 10% concentration, the peak for metformin was optimally resolved with asymmetry of 0.9-1.4 and theoretical plates 18000-22000 tp/m. At higher concentration (>20%), the peak was broad whereas at lower concentration (< 10%), there was a tailing of peak which could be reduced by changing the pH of ammonium acetate buffer to 2.5. However, such acidic pH is not suitable for the life of the column. Therefore, 10% acetonitrile in the mobile phase was found more appropriate. In another experiment, methanol was used instead of acetonitrile for plasma preparation as well as in mobile phase. However, the ultimate peak height for metformin was very small and hence methanol was considered unsuitable.The typical chromatograms obtained2 = 0.994). The inter-day and intra-day estimations of metformin revealed the reproducibility of the results irrespective of time and day. The calculated values of accuracy and precision at 2.5±0.115 h (Tmax ) and AUC as 46.52±0.21 μg.h.ml-1 (The plasma level-time study of metformin in rats indicated highest metformin concentration in plasma to be 7.2±0.09 μg/ml (Cg.h.ml-1 . Seconda |
Recent reports suggest that the product of hepatitis B virus (HBV) interacts with p53 and that the hepatitis C virus (HCV) core protein reduces p53 expression. A novel p73 gene, which is related to p53, has recently been identified and mapped to chromosome 1p36.3, which is a locus of multiple tumour-suppressor genes for many cancers, including hepatocellular carcinoma (HCC) and neuroblastoma. Here, we investigated mRNA expression, allelotype and mutation of p73 in 48 HCCs obtained from untreated patients. Reverse transcriptase polymerase chain reaction (RT-PCR) revealed that p73 mRNA was expressed ubiquitously at low levels in all the tumour tissues, as well as in the adjacent normal liver tissues. The frequency of p73 loss of heterozygosity was observed in 20% of HCCs, but PCR-single strand conformation polymorphism (SSCP) analysis showed no mutations in the 48 tumours except for three types of polymorphisms. These results suggest that p73 may play a role in hepatocellular carcinogenesis in a different manner from a Knudson two-hit model. The regulatory mechanism of interaction between p73 and hepatitis viruses remains to be determined. © 1999 Cancer Research CampaignAccumulating evidence has demonstrated that aberration of the |
Recent studies of rodent populations have demonstrated that certain parasites can cause juveniles to delay maturation until the next reproductive season. Furthermore, a variety of parasites may share the same host, and evidence is beginning to accumulate showing nonindependent effects of different infections.We investigated the consequences for host population dynamics of a disease-induced period of no reproduction, and a chronic reduction in fecundity following recovery from infection (such as may be induced by secondary infections) using a modified SIR model. We also included a seasonally varying birth rate as recent studies have demonstrated that seasonally varying parameters can have important effects on long-term host–parasite dynamics. We investigated the model predictions using parameters derived from five different cyclic rodent populations.Delayed and reduced fecundity following recovery from infection have no effect on the ability of the disease to regulate the host population in the model as they have no effect on the basic reproductive rate. However, these factors can influence the long-term dynamics including whether or not they exhibit multiyear cycles.The model predicts disease-induced multiyear cycles for a wide range of realistic parameter values. Host populations that recover relatively slowly following a disease-induced population crash are more likely to show multiyear cycles. Diseases for which the period of infection is brief, but full recovery of reproductive function is relatively slow, could generate large amplitude multiyear cycles of several years in length. Chronically reduced fecundity following recovery can also induce multiyear cycles, in support of previous theoretical studies.Microtus agrestis) of Kielder Forest (northern England), the model predicts that the disease must chronically reduce host fecundity by more than 70%, following recovery from infection, for it to induce multiyear cycles. When the model predicts quasi-periodic multiyear cycles it also predicts that seroprevalence and the effective date of onset of the reproductive season are delayed density-dependent, two phenomena that have been recorded in the field.When parameterized for cowpox virus in the cyclic field vole populations ( Effects of disease on host population dynamics come about fundamentally via effects on host fecundity rates, survival rates, or both. Such effects have been demonstrated in a range of wild populations (summarized in Clethrionomys glareolus Schreber) and wood mice (Apodemus sylvaticus L.) in UK deciduous woodland (Manor Wood), Microtus agrestis L.) populations in UK grassland habitat (Kielder Forest) are related significantly to past population densities, with similar lags ], with no births possible in the non-reproductive season (A = 0) and a constant maximum per capita birth rate in the reproductive season (A = a). Using other birth rate functions, such as a sinusoidal function (a must be greater than b for voles (and the disease) to persist in the model; a > b is therefore assumed throughout this study. The birth rate is assumed to be density dependent and is modified due to a susceptibility to crowding coefficient, q, which is related the carrying capacity K = (a – b)/aq.Here SI/N) does not affect our findings qualitatively (not shown). Infected individuals potentially have an increased mortality rate due to effects of the disease (α), and recover at a constant rate γ. Recovered individuals initially enter an immune but non-reproductive class which they leave at rate τ and regain a proportion of their reproductive capacity f(0 < f < 1). The total average reproductive delay following infection is therefore (1/γ) + (1/τ) years.We assume density-dependent transmission at rate β, although assuming frequency dependent infection rates (βr = a – b) reflect, at least partly, our uncertainly in the true parameter values, although true differences are expected between the different species considered. We examined a broad range of disease parameter values for each set of rodent parameters to 1 week (γ or τ = 52 year−1). The transmission rate, β, was varied between high (β = 0·9 ha year−1) and low (β = 0·05 ha year−1) infectivity. Disease-induced mortality was varied from a 50% mortality per month (α= 8·4 year−1) to no mortality (α = 0). We explored the full range of reduced fecundity following infection, f, from f = 0 to f = 1.The model parameters can be divided into two groups: those that are specific to the rodent populations and are independent of the disease, and those that describe the effects of the disease on the rodent populations. We chose five combinations of the rodent specific parameters from published data sets to represent estimates from a variety of rodent populations , which is the expected number of secondary infections produced on average per infected individual and increases monotonically to S = K when A = a (reproductive season equations). It is also straightforward to show that the long-term dynamics predicted by equation 1, when A = 0 and disease is present, is for the exponential decay of all component population densities to zero. For the reproductive season equations (A = a), the disease can become endemic in the population if K > SC. In this case, for most values of the other parameters, an equilibrium is approached through a series of damped oscillations to S = SC. The parameters τ and f have no effect on inequality (equation 2), and therefore will ultimately have no effect on the regulation of the host population. However, they do influence the equilibrium population densities of I, Y and Z, and the rate at which these equilibria are approached can be solved analytically (see L < b/a) then the host population will decay to zero over time, whereas if L > b/a then the long-term dynamics will be annual cycles that are repeated exactly each year.In the absence of disease, the full seasonal model or all the population components, due to the seasonally varied birth rate. To aid clarity, below we define ‘regular annual cycles’ as the cases where the annual oscillations are repeated exactly every year as in and ‘mulSC at the same time every year to this event occurring relatively late in one year and relatively early in the following year. Analysis of this transition reveals that the critical reproductive lag at which this transition occurs, τC, is dependent upon the initial population densities used in simulations. In particular, between 1/τ = 23 days and 1/τ = 66 days in The key difference between the model predicting regular annual cycles and multiyear cycles is a difference in the rate at which the susceptible population recovers following a population crash. If this rate allows the period of oscillation of the host–disease dynamics to match the period of seasonal forcing (i.e. 1 year), usually with one or two annual disease oscillations per year, then the model settles on regular annual cycles. For example, when the time taken to recover reproductive function is sufficiently fast in SC later in the reproductive season. Reducing τ and/or f (which increases the recovery lag) and varying other parameters (more details in next section) can all reduce the rate at which the susceptible population recovers from low densities. This, in turn, can induce multiyear cycles.As 1/τ is increased further in SC, also resulting in multiyear cycles. In a few rare scenarios, increasing the time it takes for the susceptible population to recover from a population crash can result in a transition from multiyear cycles to regular annual cycles. Such transitions are associated with a reduction in the number of disease outbreaks per year. For example, when the model predicts multiyear cycles with the disease breaking out on average twice a year, reducing the rate of recovery of the susceptible population following a population crash can then cause the disease to break out only once a year and can induce regular annual cycles.The smallest value of τ (1/τ≅ 1·6 years) in C) required to induce multiyear cycles . Slightly above the critical reproductive season length necessary for the voles to exist (L = b/a = 0·35 in L < 0·39), and slightly beyond this is a small region in which the disease persists at such low prevalence that it has only a minor impact on the host population (0·39 < L < 0·41).In L < 0·57) in which the disease induces multiyear cycles for all values of τ. Note, however, that in this region the presence of the disease is still necessary to induce multiyear cycles. For higher reproductive season lengths there is a region (0·57 < L < 0·94) in which τC is a non-monotonic function of reproductive season length. Analysis of the numerical dynamics along the τC line reveals that the ‘bump’ (at L = 0·78) corresponds to the transition between the disease breaking out once a year (lower L) and twice a year (higher L). Therefore, once the reproductive season is sufficiently long, the disease can have a significant impact on the stability of the multiyear host population dynamics.Once the reproductive season length is sufficiently long there is a region (0·41 < L > 0·94), there is a region in which multiyear cycles do not occur for any values of τ of the other parameters. The individual 1/τ against f plots all share some basic features. Regular annual cycles are predicted when the rate of recovery of reproductive function is fast and f is large and multiyear cycles are predicted when the rate of recovery of reproductive function is slow and f is small are qualitatively similar to those when recovery of reproductive function following infection is instantaneous [τ = ∞ (not shown)], in which case the model collapses down to a classical host–parasite framework . The effect of variation in γ appears more complicated, with the size of parameter space predicting multiyear cycles sometimes initially contracting, and then expanding, as 1/γ is increased from 7 days to 2 years (explained below).Each subfigure in , f = 0) . Betweenf would mean that even if individuals did recover they would not make a large per capita contribution to the susceptible population. Low values of τ, γ and f therefore cause the time taken for the susceptible population to recover from a disease outbreak to be relatively long and, as shown in the previous section, this can induce multiyear cycles. However, a rapid recovery rate from infection (1/γ ≤ 1 month) can also increase the time it takes the susceptible population to exceed SC. This is because increasing γ also increases CS, and if the recovery rate is sufficiently rapid (1/γ ≤ 1 month) SC can get close to, but still be less than, K. In these scenarios, density dependence slows down the growth of the susceptible population as it approaches CS. This increases the date at which the infection threshold is exceeded, and this extra time delay is sufficient to cause multiyear cycles in these cases.In rodent populations, long reproductive delays following infection (1/τ and 1/γ ≥ 1 year) would mean that most rodents would die before recovering their reproductive ability. Similarly, a small r = 2·5 and 1·8, respectively) which increase the time taken for the susceptible population to recover following a disease outbreak. The high maximum population density of the French common vole populations (K = 2000 voles ha−1) allows them to support endemic infections with lower infection rates (r < 5).The importance of the host population parameters to the model predictions is also apparent in on rates . In thisinations . Multi-y, f = 0) . The modf values that a disease such as cowpox virus, and potential secondary, possibly chronic infections, would need in order to induce multiyear cycles in their host populations. We estimated disease parameters from studies of the cowpox virus in the Kielder Forest and Manor Wood rodent populations (We performed a more detailed exploration of the region of model parameter space that corresponds to cowpox virus in Kielder Forest field voles. Our aim was to estimate the τ and ulations and provf = 0·2) then the host population will exhibit multiyear cycles for all reproductive lags . We explored plots of 1/τ against f for different values of the other disease parameters. This caused some changes in the size of the parameter space predicting multiyear cycles and in the period and amplitude of the multiyear cycles; however, the results did not differ qualitatively from those in The model predicts that if cowpox virus infection has a sufficiently large impact on rodent fecundity following recovery from infection (ive lags . HoweverI, Y and Z classes, was correlated significantly with the population density at various times in the past. We selected simulations with quasi-periodic multiyear cycles, from our detailed exploration of parameter space outlined in the previous section, to investigate these relationships. This is because quasi-periodic multiyear cycles give a range of values for these output variables when the population is sampled at the same time for multiple years. This avoids having to incorporate noise into the model to obtain a range of different values for which to analyse correlations.We investigated whether two phenomena that have been observed in studies in Kielder Forest are predicted by the model, namely delayed density-dependent seroprevalence of cowpox virus . AlthougOur key finding is that both delayed reproduction following microparasitic infection and reduced fecundity following recovery from infection can destabilize the multiyear dynamics of host populations. It is already known that disease-induced reductions in fecundity can destabilize host population dynamics . Dobson We included a seasonally varying birth rate because it features so widely across rodent populations with cyclic dynamics. Seasonal forcing has been incorporated in a variety of ways into other theoretical studies, most commonly in the infection rate and woulTo date, it has been shown that acute cowpox virus infections affect subadult maturation rates only in bank voles and wood mice . The impThe findings of For the Kielder Forest field vole–cowpox interactions, our results show that the disease could cause multiyear cycles, provided that its effects on fecundity are sufficiently strong . IrelandThe fact that two previously unexplained phenomena, delayed density-dependent seroprevalence and onset of reproduction in the spring, are predicted by our model supportsCould repeated multiyear cycles in certain microtine rodents be caused by diseases acting singly or in combination? The wide range of realistic parameter values for which disease-induced cycles are predicted by our model suggests |
While distinct cell types might process synaptic inputs into different patterns of action potentials representing specific “motifs” of network activity, standard methods of electrophysiology are not well suited to resolve such questions. In the current paper we performed dynamic clamp experiments with simulated synaptic inputs that were presented to three types of neurons in the juxtacapsular bed nucleus of stria terminalis (jcBNST) of the rat. Our analysis on the temporal structure of firing showed that the three types of jcBNST neurons did not produce qualitatively different spike responses under identical patterns of input. However, we observed consistent, cell type dependent variations in the fine structure of firing, at the level of single spikes. At the millisecond resolution structure of firing we found high degree of diversity across the entire spectrum of neurons irrespective of their type. Additionally, we identified a new cell type with intrinsic oscillatory properties that produced a rhythmic and regular firing under synaptic stimulation that distinguishes it from the previously described jcBNST cell types. Our findings suggest a sophisticated, cell type dependent regulation of spike dynamics of neurons when experiencing a complex synaptic background. The high degree of their dynamical diversity has implications to their cooperative dynamics and synchronization.Neurons display a high degree of variability and diversity in the expression and regulation of their voltage-dependent ionic channels. Under low level of synaptic background a number of physiologically distinct cell types can be identified in most brain areas that display different responses to standard forms of intracellular current stimulation. Nevertheless, it is not well understood how biophysically different neurons process synaptic inputs in natural conditions, i.e., when experiencing intense synaptic bombardment The biophysical mechanisms underlying the conversion of synaptic inputs into action potentials have been subject of intense experimental and theoretical research In the present paper we used synthetic synaptic inputs introduced with dynamic clamp to stimulate biophysically distinct types of neurons in a brain slice preparation. The bed nucleus of stria terminalis (BNST), the subject of our investigation, is a brain area that plays an important role in the regulation of stress and reward. The BNST is part of the extended amygdala, an anatomical macrostructure that comprises several basal forebrain structures to form a grey matter continuum sharing similarities in morphology, neurochemistry and connectivity The jcBNST contains three types of physiologically different GABAergic interneurons. These cell types have different amounts of specific voltage-gated membrane conductances such as the hyperpolarization-activated nonspecific inward current, the transient K- current or the low-threshold Ca-current h, and the absence of rebound firing after release from hyperpolarization . Type III neurons (n = 35) did not have either a depolarizing sag or rebound firing, but exhibited rectification with hyperpolarizing current injection via dynamic clamp. The noisy input consisted of an excitatory and an inhibitory presynaptic waveform, two trains of artificial spikes both having a mean firing rate of 30 Hz and Gaussian distributed interspike intervals with a standard deviation of 25 ms. This stimulation proved to be efficient to induce vigorous and complex firing patterns in the jcBNST neurons so they visited a wide dynamical range of their activity space. At the same time, the impact of individual EPSPs and IPSPs on the postsynaptic firing could be accurately evaluated, because, on average, there was a 15 ms separation between consecutive synaptic events.mean reliability and precision are temporal measures of the entire spike response (multiple presentations of the same input) and they are calculated by averaging the reliability and precision values determined for the individual spike events. These measures are pooled and shown for the three different cell types in First we compared spike responses of the 3 jcBNST neuronal types under frozen noise stimulation via dynamic clamp as shown in As noted above, type III neurons were the most hyperpolarized and required stronger depolarization to fire. Hence, a particular set of conductance parameters that was effective in driving vigorous firing in a type I or II neuron was usually ineffective for a type III neuron. However, comparing spike responses of various types of jcBNST neurons required not only that they received the same temporal pattern of synaptic input but also that they fired nearly the same number of spikes during the stimulation (under one sweep of the stochastic input). Hence, we made an effort to keep the spike count constant across different neurons. A target spike count of 20 was used in most experiments meaning that the 5 s stimulus was expected to evoke approximately 20 spikes in each successive trial of the experiment. As shown in the example of As anticipated from their passive electrical properties, different types of neurons required different values of maximal conductances to emit the targeted number of spikes. One way to determine the required parameter settings was to change the 3 maximal conductances manually (but keeping the 1/1/2 ratio) and to observe the spike response in one or two successive trials. The target spike number was typically found after testing 3 or 4 parameter settings. However, in most cases we used a more efficient and systematic method by automatically incrementing the synaptic conductance values in the dynamic clamp (by scripting). Here we set a low initial value for the maximal conductances (e.g. 2/2/4 nS) and increased those in small equal steps in the successive trials. These experiments revealed interesting features of the spike responses and showed how spike timing reliability/precision depended upon the strength of the EPSPs.As noted, gradual amplification of the synaptic inputs resulted in increase of the spike count rather than re-patterning of the response. Still, newly arriving spikes imposed a profound effect on the timing of ones already present in the response. For instance, when an EPSP became suprathreshold and a new spike appeared in the spike train, it imposed a shifting effect on an adjacent “old” spike that was already present in the previous trials 2 and A3The experiments with gradually increasing synaptic inputs described above provided information on the conductance dependence of the spike number and precision of spike timing. When the target number of spikes was achieved, we repeated the stimulation with fixed maximal conductances for the three synaptic inputs. Due to the different biophysical properties of the three main types of jcBNST neurons, i.e. differential expression of their specific voltage gated membrane conductances, we expected that they would produce different spike responses to the same temporal pattern of synaptic inputs. However, as shown in T is the duration of the stimulus (5 s). This method is sensitive to both the existence and precise alignment of spike events in particular locations of the stimulus. Note that the shape of a particular peak in the PSDF depends on the number of observed spikes in that particular event (reliability) as well as their spike jitter (precision). Similarity is at maximum when peaks in the PSDFs of both neurons appear in the same locations and with similar shape. The second method only examines whether peaks in particular locations appear in the PSDF . Whenever a reliable spike event is triggered by the same EPSP (same location) in both neurons, two peaks in the corresponding PSDFs will appear in identical locations and the total number of such occurrences is counted. The similarity is maximal when all 20 peaks appear in the same locations. Here, spike train distance is simply the count of matches subtracted from 20.This view was further strengthened by pairwise comparison of the spike responses using similarity matrices. As earlier studies have shown, various implementations of spike train distance perform well in distinguishing between neuronal responses or classifying cell types Using the two methods for calculating the spike train distances we built matrices of the pairwise data. While the above analysis showed that spike responses from the 3 originally described biophysically different types of neurons are generally similar, we decided to have a closer look at the fine structure of firing so our analysis might reveal more subtle differences that are hidden in a qualitative assessment or when calculating the above gross measures of similarity. At this level of analysis we managed to identify several features and temporal parameters that were significantly different between but not significantly different within groups. One of such features that distinguish type II neurons from the rest is that they tend to fire more spikes in the beginning of the stimulus than the other types of neurons compare . Type IIFinally we compared the relative occurrence of spike events in particular locations (specific EPSPs) of the stimulus for the three cell types. Evaluating the peri-stimulus density functions of 18 neurons we identified a total of 27 possible locations where marked peaks could be found. Although the cells were stimulated in a way that they produced in average 20 spikes per trial, the spikes did not always appear in the same locations among cells, hence the number for possible spike locations is greater than 20. In the following, we counted the number of trials where we did observe spikes at the 27 pre-selected locations for different type of neurons. Dividing this count by the total number of trials we obtained pooled event probabilities for the three types of neurons . This anCell type II neurons are relatively easy to identify because of their prominent sag-current in response to moderate hyperpolarization with a DC pulse and because they fire spikes when released from hyperpolarization. Such post-inhibitory rebound is very characteristic and robust in cell type II neurons while absent in types I and III neurons. In a small number of cells we found a sag-current associated with a post-inhibitory rebound, which, however, lacked the burst appearance of typical type II neurons and was instead more protracted firing . SpecifiThe results we obtained with dynamic clamp stimulation on various types of jcBNST neurons lead to interesting consequences. Conventionally, neurons in a wide range of nervous systems are classified into different physiological types using simple protocols of rectangular current steps. As we observed, jcBNST neurons classified as type I, II or III cells and displaying clear differences in their voltage output under DC stimulation, do not markedly differ when stimulated with stochastic inputs via dynamic clamp. Conversely, the latter approach identified a novel oscillatory type of neuron that produced markedly different spike responses despite resembling type II neurons under DC current stimulation. If we choose to focus on the very obvious physiological differences between jcBNST neurons, we can identify three main cell types using the DC step method and only two cell types using the synaptic stimulation via dynamic clamp. One could say, cell type classification might depend on the stimulus protocol the experimenter happens to choose.The fact that differences between the neurons' firing were detected only in a small percentage of spikes suggests that they integrate their synaptic inputs in a fairly similar manner (except the type O neurons). Nevertheless, biophysical diversity of neurons - even of the same - type has been demonstrated in a number of brain areas. The diversity is caused by the differential expression of specific voltage-gated membrane conductances and random cell-to-cell variations on the passive membrane properties of the neurons. We assumed that such random variations in the biophysical properties of neurons would have an impact on their firing responses in a way that appeared as random, within-group variations in one of the temporal parameters yet to be determined. To test this hypothesis we performed a thorough analysis of the fine structure of the spike responses.As a general strategy, the spike responses of neurons are to be analyzed in relation to the input that was presented to the neuron and processed into a specific output firing pattern. Therefore, we analyzed the temporal relationship between the local synaptic conductance transients and the corresponding spikes in the receiving neuron. As described, the input coupled to the dynamic clamp consisted of excitatory and inhibitory waveforms containing “spikes” of variable amplitude, hence the jcBNST neurons received EPSCs and IPSCs of variable amplitude. Due to the small amount of overlap between the EPSCs it was always possible to determine which excitatory transient was the triggering event for any spike in the jcBNST neuron, hence we were able to measure pre- and postsynaptic spike latency for each event in the peri-stimulus plot . These lIf latencies are so well reproduced in the responses of single neurons receiving the noisy synaptic inputs (low coefficient of variation), are the latency maps similar across neurons of the same type? This comparison is possible mostly because the neurons tend to fire in response to the same EPSPs, i.e. in similar locations of the stimulus waveform. As we observed, identical type of neurons fire spike patterns that overlap in 80 or higher percentage of the spikes. For example, a spike latency at t = 0.9405 s can be compared for neuron A and B, because they both fire in that particular location. Somewhat unexpectedly, we find no two similar latency maps when comparing these diagrams for type I, II or III neurons. In fact, each neuron produces a unique pattern of latencies in these diagrams, hence they are similar only to themselves. As noted, the low C.V. of latencies indicates that the neuron reproduces the same spike event with remarkable precision in the successive trials, but another neuron, even within the same type of cells, will fire in response to the same input with a different latency. A simple explanation for this finding would be that neuron A tends to fire with a latency that is, on average, a constant percentage (e.g. 50%) of that of the latency of neuron B. In this case, rescaling the latency map of neuron A would result in a map that nicely overlaps with that of neuron B. However, some spike events have a shorter latency in neuron A than in B but others have the reversed relationship. Hence, the simple linear rescaling does not work and the latency maps are found to be distinctive for every neuron. To verify our interpretation on the qualitative differences in the latency diagrams, we decided to perform a systematic pairwise comparison of the spike latencies between neurons. Again, we selected time series that contained approximately 20 spikes per trial (30 Hz tonic stimulus) and which were recorded from neurons that were clearly identified as type I, II or III cells according to their voltage responses to DC stimuli. Then we calculated latency values and their variance for spike events that were present in the spike responses of both neurons to be compared . Since the spike jitter (variance of the latency) was heterogeneous for different neurons, the use of Welch-statistics was justified. A total of 3138 t-tests were performed (including 21 neurons) and significant differences were found in 83% of the pairs (p = 0.05). Within group comparison revealed significant differences in 75, 80 and 88% of pairs for type I, II and III neurons, respectively. In this respect, the fine structure of firing revealed substantial variations across the population of neurons even if they are classified as the same cell types. At the millisecond time scale and when considering the dynamics of EPSP-spike coupling, every neuron appears to process synaptic inputs in a way that is different from the rest.Our experiments revealed several intriguing features of synaptic processing in the neurons of the juxtacapsular bed nucleus of stria terminalis. Our first finding was that biophysically distinct types of neurons as determined by conventional means of classification did not produce markedly different firing responses when stimulated with physiologically realistic synaptic conductance waveforms under dynamic clamp. Although the qualitative features and gross temporal parameters of the spike responses were similar across cell types, we observed significant differences in the fine structure of the firing, i.e. at the single spike resolution. In addition to the known three cell types, we identified a new type of jcBNST neuron with intrinsic oscillatory properties that displayed spike dynamics markedly different from the others. Finally, we showed that spike latency maps of neurons even from the same groups display great variations most likely due to the diversity of their intrinsic biophysical properties.According to the conventional view, the voltage output of synaptically isolated neurons under DC current stimulation reveals several important physiological properties that might suggest some feature of their operation in the intact brain. The voltage output in response to current steps, on the other hand depend on the intrinsic biophysical properties of the neurons such as the abundance or lack of specific voltage-gated ionic conductances. Indeed, this quick and reliable method has been commonly used to assess the neurons' overall physiological properties and to classify them into distinct cell types exact repetitions of synaptic messages such as those in the frozen noise experiments are unlikely in the natural conditions. On the other hand, a population of presynaptic neurons can synchronously deliver inputs to multiple postsynaptic targets often with different biophysical character. Our experiments were designed to mimic these very conditions. It is also notable that a single sweep of the noisy stimulus template (5 s length) is actually consisted of hundreds of excitatory and inhibitory conductance transients, therefore the stimulated neuron experiences a rich and variable input unlike in experiments with DC current injection.Considering the wide repertoire of biophysical properties that mammalian neurons display one can expect correspondingly rich behavior in their dynamics. While computational models of neurons have been of great value in such investigations, biological experiments with physiologically realistic inputs are to be performed to gain a clearer understanding on how these neurons might work in the active synaptic environment of the intact brain. The dynamic clamp technique offers a great opportunity for such investigations The 30 Hz template waveform we used the most frequently in our experiments can be considered as a way to simulate a moderate intensity synaptic input, but we did not aim to simulate strong synaptic bombardment that is characteristic of highly active circuits in the awake brain h), the low-threshold Ca-current (IT), the fast transient K-current (IA), the inwardly rectifying K-current (IK(IR)) and the persistent Na-current (INaP). Clearly, these are ubiquitous in neurons of other brain areas, too, hence the jcBNST neurons offer a good experimental subject to study how the neurons integrative/computational properties depend on their biophysical character.The jcBNST neurons of our study have been characterized using conventional DC current stimulation as well as voltage clamp h, their low-threshold Ca-currents and their inwardly rectifying K-currents h currents Our experiments showed that neurons with different biophysical properties can produce rather similar spike output in response to the same synaptic input. Indeed, type I, II and III neurons as classified by the conventional methods produce apparently different voltage output in response to DC current steps, but they can produce similar firing patterns when receiving the synaptic input under dynamic clamp. One would expect, the differential activation and deactivation profile of voltage-gated conductances in the three types of neurons will eventually result in deviations in their spike responses, i.e. they will follow different trajectories in their phase spaces. However, we observed that the majority of the spikes emitted by the three types of neurons occur in the same locations of the input waveform. Our preliminary calculations also showed that these “trivial” spikes can be well reproduced in a simple leaky integrate-and-fire model that is presented the same input as the biological neurons. In this respect, the trivial spikes are input driven events that occur with high probability and independently from the intrinsic biophysical properties of the neuron. As previously showed, the three types of jcBNST neurons differ significantly in the relative magnitude of their IAs part of our study, we identified a novel cell type of oscillatory neurons. Analyzing the behavior of this new type of neurons we realize that in some cases neurons do produce very different output in response to the same synaptic input. While the previously identified three types of neurons produce qualitatively similar patterns, this new type follows a very different trajectory. One of the intriguing features of its firing is that the interspike intervals display far less variations than those in the other 3 types of cells. Apparently, the newly identified oscillatory neurons tend to fire tonically in the presence of synaptic input and single EPSPs and IPSPs play a modulatory rather than a driving role in spike emissions. As we observed, this neuron type can fire tonically and persistently after the termination of a strong inhibition (DC pulse). This pacemaker type activity might be initiated by the synaptic inputs as delivered by the dynamic clamp. Hence, under such conditions the dynamics of the oscillatory type cells is not governed by the input but equally or even more shaped by their intrinsic properties. The specific voltage-gated conductances that might be responsible for the intrinsic oscillation and regenerative spiking in such cells are yet to be determined.The three types of neurons reproduced firing patterns with high reliability and precision when stimulated with a stochastic synaptic input via dynamic clamp. As we showed, the majority of spikes were emitted in the same locations of the stimulus, therefore, spike responses were consistent across neurons from different groups. At the level of single spikes we found another very consistent behavior, namely the exponential dependence of spike timing on the magnitude of the excitatory input In conclusion, our results show that neuronal types with distinct biophysical properties can produce similar spike patterns in response to the same complex synaptic input. However, the degree of similarity depends on the time scale that is chosen to analyze their responses. At the longer time scale neuronal responses in the three previously described neuronal cell types appear similar, so this analysis does not distinguish them. A higher resolution analysis at shorter time scales reveals the existence of non-trivial spikes that show consistent variations among the three previously described neuronal cell types. A great degree of diversity among neurons independently of their distinct biophysical properties is observed at the highest resolution (ms). Therefore, the biophysical properties of neurons as revealed by conventional DC stimulation protocols are not performing well in predicting their responses to complex synaptic stimulation. Thus, caution should be taken when extrapolating results with conventional stimulation to the functional properties of neurons in microcircuits or higher levels of organization in the nervous systems.3, 1.25 NaH2PO4, 2.2 CaCl2, 10 d-glucose, and 2 MgSO4, pH 7.4. Slices were preincubated in ACSF for 1 hour at 32°C and then maintained at room temperature for at least 30 min before being transferred to a submerged recording chamber at 31°C.All experimental protocols were consistent with guidelines issued by the National Institutes of Health and approved by our Institutional Animal Care and Use Committee (protocol number 07-0068). Acute brain slices were prepared as previously described 4 120, KCl 10, MgCl2 3, HEPES 10, Phosphocreatine 10, MgATP 2, GTP 0.2; osmolarity set to 280–290 mOsm, pH 7.2. Synaptic isolation of jcBNST neurons was achieved by blocking glutamate and GABA receptors using 10 µM 6-cyano-7-nitroquinoxaline-2,3-dione (CNQX), 50 µM AP-5 and 30 µM bicuculline in the bath.Slices of brain tissue containing the BNST were placed in a superfusion chamber and visualized with a Leica stereomicroscope under low magnification. Single neurons were not visualized during electrode insertion and the experimental session (blind recordings). Intracellular current clamp and dynamic clamp experiments were performed in whole-cell configuration using 10–12 MΩ patch pipettes filled with intracellular solution containing (in mM): KMeSORecordings and intracellular stimulation were made using a Multiclamp 700 amplifier (Axon Instruments) in the bridge mode. Stimulus waveforms (both rectangular and spike-like) were generated using the data acquisition software DASYLab 6.0 in a Windows computer equipped with a National Instruments PCI-MIO-16-E4 multifunctional board. We used standard rectangular current commands for conventional physiological characterization of the jcBNST neurons. Specifically, we delivered 350 ms pulses of intracellular current incremented by 20 pA from −200 pA to +100 pA or higher levels, depending on the cell type.mI is the postsynaptic current (injected into the jcBNST neuron), syng is the maximal synaptic conductance, revV is the synaptic reversal potential and mV(t) is the neuron's membrane potential. Transmitter release is modeled by an instantaneous activation term S(t) given by the differential equationinV is the input voltage waveform (either the excitatory or the inhibitory voltage) and it serves as the presynaptic membrane potential for the dynamic clamp, synτ is the synaptic characteristic time constant, thV is the synaptic threshold voltage, and slopeV is the synaptic slope parameter. The above parameters were set independently for the three synaptic conductances used in our experiments. The input from the excitatory voltage waveform (synτ) was 10 and 50 ms for the AMPA- and NMDA-type connections, respectively and the reversal potential (revV) was 0 mV for both. The second voltage waveform served as the GABAergic inhibitory input . Excitatory inputs drove the firing, while the inhibitory input played a modulatory role in spike emissions.We elicited firing activity in the jcBNST neurons by injecting them with simulated excitatory and inhibitory synaptic inputs via dynamic clamp . To achiwaveform , Exc wasThe template waveforms and the postsynaptic voltage signal were connected to the analog inputs of a Digidata 1200B board that was the interface to the dynamic clamp software StdpC v. 1.9. mean reliability for the entire experiment. The rationale for discarding the low-reliability events is that such spikes often introduce small peaks in the PSDFs that can interfere with the detection of spike events. This type of pre-filtering removed only a small percentage of spikes. The mean reliability was calculated by simple averaging of single event reliabilities. The precision of spike timing was characterized by the temporal jitter of spikes within reproducible events. The standard deviation of spike times was calculated for each spike event in a peri-stimulus plot and the arithmetic mean of the individual S.D.s was calculated. The mean spike jitter served as a scalar measure of the overall spike timing precision in the experiment.Firing patterns obtained in the dynamic clamp experiments were initially analyzed using peri-stimulus scatter plots. Reliable spike events in such plots manifested as vertically aligned tick marks, i.e. when a spike was emitted repeatedly in the same location of the stimulus. The statistical analysis was based on the evaluation of peri-stimulus density functions (PSDFs) constructed from the spike arrival times of the successive trials |
On 29–30 November 2007, just days before the United Nations Climate Change Conference began in Bali and Al Gore and Rajendra Pachauri received the 2007 Nobel Peace Prize for their work on climate change, the U.S. Institute of Medicine (IOM) held a workshop to highlight gaps in scientific understanding about the environmental and human health effects of transportation fuels. The transportation sector’s use of fuel is expected to grow more quickly than demand for energy in any other sector between 2005 and 2030, Scott Nauman, manager of economy and energy in the ExxonMobil Corporate Planning Department, told conference attendees. Therefore, new transportation fuels are key players among the innovative technologies being investigated and developed to help countries throughout the world cut greenhouse gas emissions.As worldwide transportation fuel use rises, the emissions and carbon dioxide emitted by burning these fuels will also rise, pointed out Samuel Wilson, acting director of the NIEHS. “We want to add ‘minimizing the human health impact’ . . . to the criteria for developing alternative fuels,” he said.According to Michael Wang, a vehicle and fuel systems analyst at the U.S. Department of Energy Argonne National Laboratory, biofuels are considered the most promising alternative for reducing petroleum use and decreasing greenhouse gas emissions from transportation. Electricity is also expected to grow as a source for plug-in hybrids, as is hydrogen. The idea of producing transportation fuels from coals “has generated some interest lately because they can be produced domestically,” Wang says, but their carbon emissions are “pretty high.”The main biofuel currently being developed for transportation in the United States is ethanol from corn via distillation, and its production is increasing rapidly. According to the Energy Information Administration, the percentage of the U.S. gasoline pool represented by ethanol rose from 1.27% in 2000 to 2.85% in 2005. However, John Regalbuto, director of the National Science Foundation’s Catalysis and Biocatalysis Program, predicts that hydrocarbon-based “green gasoline,” “green diesel,” and “green jet fuel” will represent a significant fraction of new biofuels by 2022. When produced via catalysis from materials such as switch-grass and waste wood products, the performance of these renewable biofuels are “essentially the same” as their conventional counterparts, he says. However, their manufacture involves intermediates such as hydroxymethylfurfural and ionic liquid solvents that require further study in terms of health effects.Additives also affect the emissions of transportation fuels, as well as these fuels’ impact on the environment, stressed Serap Erdal, an assistant professor at the University of Illinois–Chicago School of Public Health. Uncertainty over which additives will be added to new fuels and how the complex mixtures will behave in the environment makes it very hard to predict potential health effects, agreed the experts amassed at the IOM meeting. In the United States, for example, ethanol has only recently been used as an additive to make gasoline burn more efficiently. But in Brazil, where ethanol has been used as a fuel for nearly 30 years, it has become clear that, compared with gasoline, the sugarcane-derived fuel produces much higher emissions of formaldehyde, a known human carcinogen, and acetylaldehyde, a suspected human carcinogen, said Paolo Saldiva, a professor of medicine in the University of São Paolo’s Department of Pathology. However, he said that the health effects of exposure to these compounds via air emissions are unclear.What is indisputable is that key decisions leading to the development of new fuels will be made before the requisite health effects data are available, so “we need to get going as soon as possible . . . to collect baseline data,” said Dan Greenbaum, president of the Health Effects Institute, which published a report summarizing the health effects of exposure to 21 mobile source air toxics in November 2007. Added Erdal, “There is a critical need to institute public health surveillance so that we are already collecting data and are able to detect changes as they take place.” |
Subjects typically choose to be presented with stimuli that predict the existence of future reinforcements. This so-called ‘observing behavior’ is evident in many species under various experimental conditions, including if the choice is expensive, or if there is nothing that subjects can do to improve their lot with the information gained. A recent study showed that the activities of putative midbrain dopamine neurons reflect this preference for observation in a way that appears to challenge the common prediction-error interpretation of these neurons. In this paper, we provide an alternative account according to which observing behavior arises from a small, possibly Pavlovian, bias associated with the operation of working memory. observing behavior’, in which, at least in some versions, animals elect to observe cues that are predictive of future rewarding outcomes, although the observations themselves have no direct behavioral relevance. In a recent experiment on observing, the activity of monkey dopaminergic neurons was also found to be incompatible with classic RL. However, as is often the case, this was a task that allowed for potential interactions from a secondary behavioral system in which responses are directly triggered by values. In this paper we show that a model incorporating a next order of refinement associated with such Pavlovian interactions can explain this type of observing behavior.The theory of Reinforcement Learning (RL) has been influential in explaining basic learning and behavior in humans and other animals, and in accounting for key features of the activity of dopamine neurons. However, perhaps due to this very success, paradigms that challenge RL are at a premium. One case concerns so-called ‘ Animal behavior all too rarely follows the precepts of simple theories such as normatively optimal choice. Prominent examples of this arise in the florid fancies of Breland & Breland's animal actors In this paper, we study one apparent departure from optimality, namely a type of ‘observing behavior’ more even when the number of bits they receive by doing so is less that is revealing about observing. The target indicating a forced-informative trial was associated with a small but significant phasic increase in activity; whereas that indicating the random cues was followed by a small decrease in the firing rate. Under the temporal difference interpretation of the neurons, this is consistent with the preference exhibited by the monkeys, but not with the objective value of the options.In a version of the task that involved choice between immediate or delayed information about upcoming rewards, Bromberg-Martin and Hikosaka Various other features of observing can be examined through the medium of the model. Another important experimental manipulation has been to vary the probability One extra factor that is important for analysing behavior is that the biases inherent in disengagement are small and develop over a long time-scale, consistent with the stately progress evident in We have provided an account of ‘observing behavior’ that shows how it can arise from a small Pavlovian bias over instrumental behavior associated with disengagement from a task, rather than any aspect of information seeking. Pavlovian biases are rife in decision-making; and accommodating them does not necessitate any further change to the standard underlying theory of the activity of dopaminergic neurons that has not already been suggested to accommodate other data. What we have done here is specify the shape of such an interaction based on disengagement in the task. We intended specifically to capture Experiments such as Dinsmoor Another interesting account of observing is Daly and Daly's DMOD To some tastes, the most theoretically appealing accounts of observing start from the notion that animals seek to acquire information about the world In terms of our account, there are various routes by which predicted values could influence persistent engagement. Failure to engage can be seen as the same sort of malign Pavlovian influence over behavior that is implicated in the poor performance of monkeys in tasks in which they know themselves to be several steps away from reward We specialized our description of the model to the particulars of the experiment conducted by Bromberg-Martin and Hikosaka The model raises some further questions. First, we assumed that the probability of disengagement is a function of the actual prediction. However, it is possible that this function scales with the overall magnitude or scale of possible rewards, making the degree of observing relative rather than absolute. There is a report that phasic dopamine itself scales in an adaptive manner A second issue is whether disengagement is occasioned by the change in predictions associated with the phasic dopamine activity, or the level of the prediction itself. If the former, then in tasks such as the one studied by Bromberg-Martin and Hikosaka A third issue is whether disengagement is complete (and stochastic), or partial . We considered the former case, and indeed, this leads to a straightforward prediction that the histogram of the dopamine response at the time of a delivered reward in the non-discriminative case might have two peaks; one associated with continuing engagement to the point of reward; the other, which would be roughly twice as high, associated with prior disengagement. However, it is also possible that less dramatic changes in engagement occur during the interval between cues and reward. If many individual neural elements are involved in the engagement (for instance in working memory circuits devoted to timing), then some could disengage before others. This might even lead to a non-uniform behavior among different dopamine cells. Unfortunately, the low firing rates of these cells make it hard to discriminate between these various possibilities.Finally, the question arises as to the computational rationale for value-dependent disengagement. Other instances of Pavlovian misbehavior, such as withdrawal from cues associated with predictions of low values, can find plausible justifications in terms of evolutionary optimality. Disengagement might be seen in the same way, as a Pavlovian spur to exploration From the perspective of conditioned reinforcement, our account suggests that the issue that is often studied is not really the one that is critical. Various investigators (see, for instance, the ample discussion in Lieberman et al. 1997 tics see . It is tVarious versions of the ‘observing task’ have also been tested on humans In conclusion we have shown that the often observed effect of ‘observing’, preferring a behaviorally irrelevant discriminating stimulus cue, can readily be explained by a bias caused by Pavlovian misbehavior, putting it in the same category as a range of other suboptimalities. Informational accounts, however seductive, are not necessary.We model value learning using a modified version of a standard temporal difference model The only deviation from the standard TD model is in assuming that the correct updating of this system is dependent on maintaining engagement, for instance in working memory. We assume the probability of disengagement of the course of state tate see . and aThe system stays in this state, until a reward is delivered at the end of the trial. At this point the system is ‘re-engaged’ creating a TD error relative to the fixed state see . We assuChoice is only possible at one state Note that it is straightforward to see that this version of softmax is dependent on the difference in values (ue as in causes tIn the limit without any failures in updating the learned values would approach the true value For all figures we assumed |
Both mutations were present in his clinically normal mother and absent in the patient's father.a 6-years old boy, hospitalized with epigastric pain radiating to the back showed high serum levels of serum amylase, lipase, CRP and erythrosedimentation rate. Several similar milder episodes of pain, followed by quick recovery and complete disappearance of symptoms were reported during the previous 13 months. The child was medically treated and after 7 days with normal clinic and laboratory tests was discharged with a hypolipidic diet. All the known aetiologic hypotheses were excluded by anamnestic investigation, clinical observation and biochemical evaluation, whereas, anatomic abnormality were excluded by a secretin stimulated magnetic resonance (MRI). At the last follow-up visit, (11 months later), the child showed a normal body weight and anthropometric profile, without further abdominal pain. Mutation screening for coding regions of this report extend the spectrum of PRSS1 mutations, however, the absence of family history of pancreatitis leaves the present case without the hallmark of the hereditary origin of pancreatitis. At the present knowledge it can be only stated that the combined genotype CFTR (F508del)/PRSS1 (S181G) is associated to a mild phenotype of acute recurrent pancreatitis in this child without any further conclusion on its pathogenetic role or prediction on the course of the disease. PRSS1 gene, that encodes for the human cationic trypsinogen [PRSS1 gene are responsible for the increase of autocatalytic conversion of trypsinogen to active trypsin that leads to autodigestion of the organ [Hereditary Pancreatitis (HP) OMIM #167800) is a rare autosomal dominant disorder with about 80% of penetrance. The clinical features of HP patients consist in attacks of acute pancreatitis, that in ~80% of individuals starts before 20 years of age (median age 10 years). Progression to chronic pancreatitis also occurs in about ~50% of patients and pancreatic cancer may develop by 15 years of age in about ~40% of affected individuals [67800 is psinogen ,4. MutatSPINK 1 [CFTR (Cystic Fibrosis transmembrane conductance regulator) [CTRC (chymotrypsin C) [PRSS2 (cationic trypsinogen type 2) gene protects against chronic pancreatitis [Chronic pancreatitis has also been associated with mutations in other genes such as Type I) , CFTR (Cgulator) , CTRC (cypsin C) . Contempypsin C) -12. Whilreatitis .PRSS1 gene, associated with p.F508del mutation in CFTR, in a child presenting acute recurrent pancreatitis.The present report focuses on the finding of a new heterozygous mutation in the The case is described of a 6-year-old boy, examined in the Emergency Department on account of acute abdominal pain, intense nausea and mild fever (37.5°C). The clinical history revealed 6 similar episodes during the previous 13 months, some managed at home and other with brief hospitalization. During the very first episode in which he also presented a white blood count of 22,000 (88% neutrophils), appendicectomy was performed. A review of previous medical charts revealed that amylase had been evaluated only twice in the past and, on both occasions, it was slightly increased . However, no further investigation had been performed due to rapid recovery and complete disappearance of abdominal pain. When coming to our attention, the boy appeared to be suffering, with knees drawn up to his chest, and with epigastric pain radiating to his back, of post-prandial onset. Furthermore, the child presented moderate abdominal distension, however, all vital signs were within normal limits. Laboratory studies were all within the normal range, with the exception of serum amylase which was 1373 U/L (n.v. 0-95 U/L), lipase 1050 U/L (n.v. 13-60 U/L), C-reactive protein (CRP) 95 mg/L (n.v. 0-10 mg/L), erythrosedimentation rate (ESR) 74 mm/h (n.v. 0-20 mm/h). The child was treated with intravenous (i.v.) fluids plus 20 mg of proton pump inhibitor (PPI) i.v. An abdominal sonogram showed increased pancreatic volume with diffuse oedema, gallbladder was normal. The following day, laboratory tests showed overall decreased values: amylase 650 U/L, lipase 350 U/L, CRP 30 mg/L. Fluids i.v. were administered for 4 days after which amylase, lipase, CRP and ESR returned close to normal values and a liquid light meal was administered with good results. After 7 days of hospitalization, with normal laboratory tests and without abdominal pain, the child was discharged with a hypolipidic diet, 20 mg PPI daily and pancreatic enzyme supplementation per os. both for two more weeks. Taking into consideration all the aetiologic hypotheses, blunt trauma, metabolic, infectious, drug and systemic causes were excluded, by means of accurate anamnestic investigations and clinical observations and by further laboratory evaluations . In the attempt to exclude any anatomic abnormality, secretin-stimulated magnetic resonance imaging (MRI) of the pancreas was programmed as an outpatient. At follow-up visits, the child presented stable body weight, good appearance, with no further episodes of abdominal pain, continuing a strictly controlled of hypolipid diet. The secretin MRI, performed 2 months later, showed an overall increased thickness of the parenchyma of the entire pancreas with aspecific irregular signal intensity in the head region. Following secretin stimulation, the main pancreatic duct appeared to be normal, with a normal papilla in the second part of the duodenum that was normally filled, 10 minutes after the secretin infusion. At the last follow-up visit, ~11 months after the last acute pancreatic attach, the child presented a normal anthropometric profile with normal body weight, and no further episodes of abdominal pain were reported. However, two new short episodes of abdominal pain have been recently reported with a slight increase of only lipase levels following the last one.PRSS1) underlying HP, although no data were available suggesting familial pancreatitis in this patient. CFTR, SPINK-1 and the new HP-associated chymotrypsin C (CTRC) gene were also analysed. While genetic testing revealed normal SPINK1 and CTRC genes, a novel heterozygous variation, c.541A > G (p.S181G), in exon 4 of PRSS1 gene was revealed . The patient also showed the classic p.F508del mutation, in a heterozygous state, in the CFTR gene. However, no other nucleotide variations or genomic rearrangements were detected in this gene following careful examination. Both mutations were absent in the patient's father but present in his clinically healthy mother.Given the unexplained episode of pancreatitis in a child, it was decided to investigate point mutations in the cationic trypsinogen gene PRSS underlyiTo explain the discordance in phenotype, between mother and proband, the following possibilities were taken into consideration: i) presence, in the proband or the father's genome, of gross deletions/insertions in the pancreatitis causative genes; ii) presence of active modifier factors such as protective polymorphism p.G191R in the PRSS2 gene; iii) non paternity, and iv) environmental effects.PRSS2 gene and testing of paternal micro-satellites (data not shown). Furthermore, a detailed dietary history of the child showed high frequency of consumption of fat food prior to the onset of the acute pancreatitis episodes.To exclude the first hypothesis, we applied aCGH (array-based Comparative Genomic Hybridization) to detect macro deletions and macro insertions on the entire genome of the father's and proband's DNA. No significant alterations were detected (data not shown). The second and third hypotheses were ruled out by complete sequence analysis of the PRSS1, PRSS2, SPINK1, CTRC and CFTR coding regions amplification and sequencing were performed on an ABI 3130 Genetic analyzer, according to previously reported conditions [The parents were constantly informed regarding the interpretation of the clinical and genetic investigations and always gave their written consent both to the procedures and the laboratory investigations. nditions ,9,13-15,CFTR rearrangements was performed using a quantitative PCR followed by capillary electrophoresis . aCGH was performed by Agilent's Oligonucleotide Array-Based CGH for Genomic DNA 4 × 44 K.Analysis of CFTR and a novel maternal transmitted mutation, p.S181G, in exon 4 of the PRSS1. This report potentially extends the spectrum of the PRSS1 mutation. In fact, all pancreatitis-associated PRSS1 mutations discovered appear to cluster in the N-terminal half of the molecule encoded by exons 2 and 3. Whereas, the present p.S181G is the first mutation detected in exon 4 corresponding to an amino acid position inside two disulphide bridges, amino acids: 139-206 and 171-185. Although it is well known that chronic pancreatitis is predisposed by heterozygosity for CFTR mutations, little is known about the combination of CFTR mutations with PRSS1 or SPINK1 mutations. To date, only a few cases have demonstrated that pancreatitis is caused by simultaneous CFTR and SPINK1 mutations (5.5%), of PRSS1 and SPINK1 (1.3%), and of PRSS1 and CFTR (1.8%). No information concerning clinical features of these patients are available. Between 60% and 80% of HP patients carry a pathogenic PRSS1 mutation. Lower penetrance and perhaps, in some cases, modifier genes have been identified, particularly the CFTR and SPINK1 [The present case represents a rare condition in a child with recurrent acute pancreatitis allegedly determined or favoured by a compound heterozygous mutations, p.F508del in d SPINK1 .In the present report, the combined genotype F508del/S181G is associated with acute pancreatitis episodes in the 6-year-old proband, but not in his 37-year-old mother, who carries the same genotype, but without any pancreatic symptoms, biochemical or ultrasound pancreatic alterations.Following the experimental exclusion of gross deletions/insertions in the pancreatitis causative genes in the father, of a case of non paternity, and of the presence of other mutations in pancreatitis relevant genes, it is tempting to suggest that the phenotypic discordance may be due to unknown combination of genetic and/or environmental factors.PRSS1 gene carriers may remain symptom-free) [PRSS1 mutation S181G could be involved in determining recurrent pancreatitis or if it needs to be combined with other HP causing genes such as CFTR mutations. At the moment, the combined genotype F508del/S181G could be only associated to a mild phenotype of acute recurrent pancreatitis as happened in the present child. Moreover, on the base of the present report we cannot establish whether PRSS1 S181G gene mutation has a pathogenetic role on the child pancreatic disease nor any prediction on the course of the disease.Therefore, it could be a potential late onset of pancreatic disease in the proband's mother, or a case of incomplete penetrance of a genotype composed by two mutations (up to 20% of om-free) . In addiVDC and SG design and drafted the manuscript and carried out the molecular genetic studies; FG, MRD participated in the molecular genetic studies and sequence alignment; MP, EG and VL followed the clinical part of the study; GN and GDF conceived of the study and its coordination.All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-230X/10/119/prepub |
Therefore, additional prognostic indicators are needed. Here, we evaluated the prognostic value of cyclin H expression in GIST.Risk estimation of gastrointestinal stromal tumours (GIST) is based on tumour size and mitotic rate according to the National Institutes of Health consensus classification. The indication for adjuvant treatment of patients with high risk GIST after RIn order to identify prognostic factors of GIST we evaluated a single centre cohort of ninety-five GIST patients. First, GISTs were classified with regard to tumour size, mitotic rate and localisation according to the NIH consensus and to three additional suggested risk classifications. Second, Cyclin H expression was analysed.Of ninety-five patients with GIST risk classification revealed: 42% high risk, 20% intermediate risk, 23% low risk and 15% very low risk GIST. In patients with high risk GIST, the expression of cyclin H was highly predictive for reduced disease-specific survival (p = 0.038). A combination of cyclin H expression level and high risk classification yielded the strongest prognostic indicator for disease-specific and disease-free survival (p ≤ 0.001). Moreover, in patients with tumour recurrence and/or metastases, cyclin H positivity was significantly associated with reduced disease-specific survival (p = 0.016) regardless of risk-classification.Our data suggest that, in addition to high risk classification, cyclin H expression might be an indicator for "very-high risk" GIST. Gastrointestinal stromal tumours (GIST) display a wide range of clinical and pathological features and represent the largest group of mesenchymal tumours of the gastrointestinal tract. They are mostly characterised by a gain-of function mutation of the c-kit gene encoding a receptor tyrosine kinase -3. The oGenes involved in cell-cycle regulation, such as cyclins and cyclin-dependent kinases (CDKs), are among such potential markers ,12. The In this study, we investigated the expression pattern of cyclin H in a single-centre population of 95 GIST and evaluated its prognostic value, since our gene expression analysis in normal and tumour tissue of a high-risk GIST patient revealed a 10 fold upregulation of cyclin H in tumour tissue.Medical records as well as paraffin-embedded and frozen specimens of 95 gastrointestinal stromal tumours were included in the study. The clinocopathological features are outlined in Table 2 First Strand Kit . Gene profiling was done as described by the manufacturer using the RT2 profiler PCR array for the human p53 signalling pathway . For CCNH (gene encoding cyclin H), housekeeping gene HPRT1 (hypoxanthine Phosphoribosyltransferase 1) was used for normalisation. The reactions were carried out in a 7500 Fast Real-Time PCR System . The results were analysed with the 7500 Fast System SDS Software 1.4 .In a pilot study, total RNA was isolated from frozen normal jejunal tissue and from a clinically very aggressive tumour relapse which occurred 1.91 years after the initial diagnosis of a jejunal high risk GIST in a 53-year old female patient using the RNAeasy Kit . Total RNA (2 μg) was reversely transcribed into complementary DNA using the RTOriginal haematoxylin and eosin-stained tumour sections were used to evaluate cell type features and to determine the mitotic rate in 50 high power fields . GISTs were classified according to Fletcher et al. - see T. AdditioFor immunohistochemical analysis the following antibodies were used: anti cyclin H , anti KIT , anti smooth muscle actin , anti CD34 , anti desmin , anti vimentin , anti NSE , anti S100 , anti Ki-67 .In brief, deparaffinised and re-hydrated tissue sections (3 μm) were pretreated in a microwave in CitraPlus solution . After blocking the endogenous peroxidase activity , the sections were incubated with the monoclonal mouse anti cyclin H antibody followed by incubation with anti-mouse immunoglobulins conjugated with peroxidase-labeled dextran polymers . Staining was detected with 3, 3'- diaminobenzidine as chromogen and counterstained with hematoxylin before being cover slipped. Cyclin H positivity was defined as positive staining of ≥10% of the tumour cell nuclei according to the modified classifications of Bondi et al. and Kayaselcuk et al. ,23. AsseFor investigation of the obtained data, an exploratory data analysis was performed using SPSS 16 and Excel 2007 . All criteria were rated equally important, without adjustment of p-values for multiple testing. Tumour size, mitotic rate and age were considered to be continuous variables, while others, such as positivity for immunohistochemical markers, initial symptoms and sex, are treated as categorical variables.2), or (if one or more cells contain less than 5 respondents) Fisher's exact test was performed. Testing was always done two-sided. For statistical analysis of timeline-dependent parameters such as disease-specific survival, a Kaplan-Meier estimation was created and significance was tested using log-rank test. For the calculation of disease-specific-survival (DSS), non GIST-related death-events were censored. P-values < 0.05 were considered statistically significant (α = 0.05). No correction for multiple testing was done.To analyse hypotheses regarding the independence of variables, a contingency table was created and either a chi-square test (XA single-centre population of ninety five patients with a mean age of 64.3 years (median 66.9 ± 13.5) ranging from 17 to 94 years and a male/female ratio of 42/53 underwent surgical resection for a GIST via laparotomy . Clinical manifestations, pathological findings, treatment options, and clinical outcome were evaluated, and statistical analyses were carried out with regard to a potential predictive value of cyclin H.Major clinical symptoms, tumour location, histomorphology, immunohistology and risk classification are summarised in Table 0 in 83 (88%), R2 in 7 (8%) and R1 in 4 (4%) of 94 patients; one 94-year-old patient with a huge gastric GIST was not resected and only biopsies were performed due to a coexisting metastatic obstructive colonic cancer. 16 out of 27 patients who had tumour recurrence and/or metastases were treated with imatinib (200-800 mg/d) in addition to surgery. Of these 15 patients, 8 (50%) achieved stable disease, 4 (25%) attained a partial remission and 4 (25%) had tumour progression. Imatinib did not lead to a complete remission in any of our patients.Dependent on the primary tumour site and the extent of tumour growth, final resection state was RMedian follow-up time of the surviving patients was 5.37 years (64.39 months) . At the time of diagnosis, 15% (n = 14) of all GIST patients showed metastatic disease. 16% (n = 15) of the patients died due to GIST-related causes ) and the rate of patients with metastases or tumour recurrence increased to 27% (n = 26) during the time of observation. Disease-specific 1-, 3-, and 5-year survival probability (DSS) was 96%, 87%, and 84%. Respectively, disease-free survival (DFS) was 80%, 76% and 72%. The median disease-free interval after primary diagnosis of patients with primary unifocal disease and later developed metastases or tumour recurrence was 2.1 years (25 months), mean 2.6 years (31.5 months), range 0.5 to 6.1 years (5.6 to 73 months). Interestingly, 32% (n = 30) of the patients exhibited additional malignant neoplasms. Concurrent benign neoplasias were found in 17% (n = 16). Results of the survival analysis are summarised in Tables low risk, 1 as very low risk and 1 as high risk GIST. Further interpretation of strongly positive or moderate positive cannot be assessed because of the limited number of cases. Analysis of the relationship between nuclear cyclin H positivity and risk of malignancy according to Fletcher and co-workers [Quantification of cyclin H expression by Real time PCR in normal intestinal tissue and in a relapse of a jejunal high risk GIST indicated that cyclin H transcription is increased by 10 fold in the tumour tissue. Based on this high transcription level of cyclin H in one GIST, we analysed cyclin H expression at a protein level in the tumour tissue of the same patient. A high nuclear staining of cyclin H was detected. Consequently, immunohistochemical analysis of cyclin H expression in the tumour tissue of 95 GIST patients was undertaken and revealed nuclear positivity of cyclin H in 24% n = 23) Figure . In the , sex p = 0.935), and routine immunohistochemical markers such as CD34 (p = 1.000), smooth muscle actin (p = 0.479), desmin (p = 0.564) and Ki-67 (p = 0.227); Table 5, and roThe aim of the present study was to evaluate the prognostic value of cyclin H expression in GIST. To this end, the expression of cyclin H was analysed at the mRNA and consecutively at a protein level of the whole cohort. The cyclin H immunostaining pattern of tumours of 95 patients with GIST was characterised and correlated to clinicopathologic features and clinical outcome.Due to the absence of reliable genetic or immunohistochemical predictors, tumour size and mitotic rate are still the determining NIH criteria for risk estimation in GIST . AlthougQuantification of cyclin H mRNA revealed a 10.2 fold increased transcription of cyclin H in a high risk jejunal GIST compared to normal tissue, suggesting an important role of cyclin H and the cyclin-CDK-system in GIST pathogenesis. By immunohistochemical analysis of cyclin H expression in 95 tumour specimens of a single centre population we found a high expression of cyclin H (≥ 10% reactive cells) in 24% of the tumours, which correlated well with the risk of malignancy (p = 0.176). Among all Cyclin H positive patients enrolled in our study there is a tendency for a poor prognosis, although there was no statistical significance (p = 0.692 for DFS and p = 0.189 for DSS). In patients with high risk GIST the expression of cyclin H was highly predictive for the reduction of DSS (p = 0.038). Accordingly, cyclin H expression differentiated high risk and "very-high risk" GIST with regard to disease-specific mortality and might be a valuable tool for further treatment decisions. Moreover, with regard to the whole population, the combination of cyclin H positivity and high risk classification according to Fletcher was strongly predictive of a poor DFS as well as DSS (p = 0.001 and p < 0.001) [Although the predictive value of Cyclin H is limited with regard to the whole population, our results suggest for the first time a predictive value of cyclin H expression in high risk GIST patients, underlining the importance of the cyclin-CDK system for GIST pathogenesis. Therewith, our data strengthen previous reports on the predictive value of cyclin A, cyclin B, cyclin D1, cyclin E, cdc2, p27 and p21 -20,25-27The efforts to identify parameters that clearly correlate with the clinical outcome of GIST are not restricted to the cyclin-CDK-system. Similarly, the prognostic value of various other factors, such as p53, p16, p21, pRb, E2F1, p27KIP1, Mdm2, Bcl-2 and Bax is not yet entirely clarified. Although changes in their expression have been evaluated in regard to risk ranking, in most cases their correlation with the clinical outcome has not been validated in detail. Furthermore, the conclusions drawn are still in some cases contradictory ,18,28,290-resected high risk GIST with a tyrosine kinase inhibitor remains to be further investigated.In conclusion, conventional risk estimations including tumour size, mitotic rate and tumour location are useful to differentiate high risk and non-high risk GIST. The combination of positivity for cyclin H and high risk classification predicts highly significant poor prognosis in GIST. Also in patients with recurrence or metastases, the expression of cyclin H is the only relevant clinical predictor. Therefore, protein expression of cyclin H may allow subclassification of "very-high risk" (cyclin H-positive high risk GIST) from high risk GIST. Whether cyclin H alone or in combination with any other factor will be an indicator for the necessity of adjuvant treatment of RThe authors declare that they have no competing interests.Study concepts: JD, HS, UK, KK; Study design: JD, HS, MS, UK, KK; Data aquisition: JD, HS, MS, TFEB, UK, KK; Quality control of data and algorithms: JD, HS, MS, TFEB, UK, KK; Data analysis and interpretation: JD, HS, MS, AB, TFEB, DHB, UK, KK; Statistical analysis: JD, MS, AB, UK, KK; Manuscript preparation: JD, HS, UK, KK; Manuscript editing: JD, HS, AB, TFEB, DHB, UK, KK; Manuscript review: JD, HS, MS, AB, TFEB, DHB, UK, KKThe pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/10/350/prepubTable S1. Table 1: Suggested risk classificationsClick here for fileTable S2 & S3 and Figure S1. Table S2: Combined Cyclin H and p16 positivity - Results of the Survival Analysis Table S3: P values for Combined Cyclin H and p16 positivity Figure S1: Disease specific survival in high-risk GIST with combined positivity for cyclin H and p16 (p < 0.001).Click here for file |
Only in one instance has the metal binding site of metalloenzymes been exploited for therapeutic purposes and this is the use of Li+ in the treatment of bipolar affective disorder. Again the exact molecular target is not clear but is likely to involve a Mg2+-dependent enzyme of an intracellular signalling pathway. In Parkinson's disease, the selective loss of dopaminergic neurones in the substantia nigra may be caused by radical-mediated damage and there is good evidence to suggest that Fe2+ or 3+ is important in promoting formation of radical species. The evidence that free radicals are important in mediating other neurodegenerative conditions is less strong but still substantial enough to suggest that removal of reactive oxygen species or preventing their formation may be a valid approach to therapy.Metal ions are believed to participate in many neurodegenerative conditions. In excitotoxic cell death there is convincing evidence for the participation of Ca |
Fiber cells of the ocular lens are bounded by a highly specialized plasma membrane. Despite the pivotal role that membrane proteins play in the physiology and pathophysiology of the lens, our knowledge of the structure and composition of the fiber cell plasma membrane remains fragmentary. In the current study, we utilized mass spectrometry-based shotgun proteomics to provide a comprehensive survey of the mouse lens fiber cell membrane proteome.Membranes were purified from young mouse lenses and subjected to MudPIT analysis. The resulting proteomic data were analyzed further by reference to publically available microarray databases.More than 200 membrane proteins were identified by MudPIT, including Type I, Type II, Type III (multi-pass), lipid-anchored, and GPI-anchored membrane proteins, in addition to membrane-associated cytoskeletal elements and extracellular matrix components. The membrane proteins of highest apparent abundance included Mip, Lim2, and the lens-specific connexin proteins Gja3, Gja8, and Gje1. Significantly, many proteins previously unsuspected in the lens were also detected, including proteins with roles in cell adhesion, solute transport, and cell signaling.The MudPIT technique constitutes a powerful technique for the analysis of the lens membrane proteome and provides valuable insights into the composition of the lens fiber cell unit membrane. Lens fiber cells are bounded by a plasma membrane no less remarkable in composition and organization than the cytoplasm it encapsulates. In fiber cells, the plasma membrane serves the same basic function as in any eukaryotic cell; namely, providing a semi-permeable barrier to segregate the contents of the cell from the exterior. Not surprisingly, therefore, many widely-expressed membrane proteins are found in lens membranes. Na,K-ATPase, for example, a ubiquitous integral membrane protein, is expressed strongly by lens fiber cells . HoweverLens membrane proteins play central roles in the physiology and pathophysiology of the tissue. Genetic linkage studies have revealed that mutations in genes for Mip, Lim2, and other integral lens membrane proteins underlie inherited cataracts . Fiber cDespite the pivotal role of lens membrane proteins, our understanding of the composition and organization of the fiber cell plasma membrane remains fragmentary. The systematic analysis of membrane protein expression has been problematic due to the hydrophobic nature of membrane proteins and associated difficulties in solubilizing and resolving them on 2D gels. Shotgun methods, in which samples are treated with proteases and the resulting mixture of peptides are identified by mass spectrometry, offer a viable alternative. In particular, the development of MudPIT applications has facilitated the analysis of complex membrane proteomes -7. The lIn the current study, we used MudPIT analysis to further characterize the lens fiber cell membrane proteome. In addition to confirming the presence of several well-studied lens proteins, our analysis identified proteins not previously described in the lens and offered a semiquantitative determination of the relative expression levels of the various components.2 inhalation. Eyes were enucleated and the lenses were removed through an incision in the back of the eye. The lens capsule and adherent epithelium were dissected and discarded and the remaining fiber cell masses were stored at -80 °C until use. All the procedures described herein were approved by the Washington University Animal Studies Committee.Lenses from 121 18-28 day-old C57/BL6 mice sacrificed in the course of other studies were collected. Mice were killed by COLenses were thawed and homogenized in 6 ml of 20 mM sodium phosphate buffer (pH 7.0) containing 1 mM EGTA, and the membrane pellet isolated by centrifugation at 20,000× g for 30 min. These centrifugation conditions were also used for the membrane pelleting and washing steps described below. The pellet was resuspended by brief vortexing and washed in 6.0 ml of homogenization buffer containing 50 mM dithiothreitol (DTT) and membrane proteins purified by a modification of the method of Russell et al. . The pelEight-hundred μg of the recovered 1.2 mg of urea- and alkali-washed membrane fraction were used for a limited pepsin digestion of the membrane proteins using a modification of the method of Han and Schey . The pel4 in MS mode and 1×104 in Msn mode.A combination of cation exchange and reverse phase chromatography steps were used to separate the complex mixture of lens membrane and soluble fraction peptides in preparation for tandem (MS/MS) mass spectrometric analysis. Solid phase extracted peptides from both the membrane and soluble protein fractions were separated into 39 and 44 fractions, respectively, using a 2.1×100 mm polysulfoethyl A column and KCl gradient, as described previously . These fThe analysis of the lens membrane and soluble protein digests produced 269,200 and 224,484 MS/MS spectra, respectively. These spectra were used to create DTA files using BioWorks 3.2 (ThermoFisher) with a molecular weight range of 550 to 4,000, an absolute threshold of 500, group scan setting of 1, a minimum of 25 ions, and a charge state analysis using the ZSA algorithm. A mouse species subset of the Sprot (v57.2) protein database was prepared with concatenated reversed entries (and common contaminants) and searched with SEQUEST (ThermoFisher). Parent ion and fragment ion tolerances of 2.5 and 1.0 Da were used with calculated average and monoisotopic masses, respectively. Cysteine had a static modification mass of +57 Da, and no enzyme specificity was chosen. An in-house suite of programs scoring Appendix 1.The combined list of proteins found in both membrane and soluble protein fractions contained 575 non-redundant proteins. There were 197 proteins unique to the lens membrane fraction, 221 proteins unique to the lens soluble fraction, and 157 proteins in common. Of the 157 proteins in common, there were 35 that contained five or more spectral counts in the membrane fraction and showed a greater than twofold increase in spectral counts between the membrane prep sample and soluble lens sample and were thus classified as membrane enriched. Therefore, the total number of confident membrane protein identifications (unique plus enriched) was 232. Functional annotations were added to the protein results lists using the Protein Information and Property Explorer (PIPE) [A potential advantage of the MudPIT technique is that it provides a semiquantitative measure of relative protein abundance. There are several caveats, however. Clearly, a number of factors influence the spectral counts for a particular protein. For example, a protein would be underrepresented or even undetected if, by virtue of its tertiary structure or association with other elements, it were not efficiently cleaved during pepsin treatment. Similarly, certain peptides may be less stable than others and, therefore, be underrepresented in the final sample. One parameter that strongly effects the representation of a peptide in the final mix is the size of the parent protein. At equimolar concentrations, a large protein will generate more peptides than a small one of similar composition and structure. To normalize for this effect, we divided the spectral count for a given protein by the molecular mass of that protein so the abundance shown in the pie charts more closely resemble molar concentrations than weight concentrations. We recognize that the relationships may not be strictly linear and accordingly use the term “apparent abundance” when comparing the signals from two proteins. We note, however, that the lens membrane proteins shown here to have the greatest “apparent abundance” have also been shown in numerous published studies to be the most abundant proteins in the lens membrane.Lattin et al. recentlyAppendix 1).The 232 proteins identified in the lens fiber cell membrane sample included Type I, Type II, Type III (multi-pass), lipid-anchored, and GPI-anchored membrane proteins, in addition to membrane-associated cytoskeletal elements and extracellular matrix components. In this analysis, the entire fiber cell mass was utilized. Thus, the sample also included a small proportion of cells originating from the surface layers of the lens. This superficial layer contains metabolically active cells that contain a full complement of cytoplasmic organelles. Ninety three proteins known or suspected to be components of intracellular organelles were detected in the membrane proteome. Presumably, these proteins originated in the organelle-rich, superficial fiber cell layer. A spreadsheet showing the identified peptides and proteins in the lens membrane and soluble protein fractions, spectral counts, percent coverage, designation as either membrane unique or enriched, functional annotations, and links to the UniProt database are included as a supplemental data file across the cell membrane . Also in-/- mice [transporters, pumps, and channels category. These proteins are so abundant that they mask the expression of other components. In Two aquaporins were detected in this analysis, Mip and Aqp5 . Aqp5 ha-/- mice . As showNa,K-ATPase is a ubiquitously expressed membrane protein that regulates the intracellular levels of Na and K. The Na,K-ATPase consists of two subunits: a large catalytic subunit (α) and a smaller glycoprotein subunit (β). In fiber cells, the α1 and β3 isoforms appear to be the most abundant, with lower levels of α3 and β1. Previous studies have detected α1 and α3 in the fiber cells . In otheTwo other plasma membrane ATPases, ATP11c and ATP8a2, were detected, albeit at low levels. These proteins are thought to function in phospholipid transport.The solute carrier (Slc) designation includes a large group of membrane transport proteins with more than 300 members, organized into 47 families . The len+/K+/2Cl- transporter (Nkcc1/Slc12a2), the Na+/Ca2+ exchanger (Ncx1/Slc8a1) and the Na+/K+/Ca2+ exchanger (Nckx4/Slc24a4). Nkcc1 has a well defined role in cellular volume regulation and both biochemical and physiological data support the expression of Nkcc1 in cortical lens fibers [2+ ATPase (PMCA). However, no PMCA isoforms were detected in the plasma membrane proteome, consistent with earlier studies which noted epithelial rather than fiber expression of this protein [+/Ca2+ exchange (Ncx) mechanism or by K+-dependent Na+/Ca2+ exchange (Nckx). Significantly, the most abundant calcium extrusion protein detected in the current study was Slc24a4 (Nckx4). The expression levels of Slc24a4 RNA in the lens exceed that in any other tissue (LPEI = 66) yet, to our knowledge, the role of this protein in the regulation of lens fiber calcium has not been investigated. The ubiquitously expressed Slc8a1 (Ncx1) was also detected.In addition to amino acid transporters, several important ion transport proteins were detected, including the bumetanide-sensitive Nas fibers . Membran protein . CalciumPumps, transporters and channels grouping, the lens fiber cell-cell adhesion protein category is dominated by a few proteins expressed at very high levels. These are shown in As with the Lim2, Tmem47, Pmp22 and Perp are members of the Pmp22_claudin family. Members of the family each contain four transmembrane segments. Claudins, the best studied members of the family, are components of epithelial tight junctions but were not detected in the fiber cell membrane proteome. Pmp22 is a major component of myelin and mutations in Pmp22 are the cause of Charcot-Marie-Tooth disease Type1A . Pmp22 pThe existence of cadherin-based adherens junctions is supported by both morphological and biocMembers of the immunoglobulin superfamily (IgSF) are characterized by the presence of one or more extracellular immunoglobulin domains. The IgSF includes members that function as cytokine and growth factor receptors, antigen-presenting molecules and calcium-independent cell adhesion proteins. Eight IgSF members with demonstrated or suspected roles in intercellular adhesion were identified in the fiber cell membrane sample. The LPEI value for these 8 proteins ranged from 2-158 (mean=34) reflecting the importance of adhesive complexes in lens biology. The IgSF adhesive protein with the highest apparent abundance was Cadm1 . Cadm1 has not previously been described in the lens but is widely expressed in the central nervous system (including the retina), where it has an important role in driving synaptic assembly . Cadm1 fIn addition to Cadm1, other adhesion proteins that are strongly expressed in the nervous system were identified in the lens membrane. For example, LSAMP (limbic system associated membrane protein), a protein that is enriched in the cortical and subcortical regions of the limbic system , was reaTwo related molecules, junction adhesion molecule 3 (Jam3) and the coxsackie and adenovirus receptor (Cxadr), with well known roles in tight junction formation and stability ,55, wereA prominent component of the membrane proteome was Grifin . It is included here with the grouping of adhesive proteins solely on the basis of its expression pattern for theSeveral cytoskeletal, membrane-associated proteins were identified in the fiber cell membrane proteome . UnsurprBfsp1 and Bfsp2 , two abundant, lens-specific intermediate filament proteins, co-purified with the lens membranes. Filensin and CP49 are thought to be tethered to the fiber cell membrane in part via an interaction with the C terminus of Mip . SyneminPalm 1 and 2 are prenylated, palmitoylated proteins that associate with the cytoplasmic face of plasma membranes and are thought to be implicated in membrane dynamics and regulation of cell shape. Palm 1 is a Pax6-responsive gene and its occurrence in the lens has been noted previously ,60. The Several components of the spectrin/actin sub-membrane cytoskeleton were identified, including alpha 2 spectrin (Spna2), beta 1 spectrin (Spnb1), beta 2 spectrin (Spnb2), and ankyrin 2 . In the red cell membrane, ankyrin links the spectrin lattice to integral membrane proteins such as band 3. In the lens, ankyrin is essential for tissue transparency . The fibSeveral classes of signaling molecules were identified in the lens fiber cell membrane proteome .Heterotrimeric guanine nucleotide-binding proteins (G-proteins) are ubiquitously-expressed receptor/effector coupling molecules. Alpha , beta , and gamma (Gng5) G-protein subunits were detected in the lens membrane proteome. Three G-protein-coupled receptors were identified, Latrophilin 2, Gpr177 and Gprc5b. Gpr177 was recently shown to encode Wls/Evi, a protein that is essential for the secretion of Wnt proteins. Wnt signaling plays a critical role in patterning of embryos and control of cyto-architecture in several tissues, including lens . Gprc5b Several protein tyrosine kinase growth factor receptors were detected in the fiber cell membrane proteome. The receptor with highest apparent abundance was Epha2. Interestingly, potential ligands for Epha2, for example ephrin A1, were not detected in the current study. Epha2 has been implicated in both inherited and age-related cataract ,63. OtheFour different receptor-type protein tyrosine phosphatases were detected. The phosphatase with highest apparent abundance was Ptpra, an enzyme which dephosphorylates and activates Src family kinases and, thuIn the “Other” category are grouped signaling molecules that do not readily fall into one of the other designations. Flotillins (Flot1 and Flot2) are concentrated at caveolae, small indentations in the plasma membrane enriched in signaling molecules. Although they are relatively abundant proteins in the lens fiber cell membrane, the precise function of flotillins has yet to be determined. Fidgetin is a AAA+ ATPase reported previously in the mouse lens . The fidThe Ras superfamily of small GTPases was well represented in the fiber cell membrane proteome although2/day [Rho proteins are ubiquitously expressed molecules that play a pivotal role in actin polymerization and stress fiber formation. Rho, Rac, and Cdc42 have previously been identified in the lens. Disruption of Rho family GTPase activity by transgenic expression of Rho GDP dissociation inhibitor alpha (GDIα) results in abnormalities in the migration pattern, elongation and organization of lens fiber cells . During 2/day . However2/day .In preparing lens membrane samples for analysis, we removed by dissection the collagenous lens capsule and adhering lens epithelial cells. Nevertheless, extracellular matrix components and their receptors were still detected in the membrane proteome . Type IVCD44 gene show no overt lens phenotype [Most of the integrin subunits identified in the fiber proteome have been previously documented in the lens , where thenotype . CD47 ashenotype but whetFinally, two “sheddases”, Adam9 and Adam10, were identified in the membrane proteome. Sheddases are membrane-bound enzymes that cleave the extracellular portions of receptors and other transmembrane proteins often to release bioactive, soluble ectodomains. The role of Adams in lens cell biology in unknown, although downregulation of Adam9 accompanies the development of anterior polar cataracts .This analysis represents an effort to catalog systematically the expression profile of membrane proteins in mouse lens fiber cells. Previous studies in other species have utilized laser microcapture or MALDI |
During grape berry ripening, the vacuoles accumulate water, sugars and secondary metabolites, causing great impact in plant productivity and wine quality. However, the molecular basis of these compartmentation processes is still poorly understood. As in many species, the major bottleneck to study these aspects in grapevine is to obtain highly purified vacuoles with a good yield. The present paper describes an isolation method of protoplasts and intact vacuoles from grape berry cells and their functional characterization by transport and cytometric assays.2+ via a proton-dependent transport system.Protoplasts were prepared by enzymatic digestion of grape cells, and vacuoles were released and purified by a Ficoll step gradient centrifugation. The tonoplast stained strongly with the fluorescent dye FM1-43 and most vacuoles maintained an internal acidic pH, as assessed by Neutral Red. Flow cytometry analysis of vacuole samples incubated with the calcium-sensitive fluorescent probe Fluo-4 AM revealed a well-defined sub-population of intact vacuoles. As assessed by the pH-sensitive probe ACMA, intact vacuoles generated and maintained a pH gradient through the activity of V-ATPase and V-PPase and were able to transport Ca2+ strongly suggests the intactness and physiological integrity of these extremely fragile organelles. Grapevine protoplasts and vacuoles may be used as models for both basic research and biotechnological approaches, such as proteomics, solute uptake and compartmentation, toxicological assessments and breeding programs.Highly pure, intact and functional protoplast and vacuole populations from grape cells were obtained with the present method, which revealed to be fast and efficient. The capacity of the vacuole population to sequester protons and accumulate Ca Vitis vinifera L. cells . Cells were cultivated in liquid mineral medium supplemented with 2% (w/v) sucrose. The method of Greuter and Keller [Stachys sieboldii tubers was adapted for grape cells and optimized by introducing several changes, including the composition of the media, enzyme proportion and purification steps. Protoplasting was performed by enzymatic digestion of the cell walls (450 × 106 cells) with 0.007% (w/v) cellulase Y-C and 0.0007% (w/v) pectolyase Y-23 in a final volume of 50 ml. Digestion occurred in Gamborg B5 Medium supplemented with 0.4 M sucrose, under shaking (50 rpm), at pH 5.8 and 22°C. Different digestion periods of 4 to 12 h were tested. The resulting protoplasts were gently collected and subsequently purified. Initially, protoplasts were separated by floating, at 150 × g for 8 min, and subsequently washed with the same medium. A discontinuous gradient was prepared by overlaying 1 volume of a solution containing 0.05 M glucose, 154 mM NaCl, 125 mM CaCl2 and 5 mM KCl, pH 5.8, on the protoplast suspension, followed by centrifugation at 150 × g for 8 min. Protoplasts were recovered from the interface of the gradient, resuspended in 3 volumes of the glucose-containing medium and sedimented for 8 min at 150 × g. The pellet was washed in 0.4 M mannitol, 15 mM MgCl2, 5 mM Mes, pH 5.8, resuspended in the same medium and stored at 4°C. Protoplasts were counted in a Malassez chamber under the light microscope. A protoplast yield of 13% was obtained as a result of a 12 h digestion protocol, decreasing approximately to 6% when the digestion lasted 4 h.Protoplasts were prepared from d Keller to isolaThe viability of the protoplasts was tested with the fluorescent dye fluorescein diacetate (FDA). The intact plasma membrane is permeable to FDA, and FDA is converted into a green fluorescent dye, fluorescein, by internal esterases, displaying a green fluorescence in viable cells . Figure ® XLTM (Beckman Coulter) flow cytometer equipped with an argon-ion laser emitting a 488 nm beam at 15 mW. Green fluorescence was collected through a 488 nm blocking filter, a 550 nm long-pass dichroic and a 525 nm band-pass filter. For each sample, 20,000 protoplasts and 20,000 vacuoles were analysed at low flow rate. An acquisition protocol was defined to measure forward scatter (FS), side scatter (SS) and green fluorescence (FL1) on a four decades logarithmic scale. Data were analysed by WinMDI 2.8 software. The analysis of the biparametric histograms, plotting log SS against log FS, revealed some heterogeneity in both relative complexity and size of the protoplast population , one layer of 3.0% Ficoll (w/v) and one layer of vacuole buffer containing 0.5 M mannitol, 10 mM MOPS, pH 7.5 and a protease inhibitor cocktail , in the proportion of 7:3:1 volumes. The 3.0% Ficoll solution was prepared by diluting the lysis buffer with vacuole buffer. The vacuoles were counted on a Malassez chamber under the light microscope. In a typical fractionation procedure, an average amount of 4.0 × 106 vacuoles was obtained, corresponding to about 12 % of the total number of protoplasts (purified by a 12-h digestion protocol) subjected to lysis. Since the yield of intact vacuoles was always higher when protoplasts were isolated by a 12-h digestion protocol (not shown), this digestion duration was used in all subsequent experiments. Cytosolic glucose-6-phosphatase was used as a marker enzyme to monitor vacuole purification [-1 mg prot-1), respectively. Only 2% of the marker enzyme was recovered in the vacuolar fraction, indicating that this sample was strongly depleted in protoplasts and cytosolic contaminations. This conclusion was further supported by microscopic observation and flow cytometry analysis.Vacuoles were released upon the protoplast osmotic lysis at a relatively high temperature and were purified by a Ficoll step gradient centrifugation. The methodology was adapted from the protocol used to obtain vacuoles from Arabidopsis protoplasts . The proinset). This figure suggests that several structures belonging to the "vacuolar apparatus" remained attached to the central vacuole after protoplast lysis. The virtual absence of intact protoplasts in the vacuole preparations was confirmed by the lack of labelling by FDA that only stains the cytoplasm.To visualize the vacuoles with the fluorescence microscope, the styryl dye FM 1-43 was used as described earlier . This fl4Cl almost completely abolished the pH gradient across the majority of the vacuoles.Most of the intact vacuoles, ranging in size from 10 to 50 μm, maintained an internal acidic pH and exhibited a red colour after being labelled with Neutral Red, a lipophilic phenazine dye (Sigma-Aldrich), in spite of their resuspension in a buffer at pH 7.5 Figure . This acThe flow cytometry analysis of vacuole samples is depicted in Figure in vivo plant system than tonoplast vesicles. The low pH of the vacuole of fruit cells is the result of two processes: 1) pumping protons across the tonoplast, which directly results in a drop of vacuolar pH, and 2) synthesis and accumulation of organic acids in the vacuolar sap [4 and 1 × 105) were added to the assay cuvette (2.0 ml), containing 100 mM KCl, 2 mM MgCl2, 0.1% BSA (w/v), 10 mM MOPS-Tris pH 7.2 and 2 μM ACMA. The optimal concentration of Mg2+ in the assay medium was previously adjusted taking into account that the cation forms insoluble complexes with PPi, and then changing PPi/Mg2+ ratio modifies the H+ pumping activity of V-PPase . Figure + pumping activities across the membrane of intact vacuoles from grape cells, as measured by the fluorescence quenching of ACMA. Both NH4Cl and CCCP induced a prompt recovery of ACMA fluorescence, demonstrating the generation of a pH gradient. In this biological system, the V-PPase seems to be the main tonoplast proton pump, generating a pH gradient 1.4-fold greater than the V-ATPase, counting with 170 times less substrate concentration: the Vmax value for the V-PPase proton pumping was 4.3 × 10-5 %ΔF min-1 vac-1, while the Vmax for V-ATPase was 3.1 × 10-5 %ΔF min-1 vac-1. Indeed, the Km of V-PPase proton pumping was determined to be 2.0 μM PPi, while the Km for the V-ATPase was 340 μM ATP.Monitoring the transmembrane proton gradient in intact vacuoles is a proper approach to study the mechanisms of vacuolar acidification, because intact vacuoles are physiologically closer to the olar sap . For proolar sap ,15. Vacu2 to dissipate a pre-established ∆ pH gradient across the tonoplast was used to assess the involvement of a Ca2+/H+ antiport system. The addition of CaCl2 to energized intact vacuoles through the activation of V-PPase resulted in an immediate dissipation of the proton gradient . A vacuole sample (100 μl) was also labelled with 0.5 μM of the calcium probe Fluo-4 AM, for 15 min at room temperature, prior to observation under the fluorescent microscope. The high fluorescence observed was substantially decreased after the addition of 300 μM calcymicin , generate a proton electromotive force, which, in turn, allow the secondary active transport of several compounds that are accumulated in the vacuole, as it has been shown for Cas Figure is in agStructural studies -21 and, The authors declare that they have no competing interests.NF carried out the experiments reported in the main manuscript, performed data processing and statistical analysis and participated in amending the draft. RS assisted flow cytometric analysis. FL and CV contributed to the optimization of the protoplast purification procedure. HG and SD conceived the study and wrote the manuscript. All the authors approved the final version. |
Coronary artery anomalies are found in 0.6% to 1.55% of patients who undergo coronary angiography, and the increasing use of diagnostic coronary angiography is uncovering even more such abnormalities. We present a very unusual case of an anomalous origin of the left circumflex coronary artery (LCx) from the proximal right coronary artery (RCA).We present a case of a 45-year-old-man with a recent history of a non ST elevation myocardial infarction. The coronary angiography reveals an ectopic left circumflex coronary artery from the right coronary artery. In this report we attempted to highlight the rarity of this coronary anatomy.Anomalous origins of the coronary artery are rare, but may cause myocardial ischemia and sudden death. Thus, their reliable identification is a matter of paramount importance possibly evaluating the effects of therapeutic intervention. The presence of anomalous coronary arteries is observed about 1% of patients undergoing cardiac catheterization. However, their identification is crucial to the management of the patient with associated coronary artery disease. This report presents a very unusual case of an anomalous origin of the left circumflex coronary artery (LCx) from the proximal right coronary artery (RCA) in a patient presented with a non ST elevation myocardial infarction of the inferior wall.A 45-year-old man was admitted to our hospital with a recent history of chest pain. He had no specific past medical history, but he was a smoker. The electrocardiogram reveals mildly depression of ST in the leads of the inferior wall. The troponin and the remaining cardiac enzymes were elevated. He was hemodynamically stable with a blood pressure approximately 120/80 mmHg. The patient received dual antiplatelet therapy (aspirin 100 mg/day and clopidogrel 300 mg once and after at a dose of 75 mg/day), intravenously glycoprotein IIbIIIa inhibitors and heparine for 48 hours; the remaining therapy was a statin, an angiotensin converting enzyme inhibitor (ramipril) and a beta blocker (metoprolol). Afterwards, he underwent coronary angiography to evaluate coronary artery disease because of his recent history of non ST elevation myocardial infarction of inferior wall. In this patient, the mildly stenosed LCx coexists with a stenosed RCA, causing a non-ST elevation coronary syndrome (Figure The ectopic origin of the LCx is a well-recognized variant, which is considered the most common coronary anomaly and can be found in approximately 0.37% to 0.7% of all patients. The anomalous LCx most commonly arises from a separate ostium within the right sinus, or as a proximal branch of the RCA . AlthougWritten informed consent was obtained from the patient's next-of-kin for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.OK and MG analyzed and interpreted the patient data regarding his hospitalization. SP and PK performed the coronary angiography, and were the major contributors in writing the manuscript. All authors read and approved the final manuscript. |
For rel al. 1981; Abriel al. 1981; Borgias al. 1985; Jaswal al. 1990; Keefer al. 1988. 2H7OS+·Br6Te2−·2C2H6OS2CM r = 921.59 Triclinic, a = 8.0087 (2) Å b = 9.2428 (2) Å c = 10.5249 (3) Å α = 66.280 (1)°β = 70.732 (1)°γ = 66.340 (1)°V = 639.98 (3) Å3 Z = 1 Kα radiationCu −1 μ = 23.30 mmT = 100 (2) K 0.23 × 0.20 × 0.16 mm Bruker APEX2 CCD detector diffractometerSADABS 2112 reflections with R int = 0.023 R[F 2 > 2σ(F 2)] = 0.021 wR(F 2) = 0.056 S = 1.15 2112 reflections159 parametersAll H-atom parameters refinedmax = 1.02 e Å−3 Δρmin = −0.68 e Å−3 Δρ APEX2 used to solve structure: XS in SHELXTL (Sheldrick, 2008SHELXL97 (Sheldrick, 2008XP (Bruker, 1998XCIF in SHELXTL (Sheldrick, 2008Data collection: 10.1107/S1600536808015468/tk2262sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808015468/tk2262Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Metastatic tumors are the most common intra-ocular malignancies and choroid is by far the most common site for intra-ocular malignancies. Multiple foci are usually involved, and bilateral involvement is frequently seen. The primary sites for choroidal metastasis in decreasing order and by gender are: breast, lung, unknown primary, gastrointestinal and pancreas, skin melanoma and other rare sources in females, and lung, unknown primary, gastrointestinal and pancreas, prostate, kidney, skin melanoma and other rare sources in males. Available treatment options are external beam radiotherapy and plaque radiotherapy, while new methods like surgical resection, transpupillary thermotherapy and intravitreal chemotherapy offer promises for the future. The use of chemotherapy alone for choroidal metastases is not widely reported.We report the case of a 50-year-old Indian man who had a unilateral solitary lesion in his right eye. He was found to have an adenocarcinoma of the lung with choroidal metastasis as the first presenting sign. There were no findings of metastasis involving his contralateral eye. He was administered chemotherapy based on gemcitabine and carboplatin. He had significant progressive subjective and objective improvement since his first chemotherapy. His current best corrected visual acuity is 20/60 after three cycles of chemotherapy.Chemotherapy alone can be used as an effective mode of treatment in patients who have primary tumors that respond to chemotherapy. Metastatic tumors are the most common intra-ocular malignancies, and choroid is by far the most common site for intra-ocular malignancies. Multiple foci are usually involved and bilateral involvement is frequently seen. Available treatment options are external beam radiotherapy and plaque radiotherapy. Meanwhile, newer modalities such as surgical resection, transpupillary thermotherapy and intravitreal chemotherapy offer promises for future. The use of chemotherapy alone for choroidal metastases is not widely reported.A 50-year-old Indian man presented with headache, and blurred vision in his right eye for the last three months. He had no history of seizures, vomiting or dizziness. However, he stated that he had occasional dry cough for the past four to five months.A thorough ophthalmic and systemic examination was carried out. Ocular examination revealed his best corrected visual acuity to be counting fingers at one foot in the right eye and 20/20 in the left eye. Results of his slit lamp examination were unremarkable. His pupils were of normal size and normal reaction. His ocular movements were normal in all gazes. His intra-ocular pressure was also normal. His systemic examination showed bilaterally symmetrical chest movements. Vesicular breath sounds were audible bilaterally, but sounds on the right side were decreased as compared to the left side. Vocal fremitus and vocal resonance were decreased over the right side from the first to fourth intercostal space. No added sounds were audible. No lymph nodes were palpable clinically. A fundus picture of his right eye showed an ill-defined, yellow-white elevated lesion in choroid about three to four times the disc diameter in size, superior-temporal to the disc. A fundus picture of his left eye was normal.Meanwhile, fluorescein angiography of our patient's right eye revealed hyperfluorescence from the surface of his choroidal tumor. The tumor was on its late phase and it had already accumulated sub-retinal fluid Figure . A B-scaResults of our patient's bone scan, and upper and lower gastrointestinal series were also normal. A chest X-ray showed a homogenous opaque mass in our patient's right hilar area. His Mantoux, immunoglobulin M, and immunoglobulin G for tuberculosis tests were all negative. A computed tomography scan of our patient's thorax showed a right central bronchogenic carcinoma with ipsilateral lung having distant metastasis. Computed tomography-guided fine needle aspiration cytology from his right lung lesion was suggestive of adenocarcinoma of the lung Figure . Ultrasothree cycles is currently 20/60 - please clarify the inconsistency and/or provide more information about acuity at all treatment cycles in the body of the manuscript] in the involved eye. Recent fundoscopic examination did not show any mass.We prescribed six cycles of chemotherapy and the patient subsequently showed an improvement in vision. His subjective improvement after the first chemotherapy was about 50%. His best corrected visual acuity was 20/80 in the involved eye. He was administered chemotherapy based on gemcitabine and carboplatin. He had significant progressive subjective and objective improvement since his first chemotherapy. His current best corrected visual acuity is 20/30 after six cycles of chemotherapy [AU: the abstract states his best acuity after Here we report a case of lung adenocarcinoma with choroidal metastasis as the first presenting sign. Our patient was administered with chemotherapy and showed a substantial improvement in vision after his first session of chemotherapy. His response to succeeding cycles has been very encouraging.Metastatic tumors are the most common intra-ocular malignancies and choroid is the most common site for intra-ocular malignancy ,2. Multiet al. reported that at the time of ocular diagnosis, 66% of patients reported a history of primary cancer and 34% had no history of cancer. From 142 patients with no prior cancer, the primary site was discovered in 49% [Shields Of all patients reported to have choroidal metastasis as the presenting symptom, 58% had lung cancer and 28% had breast cancer . B-scan et al. described six patients with choroidal metastasis who were treated with chemotherapy and underwent regression [Letson gression . Thus, cThe major determinants of survival after the diagnosis of choroidal metastasis are primary tumor type and local tumor invasion at the time of diagnosis. The median survival from lung cancer after the discovery of choroidal metastasis is reported to be 3.3 months (range 0.5 to 19 months). Our patient, described in this report, has responded well to treatment and is doing well 13 months after diagnosis.In the past, choroidal metastasis was treated with radiotherapy alone or in combination with chemotherapy. Our patient responded well after chemotherapy alone and showed marked improvement after each cycle of chemotherapy. Thus, chemotherapy alone can be a viable treatment for choroidal metastasis if the primary tumor is responsive to chemotherapy. As such, acute radiation damage and its sequelae to vital structures close to the eye can be prevented during and after radiotherapy.Written informed consent was obtained from our patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.AS was involved in the conception and design of the study, analyzed and interpreted the data, and drafted the manuscript. PS was involved in the conception, design and drafting of the manuscript. KS drafted the manuscript and revised it critically for important intellectual content. PSH was involved in the acquisition, analysis and interpretation of data and provided inputs for important intellectual content. VS interpreted the data and provided inputs for important intellectual content. NKP drafted the manuscript and revised it critically for important intellectual content. All authors read and approved the final manuscript. |
Physicians in primary and secondary care are frequently confronted with patients with medically unexplained symptoms (MUS). In order to solve their patients' problems and out of a fear of overlooking a serious disease, many physicians give their patients full physical examinations and interventions, thereby incorrectly confirming the somatic nature of their condition. Preventing somatization could be achieved by examining the patient's symptom presentation for clues to underlying psychosocial issues and by an appropriate physician response.Ninety-seven videotaped medical visits from primary care patients presenting MUS for the first time were analyzed. Patients' presentations were categorized in: (1) symptoms only; (2) symptoms with a clue to an underlying concern; or (3) symptoms with an explicit concern. General practitioners' (GPs') responses to patients' presentation were classified into ignoring or more or less exploring responses. Exploring responses were further subdivided in non-directional explorations, clue explorations and medical explorations.Results show that most patients presented their symptoms together with a reference to an underlying concern. Yet, most of them did so in an implicit way. GPs usually explored the concern presented by the patients, but most often in a medical way only.To address the potential psychological basis of patients' medically unexplained symptoms, GPs should pay more attention to the specific clues patients present to them. Likewise, in order to receive full attention, patients should try to present their concerns more explicitly. In primary as well as secondary care a large number of patients commonly present with persistent physical symptoms for which no somatic origin can be found. The major issue in these medically unexplained symptoms (MUS) is that there is a delicate balance between diagnosing MUS and the physician missing a somatic disease. Because physicians take responsibility for solving their patients' problems and because they are afraid of overlooking serious diseases, many patients receive a whole spectrum of physical examinations, interventions and referrals, to exclude potential somatic causes. This contributes to their beliefs that the presented symptoms are indeed of physical origin, which was described by Quill and otheIn order to be able to diagnose MUS, research has been done on recognizing these symptoms in an earlier stage in the medical process. Salmon et al. examinedAll these studies concerned qualitative analyses of the presentation of symptoms and the physician's response to this presentation. To be able to use the presentation of clues by patients as a diagnostic tool, quantitative analysis is needed to confirm the relation between those clues and MUS. Floyd et al. presenteIn order to analyse the initial communication between patients and physicians about the physical symptoms as a presentation of MUS, video recordings of consultations in the GP's office were obtained from The Second Dutch National Survey of General Practice (DNSGP2) performed by NIVEL in 2001 . Of the Psychological Impact On Symptoms (PIOS) After the consultation the GPs had to score on a 5-point scale whether they considered the cause of the presented physical symptom to be: 1) Only somatic 2) More somatic than psychological 3) As much somatic as psychological 4) More psychological than somatic 5) Only psychological. For the purpose of this study patients with a score of 4) or 5) were selected.Out of the 2784 videorecordings, consultations were selected based on the following criteria: Diagnosis 1) Diagnosis had to be scored by the GP as an ICPC-code; 2) Those scored in ICPC chapter 18 – Psychological – were excluded; 3) The primary symptom presented by the patient had to be of physical origin, so symptoms scored by the video observer of DNSGP2 as ICPC chapter 18 – Psychological – or ICPC chapter 26 – Social – were excluded; 4) Symptoms previously presented to the GP were excluded. This was verified by the patient questionnaire of DNSGP2. The first three criteria were used to determine whether the consultation really concerned medically unexplained symptoms. The fourth criterium excluded those consultations in which the GP already had an idea about the cause of the symptoms, since the objective of the study was to learn about the initial presentation by the patient and the GP's response to that. After this selection process 120 videorecordings remained. During observation it became obvious that in 21 recordings the GP already had prior knowledge of the symptoms and that in 2 cases there was a technical malfunction of the videotapes, resulting in 97 recordings that were used for further evaluation in this study.In order to evaluate the relationship between patients' presentations and GPs' responses, the descriptions used in literature were used to form a model for patient's presentations and GPs' responses figures and 2. TThe presentation by the patient was defined as verbal expressions of physical symptoms during the first uninterrupted part of the conversation. Presentations were divided into three major classes, mutually exclusive and exhaustive, according to those used by Floyd et al. 2005) figure . The sec005 figurThe patient speaks about his symptoms without any reference to an underlying concern.The patient expresses his concern or worry in a hidden form; he makes an equivocal remark about what might be troubling him, without explicitly mentioning the problem itself. Within this class there are two subclasses:The clue in this subclass refers to the patient's thoughts of what is the cause of his symptoms. This can be about causative factors without mentioning a specific disease or it can be about the solution of their problem, which automatically indicates that he has a hypothesis of what the underlying cause is. In some special situations patients actually have such a hypothesis, but they trivialise the possible sincerity of their symptoms. They tell their GPs that they believe it is nothing important or they explicitly state that they do not believe the hypothesised condition to be true .The patient tries to account for visiting the GP or for having a concern. One way is to 'convince' the GP by vividly describing or exaggerating the symptoms, or presenting their symptoms in a syndromal pattern. Another way is 'explanation' in which the patient tries to clarify the reason for visiting or for the concern, e.g. by telling a personal story or medical history. The 'Justify' subclass also concerns quoting the opinion of a third person about their symptoms (Projection) and starting a different, seemingly more important, subject, while the real concern remains hidden (Nonrelated subject).This class contains situations like a direct question concerning a diagnosis, when the patient says he fears a particular disease, when he states that he is worried or uncertain about his condition or when he discloses symptom-related psychosocial problems.See additional file A response from the GP can be verbal or nonverbal, but since this research only concerns verbal reactions, the nonverbal reactions are excluded from further analysis. The verbal response is defined as a single turn, stretching from the first word of the GP to the start of the next turn of the patient. There are a few exceptions to this verbal definition, which are not scored as a GP's response: The GP finishes the sentences of the patient with a few words or a very short sentence ; Short facilitations/exclamations ; The GP tries to start his turn, but is immediately interrupted by the patient, who continues his turn; Literal reflections uttered by the GP to confirm that he heard correctly or to encourage the patient to continue. These reflections may only refer to the last sentence of the patient and the patient has to continue his turn immediately after the reflection.Three exhaustive but not exclusive classes for GPs' responses were derived from the responses as described by Floyd et al. , supplemThe GP fails completely to respond to the presented symptoms, clue or concern. Examples are: Continuing on a different subject; performing a physical examination; giving no verbal response whatsoever.The GP reacts directly to the presentation of symptoms, without creating a new opportunity for the patient to provide more information about his situation.This includes responses like: Normalisation of the problem, i.e. when the GP trivialises the symptoms, clue or concern, or he tries to reassure the patient without further exploration; shifting back responsibiliy to the patient, i.e. when the GP emphasises that the patient has to take responsibility for his own problems; expression of own emotions, i.e. when the GP expresses how he feels about the patient's problems and shows sympathy for the situation, without giving rise to exploration of the problem; acknowledgement of the symptoms, very similar to 'Expression of own emotions', but only concerning the understanding of the situation and not the feelings of the GP. Note: Do not confuse this subclass with a reflection in the class clue-exploration, where the GP acknowledges the underlying clue instead of the symptoms and tries to investigate the patient's concern about the subject; and, humor, i.e. when the GP makes a joke in response to the symptom by the patient.The GP responds to the presentation of symptoms, in order to explore an underlying concern.There are three kinds of responses: Non-directional exploration, i.e. when the GP stimulates or asks the patient to tell more about his situation with a non-directing response. He tries not to lead the patient in a specific direction and only facilitates the conversation; clue-exploration, i.e. when the GP tries to identify the underlying worry or to expand on the explicit concern mentioned. Two types can be distinguished within this subclass, namely 'reflection' and 'investigation'. The first one is a response in which the GP summarises and interprets the presentation and gives feedback to the patient about his own situation. 'Investigation' means that the GP asks a direct question related to what the patient just said, in order to explore the clue or concern; and, medical exploration, i.e. when the GP uses reflection, closed or open questions to gather more information about the medical nature of the problems and avoids the clue or concern. Utterances that include both class 2 and 3 responses are coded as class 3 responses.See additional file The reliability of the observations has been verified by taking a random sample of 11 video conversations out of the total 97 conversations and scoring those a second time. The total number of observations as well as the class of presentations and responses were compared with the results of the first series. In the original run a total of 30 observations of 'presentations' and 'responses' were scored, compared to 33 observations during the secondary survey. All 30 observations of the original run were also scored in the secondary survey, resulting in three additional observations and no missings during the second run. In 29 of the observations there was agreement on the scored class, whereas for 1 observation of the original run a different class was scored in the secondary survey. This resulted in an overall agreement of 87.9% (4 mismatches out of 33) and 90.5% and 83.3%, respectively, when stratified for the groups 'presentations' and 'responses'.As depicted in table Eleven of the ninety-seven patients (12.1%) presented their symptoms with Class 1 (Symptoms Only), while sixty patients (68.0%) expressed a clue according to presentation Class 2 and 20 patients according to Class 3 (20.6%). Of the sixty patients with Class 2, twelve patients (18.2%) used only Subclass 2A (Objectify) twenty-five (37.9%) used only Subclass 2B (Justify) and twenty-nine patients (43.9%) used both subclasses.Most GPs responded with an exploring expression (79.4%); in sixty-three percent this was a medical exploration and in twenty-four percent they explored the clue. In six consultations (6.2%) the GP fully ignored the patient and a non-exploring response was made in 24 cases (24.7%).In eight cases the relationship between presentation and response was beyond chance (p < 0.05) table . ObjectiTo describe MUS, different definitions have been used that do not overlap completely. The definition used by Nimnuan et al. , for insDuring a medical visit between a patient and a GP, differences on emotional and cognitive level may complicate the interpersonal interaction. This may be reflected by patients expressing their concerns carefully as clues and GPs ignoring the affective load of the patient's message. In the case of MUS, it is important to recognize the affective message hidden in the symptom presentation, in order to intervene in an early stage and therefore prevent the iatrogenic harm of continuing physical investigations and treatment. Our study indicated that the majority of patients with MUS indeed present their symptoms with a clue to an underlying psychosocial concern, much more so than MUS-patients imagined . HoweverGPs seem to explore explicit concerns but – in conformity with previous studies – they sWhen dealing with patients with MUS, it would be best to explore every clue they give about possible underlying psychological problems . In contUnfortunately, due to a lack of power, some other relationships yielded merely trends in a statistical sense. Also the question remains whether the presentation of MUS actually leads to specific GP responses; no causal relationship can be established, since the MUS population was not compared to an average or typical patient population. Furthermore, like previous studies, the focus in the present study was on the initial presentation of physical symptoms as put forward by patients' and GPs' subsequent response to this presentation. Although studies on the clinical importance of the ventilation of stress ,13 do suPhysicians should be recommended to pay more attention to the specific clues patients present to them, as an opening to address the psychological basis of the patients' symptoms. For this purpose they may have to require extra skills and confidence . LikewisThe authors declare that they have no competing interests.The study was designed by SvD. TK conducted the study, performed the analysis and then drafted the manuscript together with SvD. Both authors read and approved the final manuscript.Appendix 1. Examples of patients' presentation classes.Click here for fileAppendix 2. Examples of GPs' response classes.Click here for file |
Correction for:10.1371/journal.pbio.0050229Levine E, Zhang Z, Kuhlman T, Hwa T (2007) Quantitative characteristics of gene regulation by small RNA. PLoS Biol 5(9): e229. doi:zzhongge@biomail.ucsd.edu.The authors would like to add the second author, Dr. Zhang, as a second corresponding author. He can be contacted by e-mail at |
These chains are further connected to each other by weaker C—H⋯O hydrogen-bonding interactions, leading to the formation of a three-dimensional network.The asymmetric unit of the title compound, C Å b = 20.130 (2) Å c = 10.434 (4) Å β = 104.84 (2)°V = 1845.6 (10) Å3 Z = 8 Kα radiationMo −1 μ = 4.09 mmT = 298 K 0.37 × 0.29 × 0.19 mm Enraf–Nonius Turbo-CAD-4 diffractometerT min = 0.145, T max = 0.298 (expected range = 0.224–0.460)Absorption correction: multi-scan 2980 reflections with R int = 0.040 2 standard reflections frequency: 120 min intensity decay: 4% R[F 2 > 2σ(F 2)] = 0.047 wR(F 2) = 0.112 S = 1.01 4433 reflections274 parametersH-atom parameters constrainedmax = 0.80 e Å−3 Δρmin = −0.75 e Å−3 Δρ CAD-4 EXPRESS (Enraf–Nonius, 1994CAD-4 EXPRESS; data reduction: XCAD4 (Harms & Wocadlo, 1995SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997DIAMOND (Brandenburg & Putz, 2005WinGX (Farrugia, 1999Data collection: 10.1107/S1600536809022879/dn2458sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809022879/dn2458Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
To compare the global gene expression profile of stratified epithelia generated in vitro using simian virus 40 (SV40) immortalized human corneal epithelial cells with the previously reported gene expression of normal human corneal epithelia.2 were dissolved in an RNA purification lysis buffer. Purified RNA was used to globally determine gene expression levels using high-density single-channel oligonucleotide microarrays. Raw hybridization readings were converted into relative gene expression levels using Robust Multi-array Average (RMA) algorithm. Expression levels for selected genes were validated by real-time RT-qPCR. The biologic significance of the gene expression profiles was interpreted with the help of several microarray software analysis tools and ad hoc thematical analysis.Immortalized cells expanded in submerged culture were grown in an air-liquid interface of liquid permeable collagen-coated filters to foster stratification and differentiation. Stratified epithelia displaying resistances exceeding 300 Ω · cmALDHs), and paired box gene 6 (PAX6) and its whole downstream transcriptome. Overexpression related to genes associated with cell cycling stimulation.The stratified cell culture to native epithelial comparison identified over- and under-expression in 22% and 14% of the probed genes, respectively. The larger expression decreases occurred in genes intimately associated with both the stratified epithelial lineage at large such as keratin 14 and the corneal phenotype, such as keratin 12, connexin 43, aldehyde dehydrogenases (The results indicate that the stratified corneal epithelial cell model generated using SV40 immortalized cells may be useful only in certain research applications. Extrapolations of studies with these cells to actual tissue cells should be done with a great deal of caution. The corneal epithelium is a stratified lining that serves as a critical protective barrier for the cornea. It prevents pathogen infiltration and limits fluid inflow into the transparent, dehydrated corneal stroma. The latter is primarily accomplished by high ionic resistance tight junctions coupled to an apical membrane with low solute permeability . The junIn recent years, cell culture models based on both primary and immortalized cells have been developed as potentially reliable models of the native human corneal epithelium for either basic research or chemical testing . This laContinuously growing cells are preferred as an indefinite source of human cells, because they are renewable and easily maintained. Simian virus 40 (SV40) immortalized human corneal epithelial (iHCE) cell lines were independently developed by Araki-Sasaki et al. and KahnIn spite of the induced transformation, when grown on permeable filters at an air-liquid interface, the SV40 immortalized cells stratify, yielding multi-strata that resemble in many aspects both epithelia generated with untransformed corneal cells and native tissue . Apical Yamasaki et al. recentlySince gene expression is strongly affected by cell culture conditions, we have now compared the gene expression profile of these cells when in the stratified, high transepithelial resistance condition, which is used to mimic the normal environment of the corneal epithelium, against the profile for the native, freshly isolated epithelium . The resThe SV40 immortalized human corneal epithelial cell line (p4) was originally obtained from Dr. Hitoshi Watanabe . During 2 were dissolved in TriReagent . Total RNA isolated from this solution was further purified using RNAeasy spin columns . RNA concentration and purity were determined from 260 nm and 280 nm absorbances. Integrity was determined using the Agilent 2100 BioChip . The RNA was subjected to a single amplification run, labeled with biotin nucleotides, digested into proper size fragments, and hybridized to the HG-U133A gene microarray following a standard protocol established by Affymetrix. Hybridized chips were reacted with FITC-avidin and raw fluorescence intensities were read with a laser reader. HG-U133A contains >22,000 probes that provide for the representation of about one-half of the human genome. The raw signal intensity readings have been deposited in the Gene Expression Omnibus (GEO) under the accession number GSE22539.Cultures with resistances exceeding 300 Ω · cmGEO, series accession number GSE5543.The tissue (t)HCE data used in this study were generated previously for comparative study of gene expression profiles in freshly isolated human corneal and conjunctival epithelia . The intIt is pertinent to point out that the experimental steps for the generation of the microarray results, starting with RNA repurification and ending in HG-U133A signal intensity readings, were performed at the MicroaArray Shared Facility of the Mount Sinai School of Medicine, New York, NY, under near identical conditions, including reagent used, technical personnel and automated microarray instrumentation.Entrez gene database [Microarray raw data files for three independent replicates of iHCE stratified cultures and previously published tHCE generated from Dispase-isolated epithelia that were processed in an identical manner to the current processing were imported into R v. 2.8.0 Bioconductor . Custom database . This redatabase . iHCE/tHt-test implemented in the limma package [Differential expression was tested by the package . One setDAVID) functional annotation tool [Genomatix BiblioSphere v. 7.0 software. In the BiblioSphere process, connections in the network were drawn if two genes were either co-cited in the literature or contain consensus binding sites in their promoter regions for specific transcription factors and global differences in genes based on their promoters. In addition, differences in selected critical cell signal transduction pathways or gene families were manually examined using pathways depicted in Kegg or Biocarta.The Database for Annotation, Visualization, and Integrated Discovery .iHCE RNA was isolated from two separate cell culture batches, each with three replicates, distinct from those used for the microarray measurements. Three independent replicates of tHCE samples were obtained from photorefractive keratectomy (PRK) eye surgery performed at the Eye Clinic Silmäkeskus Laser Oy, Helsinki, Finland. Collection of this tissue was sanctioned by the local IRB and performed after obtaining informed, written consent from the donors. The use of human tissues was in accordance with the Declaration of Helsinki. Total RNA was isolated from these samples using RNAqueousABCB1 and ABCG2 genes, custom-made primers and probes described in Korjamo et al. [T). Normalization was performed using the geometrical means of TAF1C (Hs00375863_m1) and ABCB11 (Hs00184824_m1) CTs as normalizing values. Commonly used normalization genes, ACTB and GAPDH, have somewhat different expression levels in the iHCE and tHCE and thus these genes were considered as unsuitable for normalization. TAF1C and ABCB11 genes had similar expression levels in iHCE and tHCE based on both microarray and real-time RT–PCR experiments. Therefore, these genes were chosen for normalization. Statistical significance was calculated using unpaired t-test.Quantitative real-time RT–PCR was used to validate the microarray results using a combination of over- and under-expressed genes. Genomic DNA contamination was eliminated by treating the samples with DNase I (Ambion). RNA (2 µg) was transcribed into cDNA using M-MuLV reverse transcriptase and random primers (Fermentas). The PCR reaction was conducted in an ABI Prism 7000 instrument using TaqMan® Gene Expression Master Mix complemented with an amount of cDNA derived from 40 ng RNA and Taqman® Gene Expression Assays demonstrated that the microarray data were of good quality and that the data from iHCE and tHCE formed two separate groups. Overall, the microarray results correlated well with the results of RT–PCR analysis in their direction emerged from this analysis as the central gene, with possible binding sites on the promoters of several other genes in the tHCE , and keratin 12 (KRT12) [ALDH) [KRT4, KRT5, KRT14, and KRT15 [KRT7 and KRT18) [The changes in keratin expression profiles provide a robust, patent example of the large gene perturbation in terminal differentiation associated with the SV40 large T antigen effects . Each st (KRT12) . Respect) [ALDH) . The strnd KRT15 also undd KRT18) became oPAX6 gene acts as the central master gene of eye morphogenesis. It is expressed in the corneal epithelium through development and adulthood. Its dosage is a critical determinant of migration, differentiation, and limbal stem cell function, where it determines critical behavior of the limbal-corneal stem cells [PAX6 expression in iHCE cells. Interestingly, our analysis reveals that BRN5 might act as a co-regulator of PAX6 in the corneal epithelium.Mechanisms of gene regulation can be inferred from large gene expression studies by assuming that co-expressed or co-regulated genes might also be under the control of the same transcription factors . The PAXem cells -45. HencOne of the main drivers for the development of iHCE lines was the need to establish in vitro models for corneal drug permeation studies . The corABC and SLC transporters are found in the lists of overexpressed and under-expressed genes. Expression and functionality of transporter proteins should be further investigated and scaled to tissue properties before a stratified cell system based on the iHCE approach can be reliably applied to studies of active drug transport and metabolism.Our recent literature analysis revealedAppendix 4). Finally, using the same microarray data analyzed in this report, Wang et al. [The iHCE divergency in gene expression, though, may not occur or be so marked for features not associated with differentiation. Polarization and tightness of cell layers is a landmark of epithelial cell differentiation. The iHCE cell forms a tight permeation barrier with tight junctions and desmosomes shown at electron microscope level . In thisg et al. recentlyIn conclusion, we demonstrated the differences in the global gene expression between the human corneal epithelium and stratified filter cultured cell culture system. Despite the correct morphology and barrier formation, there are still significant deviations of expression from the normal corneal epithelium. The SV40 transformed corneal epithelial cells could provide a useful model for certain areas of biologic study. However, the validity of the studies using these cells should be reconfirmed by parallel studies using native tissue or primary cells. |
The Japanese herbal medicine Sho-saiko-to (TJ-9) has been administeredto 1.5 million Japanese patients with chronic liver diseases. TJ-9 is known to significantlysuppress cancer development in the liver and has macrobiotic effects. In the present study, weexamined the p <0.01, p < 0.05). However, when TJ-9 was added to the cultures, the IL-12 production levels inboth cell fractions increased approximately three fold, and the levels from the monocyte/macrophagefraction were almost the same as those from healthy subjects. This effect of TJ-9 wasattributable to two of its seven herb components, that is, scutellaria root and glycyrrhiza root.One possible mechanism for the macrobiotic effects of TJ-9 on liver cirrhosis patients may bethe improvement in IL-12 production.The monocyte/macrophage fraction and the lymphocyte fraction of peripheral blood wereobtained from 11 HCV-positive liver cirrhosis patients and 12 healthy subjects. Interleukin-12levels in the supernatants were measured using ELISA kits. The levels of IL-12 produced bythe patients fractions were significantly lower than those produced by healthy subjects ( |
Pten (phosphatase and tensin homolog deleted on chromosome ten), the gene encoding PI3K negative regulator PTEN, results in premature activation of the entire pool of primordial follicles, indicating that activation of the PI3K pathway in oocytes is important for control of follicular activation. To investigate whether PI3K signaling in oocytes of primary and further developed follicles also plays a role at later stages in follicular development and ovulation, we conditionally deleted the Pten gene from oocytes of primary and further developed follicles by using transgenic mice expressing zona pellucida 3 (Zp3) promoter-mediated Cre recombinase. Our results show that Pten was efficiently deleted from oocytes of primary and further developed follicles, as indicated by the elevated phosphorylation of the major PI3K downstream component Akt. However, follicular development was not altered and oocyte maturation was also normal, which led to normal fertility with unaltered litter size in the mutant mice. Our data indicate that properly controlled PTEN/PI3K-Akt signaling in oocytes is essential for control of the development of primordial follicles whereas overactivation of PI3K signaling in oocytes does not appear to affect the development of growing follicles. This suggests that there is a stage-specific function of PTEN/PI3K signaling in mouse oocytes that controls follicular activation.Immature ovarian primordial follicles are essential for maintenance of the reproductive lifespan of female mammals. Recently, it was found that overactivation of the phosphatidylinositol 3-kinase (PI3K) signaling in oocytes of primordial follicles by an oocyte-specific deletion of In women, the 300,000–400,000 ovarian primordial follicles at menarche serve as the source of fertilizable ova for the entire duration of reproductive life Recently, studies from our research group have suggested that the phosphatidylinositol 3-kinase (PI3K) signaling pathway in oocytes plays an important role in oocyte growth during early follicular development Pten gene from mouse oocytes of primordial follicles using transgenic mice expressing Cre recombinase mediated by the growth differentiation factor 9 (Gdf-9) promoter, results in excessive activation of the entire pool of primordial follicles, which in turn leads to premature depletion of all primordial follicles We have shown that deletion of the Pten gene from oocytes of primary follicles using transgenic mice carrying zona pellucida 3 (Zp3) promoter-mediated Cre recombinase Pten in oocytes of primary follicles showed unaltered follicular development, ovulation, oocyte maturation, and fertility. Our data indicate that PTEN is probably essential for regulation of follicular activation in a stage-specific fashion.The current study was designed to investigate the role of PTEN/PI3K–Akt signaling in oocytes of primary and further developed follicles in greater detail. We used a Cre-loxP system to delete the Pten gene from oocytes of primary follicles, we crossed loxP/loxPPten mice Zp3 promoter-mediated Cre recombinase (Zp3-Cre mice) Zp3 promoter drives the expression of Cre recombinase in oocytes from the primary follicle stage -treated ovaries, followed by western blot analysis. The expression of PTEN protein was found to be completely abolished in loxP/loxPPten; Zp3-Cre+ oocytes in one allele of their genomic DNA. These results indicate that the Pten gene was successfully deleted from growing oocytes of loxP/loxPPten; Zp3-Cre+ mice.We also confirmed the deletion of loxP/loxPPten; Zp3-Cre+ oocytes. As shown in loxP/loxPPten; Zp3-Cre+ oocytes as compared to control oocytes. The phosphorylation of another important site on Akt, Thr308, which is required for complete activation of Akt, was also elevated upon deletion of Pten in growing loxP/loxPPten; Zp3-Cre+ oocytes. As an indicator of Akt activity, the phosphorylation of Tsc2 (at Thr1462), which is an Akt substrate, was found to be elevated in loxP/loxPPten; Zp3-Cre+ oocytes compared to control loxP/loxPPten oocytes. These results suggest that there is enhanced activation of PI3K–Akt signaling in oocytes of growing follicles upon deletion of Pten in loxP/loxPPten; Zp3-Cre+ mice.We tested whether the PI3K–Akt signaling pathway is enhanced in Pten from oocytes of primordial follicles leads to activation of the entire pool of primordial follicles, which eventually results in follicle depletion and premature ovarian failure (POF) in young adulthood Pten in oocytes of primary follicles, we first examined ovarian morphology of loxP/loxPPten; Zp3-Cre+ at postnatal day 13 (PD13), PD23, and at 16 weeks of age in comparison to control loxP/loxPPten ovaries. We found that loxP/loxPPten; Zp3-Cre+ ovaries at PD13 appeared normal in morphology as compared to control loxP/loxPPten ovaries, with primordial, primary, secondary, and some early antral follicles , prematurely activated primordial follicles (transient follicles with enlarged oocytes surrounded by flattened pre-granulosa cells) were observed , which w ovaries . Specifi ovaries , arrows loxP/loxPPten; Zp3-Cre+ oocytes. Surprisingly, we found that the rate of GVBD in Pten-deficient oocytes was unaltered as compared to the control oocytes mice show similar phenotypes of premature activation of the entire primordial follicle pool loxP/loxPPten; GCre+ mice Foxo3a, which is a transcription factor and also an Akt substrate, has been shown to suppress follicular activation loxP/loxPPten; Zp3-Cre+ mice undergo normal maturation, ovulation, and fertilization, and the mutant mice were completely fertile with normal litter sizes, indicating that the loss of Pten in oocytes does not apparently affect the fertility of the mice.It has been suggested that PI3K–Akt signaling plays an important role in the meiotic maturation of oocytes loxP/loxPPten; GCre+ mice and loxP/loxPPten; Zp3-Cre+ mice that carry Pten deficiency in oocytes of primordial and primary follicles, respectively, indicate that PTEN/PI3K–Akt signaling in oocytes is critically important for maintenance of the primordial follicle pool. On the other hand, further detailed and preferably in vivo studies are needed to elucidate the roles of PTEN and PI3K signaling in oocytes during oocyte maturation.Results from our current work with the two mutant mouse models, the loxP/loxPPten mice Zp3-Cre transgenic mice where the Cre recombinase is specifically expressed in oocytes of primary and further developed follicles were obtained by crossing loxP/loxPPten mice with transgenic mice carrying Gdf-9 promoter-mediated Cre recombinase, which is specifically expressed in oocytes of primordial and further developed follicles , tuberin/Tsc2, rabbit monoclonal antibody to phospho-tuberin/Tsc2 (Thr1462), and mouse monoclonal antibody to PTEN were obtained from Cell Signaling Technologies . Mouse monoclonal antibody to phospho-Akt (Thr308) was purchased from BD Bioscience . PMSG and mouse monoclonal antibody to β-actin were purchased from Sigma-Aldrich Sweden AB . Western blots were carried out according to the instructions of the suppliers of the different antibodies and were visualized using the ECL Plus Western Blotting Detection System .Ovaries were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. The paraffin-embedded ovaries were sectioned at 8-µm thickness and stained with hematoxylin for morphological observation. Ovarian follicles at different developmental stages were categorized based on the well-accepted standards established by Pedersen and Peters 2 for 6 h to determine the rate of GVBD.To stimulate follicular development, immature 23-day-old female mice were injected intraperitoneally with 5 IU of PMSG. The ovaries were collected 48 h later and were dissected free of fat and connective tissue. Oocytes were collected by puncturing the ovaries with a sharp needle in M2 medium (Sigma), selected using a mouth pipette, and then cultured further in M16 medium (Sigma) at 37°C in an atmosphere of 5% COFor western blot, oocytes were lysed immediately after being selected with a mouth pipette, in a buffer containing 50 mM Tris-HCl (pH 8.0), 120 mM NaCl, 20 mM NaF, 20 mM β-glycerophosphate, 1 mM EDTA, 6 mM EGTA (pH 8.0), 1% NP-40, 1 mM DTT, 5 mM benzamidine, 1 mM PMSF, 250 µM sodium vandadate, 2 µg/ml aprotinin, 10 µg/ml leupeptin, and 1 µg/ml pepstatin, for 20 min on ice with frequent vortexing. The oocyte extracts were then used for western blot.Adult female mice were housed with wild-type males, and vaginal plugs were checked every morning. Embryonic day 0.5 (E0.5) refers to the day when a vaginal plug was found. The mated females were sacrificed at E1.5, and 2-cell embryos were recovered from their oviducts and cultured further in KSOM medium . The numbers and stages of development of the embryos were recorded.P<0.05.All experiments were repeated at least 3 times. For comparisons of oocyte numbers, differences between the two groups were calculated with Student's t-test, and a difference was considered significant if |
The two inversion-related CdII ions are separated by 3.9920 (6) Å and are bridged by two O atoms from two nitrite ligands. There are two types of π–π stacking interactions involving symmetry-related pyrazole rings, with centroid–centroid distances of 3.445 (2) and 3.431 (2) Å.In the title centrosymmetric binuclear complex, [Cd DOI: 10.1107/S1600536809039841/lh2917Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
In the crystal structure, the molecules display a two-dimensional framework formed by weak intermolecular C—H⋯O hydrogen bonds.In the axially chiral title compound, C Å b = 10.4423 (13) Å c = 10.4429 (13) Å α = 82.5650 (10)°β = 62.2850 (10)°γ = 60.5200 (10)°V = 864.73 (19) Å3 Z = 2 Kα radiationMo −1 μ = 0.15 mmT = 291 (2) K 0.41 × 0.34 × 0.29 mm Bruker APEXII CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.940, T max = 0.958Absorption correction: multi-scan (6598 measured reflections3194 independent reflectionsI > 2σ(I)2686 reflections with R int = 0.013 R[F 2 > 2σ(F 2)] = 0.041 wR(F 2) = 0.117 S = 1.02 3194 reflections282 parametersH-atom parameters constrainedmax = 0.25 e Å−3 Δρmin = −0.21 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536808011926/si2086sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536808011926/si2086Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
The amine-carboxyboranes anti-inflammatory agents were shown to blockTNF α release at 90 min. and IL-1 release at 5 hr. from macrophages.The agenst competed with L929 fibroblasts high affinity receptors forendogenous cytokines which regulate the inflammation process. Blockingthe TNFα receptor at 90 min. by the agents from 10 to 50 μΜ, resulted inlysosomal hydrolytic enzyme inhibition and lowering of prostaglandinsynthesis as well as reductions in calcitonin high affinity receptorbinding and calcium influx into the cells. IL-1 receptors when blockedby the agents at 5 hr. resulted in a reduction of NAG activity andleukotriene synthesis. An elevation of proline incorporation intocollagen occurred at 90 min. and 24 hr. in the presence of the agents. |
Lichtheimia corymbifera (previously Absidia corymbifera) is a filamentous zygomycetes belonging to the order Mucorales and to the family Lichtheimiaceae. Members of genus Lichtheimia spp. are cosmopolitan and ubiquitous in nature. Lichtheimia corymbifera is a recognized agent of diseases in man and animals. In cattle it causes abortion and mastitis. Three cases of bovine abortion occurred in a herd located in the Po Valley. Serological examinations were performed on fetal and mother's blood. One of the aborted fetus was referred to our laboratory. The paper describes the isolation and characterization of Lichtheimia corymbifera from a bovine aborted fetus.Serological examinations were performed on fetal and mother's blood. Lesions on fetal tissues and placenta leaded the diagnostic suspect towards a mycotic aetiology. Tissues were then put in culture, and at the same time an histological examination was performed, together with bacteriological and virological tests. The isolate from placenta and fetal tissues was identified and characterized by PCR and RFLP, using the ITS region as a target sequence and AclI restriction site within the amplicon to distinguish Lichtheimia corymbifera among the other fungi.Serological, bacteriological and virological tests gave aspecific results. Histological examination evidenced numerous PAS positive hyphae within the necrotic cotiledons and numerous fungal nonseptate hyphae to the GMS stain. Colonies with typical morphological features of fungi grew up on Sabouraud agar from fetal skin and placenta. On the developed colonies the microscopic examination has shown a large number of nonseptate hyphae and sporangia consistent with Mucorales. PCR and RFLP allowed the identification of the isolate as Lichtheimia corymbifera.The present report describes the isolation and the molecular characterisation of a fungal isolate from bovine aborted fetus and placenta. The diagnostic protocol allowed to identify and characterise the strain. This is the first isolation in Italy of Lichtheimia corymbifera in a bovine aborted fetus. Among t60th day .th - 8th months of gestation and is often followed by placenta retention. The placenta is thickened and wooden in appearance [In the northern hemisphere the incidence of mycotic abortion is sporadic, occurring mainly during the winter periods (November - April), when the cows are usually fed with a large amount of hay . This phpearance , and haepearance ,7. On thpearance ,8,9.Aspergillus fumigatus and Aspergillus nidulans, Absidia corymbifera, Mortierella wolfii, Rhizopus spp., Mucor spp., and Rhizomucor spp. [Aspergillus fumigatus. Zygomycetes accounted for about 20% of cases, and the remaining 20% were caused by a wide range of opportunistic filamentous fungi and yeasts [Aspergillus spp. and Mortierella wolfii have been isolated [Mortierella wolfii has been considered the major mycotic cause of abortion [Aspergillus, Mortierella and Absidia spp. since 1967 [Aspergillus spp. are reported [Different fungi have been isolated from aborted fetuses, belonging to the species cor spp. ,10. Prevd yeasts . In Austisolated , and in abortion . In Euronce 1967 and morence 1967 . In Italreported .th and the 6th month of gestation, without apparent symptoms. Signs of illness were not observed in the dams before and after abortions. Of the three aborted fetuses, only one showed skin lesions. It was aborted at the 23rd week of pregnancy and referred to our laboratory for diagnostic investigations. Aim of the work is to describe the isolation and characterisation of a strain of Lichtheimia corymbifera isolated from the referred fetus, to provide a complete diagnostic protocol in case of bovine mycotic abortion.In February 2009 three cases of abortion occurred during a single week in a Friesian dairy herd located in the province of Parma , area of production of Parmigiano Reggiano cheese. The herd size was 120 animals (60 lactating), free-stall housing, not vaccinated for infectious abortive agents. The abortions occurred between the 5The aborted fetus and placenta were chilled and referred to our laboratory within 12 hours from the abortion, together with the blood samples from the aborted cows.Histological examinations were performed on fetal tissue samples including skin, heart, lung, liver, spleen, kidney, fetal stomach and placenta collected during the necropsy and fixed in 4% buffered formalin (Bio-Optica). The samples were routinely processed and stained with hematoxylin and eosin (HE) for histopathological evaluation. To investigate the presence of fungi, periodic acid Schiff reaction (PAS) and Grocott's Methenamine Silver stain (GMS) were also performed on tissue sections.Brucella spp. on 5% blood agar and incubated in microaerophilic (5% CO2) environment.Bacteriological examination was performed on fetal spleen, liver, kidney, lung, heart, skin, stomach content and placenta on blood agar (5% bovine erythrocytes) and Mc Conkey agar (DIFCO) and incubated for 24-48 hours at 37°C in air. The fetal stomach content was specifically cultured for the isolation of Mycological culture was performed on fetal spleen, liver, kidney, lung, heart and placenta on Sabouraud agar (DIFCO), and incubated for 24-48 hours at 37°C in air.Melezitose assimilation was performed using ID32C strip as reported by Schwarz and coll. .Brucella abortus by card test agglutination , Neospora caninum by indirect immunofluorescence, Chlamydophila abortus by ELISA , Bovine Viral Diarrea (BVD) virus by seroneutralization, Coxiella burnetii by ELISA , and Leptospira serovar sejroe-hardjo, australis-bratislava, pomona-pomona, icterohaemorrhagiae-copenhageni by microagglutination test. ELISAs were performed following manufacturer instructions. Seroneutralization, indirect immunofluorescence and microagglutination test were performed following our in-house protocols.Serological examinations for the main infectious abortive agents were performed on blood sera from aborted cows. Moreover, during the necropsy of the fetus, 1 ml of blood from the atrial chambers of the heart was taken. The serological examination of the blood samples to investigate the presence of antibodies against abortive agents was performed for Virological examination was performed on fetal spleen and lung tissues by direct ELISA following manufacturer instructions to assess the presence of BVD virus.Rhizopus spp., Rhizomucor spp., Mucor spp., and Lichtheimia corymbifera were used with a degenerate antisense primer . The region selected for the design of primers excluded the amplification of human DNA and other filamentous fungi. Primers Lap (5' GAAACTGCGAATGGCTCATTA 3') and Rap (5' CAATCCAAGAATTTCACCTCT 3') designed to amplify all the fungi and the human DNA were used as positive controls.Molecular identification and characterization was performed on isolated fungal mycelia. Genomic DNA extraction, PCR and RFLP were performed as described by Machouart and coll. . SpecifiThe amplicon was also sub-cloned into the 2886 bp pTZ57R/T vector and subjected to RFLP analysis with AclI restriction enzyme.Cotyledons appeared thickened, firm and necrotic, whereas intercotyledonary chorioallantois showed brown exudate and moderate hyperemia Fig. . MultifoZygomycetes were present in the grossly evident placentar lesions corymbifera. In contrast none amplification products were obtained when primers for Rhizopus spp., Rhizomucor spp. and Mucor spp. were applied (Fig. Lichtheimia corymbifera (Fig. An expected specific amplicon of 824 bp was obtained only with the set of primers specifying for ied Fig. . The 824ied Fig. and the ied Fig. were anaera Fig. . SequencLichtheimia corymbifera [E. coli from fetal tissues, associated to the absence of gross lesions in the fetal organs, and the BVDV seropositivity at low titre of the dam have to be considered not meaningful to demonstrate the involvement of these pathogens in the abortive event [In the area where the abortions occurred, the nutrition of dairy cattle is regulated by strict rules and the administration of silage is forbidden. Consequently, dairy cows are fed with a major amount of hay. In our case, heifers were usually fed with grass and hay, while during the pregnancy the ration was supplemented with hay stored the year before in a moist place, exposed to bad weather conditions. The risk factors associated to the administration of mouldy hay were present. Moreover, the macroscopic lesions on the fetus and placenta were consistent with mycotic abortion, confirmed by cultural and histological findings . The morymbifera ,18. The ve event . In addiLichtheimia corymbifera is the causative agent of the abortion. The present case is particularly relevant because represents the first isolation in Italy of Lichtheimia corymbifera in a bovine aborted fetus. It is useful to stress that in case of abortion the routine diagnostic procedures should include the mycotic component and assess the fungal species [Our findings support the conclusion that species . In acco species ,19, confThe authors declare that they have no competing interests.CSC conceived, designed and wrote the paper. CP and FG performed the bacteriological, mycological and serological tests. SJ performed the histological tests. GD was responsible for the molecular identification and characterisation, and intellectually contributed and helped to write the paper. ST performed the serological tests and intellectually contributed and helped to write the paper. SC reviewed the paper. All authors read and approved the final manuscript. |
Non-invasive ventilation (NIV) may be useful after extubation in children. Our objective was to determine postextubation NIV characteristics and to identify risk factors of postextubation NIV failure.A prospective observational study was conducted in an 8-bed pediatric intensive care unit (PICU). Following PICU protocol, NIV was applied to patients who had been mechanically ventilated for over 12 hours considered at high-risk of extubation failure -elective NIV (eNIV), immediately after extubation- or those who developed respiratory failure within 48 hours after extubation -rescue NIV (rNIV)-. Patients were categorized in subgroups according to their main underlying conditions. NIV was deemed successful when reintubation was avoided. Logistic regression analysis was performed in order to identify predictors of NIV failure.2 at 1 hour and PO2/FiO2 ratio at 6 hours. Neurologic condition was found to be associated with NIV failure. Multiple logistic regression analysis identified no variable as independent NIV outcome predictor.There were 41 episodes (rNIV in 20 episodes). Success rate was 50% in rNIV and 81% in eNIV (p = 0.037). We found significant differences in univariate analysis between success and failure groups in respiratory rate (RR) decrease at 6 hours, FiOOur data suggest that postextubation NIV seems to be useful in avoiding reintubation in high-risk children when applied immediately after extubation. NIV was more likely to fail when ARF has already developed (rNIV), when RR at 6 hours did not decrease and if oxygen requirements increased. Neurologic patients seem to be at higher risk of reintubation despite NIV use. Conventional mechanical ventilation (CMV) is a core feature of intensive care. Weaning and removement of endotracheal tube are crucial processes, which often account for a considerable part of CMV total time. Unsuccessful extubation has been noted to be associated with an increase of both morbidity and mortality in adult and paediatric patients -4. The dNon invasive ventilation (NIV) has been proposed as a useful therapy to wean patients after unsuccessful weaning trials and to avoid reintubation in adults -10, thouThe objective of the present study was to determine postextubation NIV characteristics and to identify risk factors of postextubation NIV failure in children.2 of less than or equal to 0.4 to maintain transcutaneous oxygen saturation >94% , positive end-expiratory pressure (PEEP) under 8 cm H2O and a pressure support of under 12 cm H2O. An exception was made to this protocol: PEEP could be ≥ 8 cmH2O in children in whom an early extubation was considered beneficial due to high risk of associated-ventilator pneumonia (e.g. immunodeficiency). Sedation was progressively lowered according to our sedation protocol in order to avoid withdrawal syndrome.A prospective observational study was conducted in our 8-bed paediatric intensive care unit (PICU) from July 2004 to December 2008 following NIV PICU protocol. To be enrolled, patients had to have undergone CMV for over 12 hours, to have adequate consciousness level , to require no inotropics (or a maximum of 5 mcg/kg/minute of dopamine) and to fulfill NIV inclusion criteria, listed below. Extubation was performed following our internal PICU protocol for weaning: FiOTypes of postextubation NIV were elective NIV (eNIV) when the patient was extubated directly to NIV, or rescue NIV (rNIV) when the child developed ARF within 48 hours after extubation.2O.• eNIV: children deemed at high-risk of extubation failure or patients extubated from a PEEP ≥ 8 cmH2: FiO2) ratio under 250 and above 150 or a transcutaneous oxygen saturation <90% despite FiO2 of 50%, or venous PCO2 > 55 mmHg or arterial PCO2 > 50 mmHg.• rNIV: ARF within 48 hours after extubation which did not respond to aggressive medical treatment and: a respiratory rate above 2 standard deviations (SD) for child's age normal range, or a partial pressure of arterial oxygen to the fraction of inspired oxygen was used in all cases. Ventilators employed were BiPAP Vision for pressure support NIV and CF 800 for CPAP.2O higher than previous PEEP during CMV. In rNIV, CPAP or EPAP initial ventilator setting was 4-5 cmH2O. In both types of postextubation NIV, inspiratory positive airway pressure (IPAP) was started at 6-8 cmH2O. IPAP was increased if the attending physician considered that inspiratory volume was low according to auscultation and thoracic motion, and if hypercarbia increased or did not decrease. CPAP or EPAP were increased if no improvement of pulse-oximetry O2 saturation or arterial PO2 was achieved. If clinical situation did not improve with CPAP and a good-fitting mask was available, the child could be switched to pressure support NIV according to the attending physician's decision.In eNIV, continuous positive airway pressure (CPAP) or expiratory positive airway pressure (EPAP) was set at 1-2 cmH2 before NIV was started. The same data and CPAP, EPAP and IPAP were collected at 1, 6, 12, 24 and 48 hours.Patients with multiple NIV episodes were considered individually, since each episode requiring NIV presents new variables potentially affecting outcome. For each episode, the following variables were collected: age, gender, weight, PICU stay, primary cause of intubation, underlying disease, type of postextubation NIV, paediatric risk of mortality (PRISM) score within 24 hours of admission, type of interface, NIV duration, NIV outcome, mortality and causes of death. Clinical data collected were respiratory rate (RR), heart rate (HR) and FiONIV was considered successful when reintubation was avoided.2). A logistic regression analysis was performed in order to identify possible predictors of NIV failure. Kaplan-Meier estimate-of-survival curve was used to determine the cumulative risk of avoiding reintubation. Multiple logistic regression analysis was performed before NIV start and after 1, 6 and 12 hours. Variables included in the multivariate analysis were those which had a p value under 0.2 between success and failure groups and also those variables which were considered clinically important in order to control statistical confusion. Variables included in the model were age, weight, gender, HR difference to initial HR, RR difference to initial RR, FiO2, neurologic condition, type of postextubation NIV. At the first hour, IPAP was also included. Before NIV was started, RR and HR were also included, instead of HR or RR difference. PO2/FiO2 ratio, PCO2 and pH were excluded from multivariate analysis due to the lack of data. A p value < 0.05 was considered statistically significant.Mean, median, standard deviation and range were used to describe the sample. Quantitative continuous variables were compared between groups using Mann Whitney's non parametric tests if the variable had a non-normal distribution or unpaired Student's t test if the variable had a normal distribution. Qualitative variables were compared by Chi-square test . Another episode was also excluded because inclusion criteria were not fulfilled. Among those resulting 41 episodes (36 patients), 20 of them belonged to rNIV group. CPAP was only used in two cases (one failed after switching to pressure support NIV). Baseline characteristics are shown in Table 2O and eNIV was applied. None of these 3 cases failed NIV trial.NIV was successful in 65.9% of cases. Baseline characteristics of success and failure groups are shown in Table Causes of NIV failure were upper airway obstruction in 5 cases, apnoeas in 3 children, hypercapnia in 2, and hemodynamic instability, hypoxemia, inability to manage secretions and massive atelectasis in 1 episode each. Median period between NIV beginning and reintubation was 4.5 hours (range 0.2 - 19 hours). Mean stay was 19.0 ± 17.7 days in success group vs. 45.3 ± 39.3 days in failure group (p = 0.001). Facial mask was used in 30 cases (13 in rNIV), nasal mask in 5 (3 in rNIV), full-face mask in 2 (1 in rNIV) and helmet in 2 (both in rNIV). Median NIV duration was 12 hours (range 0.2 - 149 hours). Two deaths occurred during the study, both children belonging to failure group. None of these deaths was related to NIV use or to NIV failure.2 at 1 hour was found to have an area under the curve (AUC) of 0.836 to detect NIV failure. A FiO2 of 50% at 1 hour could predict NIV failure with a sensitivity of 76.9% and specifity of 81.5%. RR decrease at 6 hours had an AUC of 0.764 to predict NIV success. A decrease of RR at 6 hours equal to or higher than 4 bpm could predict NIV success with a sensitivity of 92.3% and specifity of 57.1%.Table Multiple logistic regression analysis revealed that no variable included in the model was an independent predictive factor of postextubation NIV success or failure.Data about postextubation NIV use in children are scarce. We conducted the present study following an observational design, as patients' management was based on our standard clinical practice criteria. To our knowledge, this is the first study to identify predictive factors of postextubation NIV outcome in a multidisciplinary PICU. Previous pediatric studies about NIV use after extubation focus on post-cardiac surgery patients ,24.Postextubation NIV can be used in three ways: (1) as an adjunct to weaning patients from CMV by early extubation directly to NIV, (2) as a preventive application of NIV to higher-risk patients who were extubated at the time they fulfilled standard extubation criteria, or (3) as a curative or rescue application of NIV to patients who develop ARF after having been extubated according to standard criteria. The first two indications represent children included in our study as eNIV cases. The third indication corresponds to rNIV group.Rate of success (65.9%) was lower than rates reported in other NIV pediatric studies which do not include postextubation cases ,17. A veWe found that children developing ARF after extubation non-respondent to conventional medical therapy (rNIV) were more likely to fail NIV support than those extubated directly to NIV (eNIV). This goes in accordance with previous studies in adult patients. Keenan and Esteban found no outcome improvement in patients treated with NIV who developed ARF in the following 48 h after extubation when compared with standard medical therapy . TrevisaPatients with underlying neurologic conditions were found to be at higher risk for reintubation. Kurachek et al. reported the same patient feature associated with extubation failure . Similar2/FiO2 was significantly higher in success group in the first hour, which goes in accordance with other works in hypoxemic patients [Evolution of RR in the first hours was described as an outcome predictor in several paediatric studies ,15. The patients .Some limitations of this study must be outlined. First, the power of the study is limited due to the sample size, which obligates us to take our results with caution. Second, it is not a randomized trial, which would be definitive to draw conclusions. Taking into account that postextubation NIV seems to be beneficial , performThis study has several strengths. First, it is the first study focusing on paediatric postextubation NIV outcome predictors. Second, the current prospective study is based on daily clinical practice, which may allow the findings to be useful for clinical management of these children. Furthermore, despite the observational design, inclusion and reintubation criteria were well defined following our internal protocol.In conclusion, our data suggest that postextubation NIV seems to be useful in avoiding reintubation in high-risk children when applied immediately after extubation. NIV was more likely to fail when ARF has already developed (rNIV), when RR at 6 hours did not decrease and if oxygen requirements increased. Neurologic patients seem to be at higher risk of reintubation despite NIV use.ARF: acute respiratory failure; AUC: area under the curve; CMV: conventional mechanical ventilation; CPAP: continuous positive airway pressure; EPAP: expiratory positive airway pressure; HR: heart rate; IPAP: inspiratory positive airway pressure; NIV: non invasive ventilation; PEEP: positive end-expiratory pressure; PICU: paediatric intensive care unit; PRISM: paediatric risk of mortality; RR: respiratory rate.The authors declare that they have no competing interests.JM-C: Data collection. Analysis and interpretation of data. Drafting of manuscript. AM: Conception and study design. Literature revision. CR: Analysis and interpretation of data. Drafting and critical revising of the manuscript. AC: Data collection and drafting of the manuscript. SM, MLA and IG: Data collection. Critical revising of the manuscript. All authors read and approved final manuscript version.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2431/10/29/prepub |
Prospective cohorts represent an essential design for epidemiological studies and allow for the study of the combined effects of lifestyle, environment, genetic predisposition, and other risk factors on a large variety of disease endpoints. The CONSTANCES cohort is intended to provide public health information and to serve as an "open epidemiologic laboratory" accessible to the epidemiologic research community. Although designed as a "general-purpose" cohort with very broad coverage, it will particularly focus on occupational and social determinants of health, and on aging.The CONSTANCES cohort is designed as a randomly selected representative sample of French adults aged 18-69 years at inception; 200,000 subjects will be included over a five-year period. At inclusion, the selected subjects will be invited to fill a questionnaire and to attend a Health Screening Center (HSC) for a comprehensive health examination: weight, height, blood pressure, electrocardiogram, vision, auditory, spirometry, and biological parameters; for those aged 45 years and older, a specific work-up of functional, physical, and cognitive capacities will be performed. A biobank will be set up. The follow-up includes a yearly self-administered questionnaire, and a periodic visit to an HSC. Social and work-related events and health data will be collected from the French national retirement, health and death databases. The data that will be collected include social and demographic characteristics, socioeconomic status, life events, behaviors, and occupational factors. The health data will cover a wide spectrum: self-reported health scales, reported prevalent and incident diseases, long-term chronic diseases and hospitalizations, sick-leaves, handicaps, limitations, disabilities and injuries, healthcare utilization and services provided, and causes of death.To take into account non-participation at inclusion and attrition throughout the longitudinal follow-up, a cohort of non-participants will be set up and followed through the same national databases as participants.A field-pilot was performed in 2010 in seven HSCs, which included about 3,500 subjects; it showed a satisfactory structure of the sample and a good validity of the collected data.The constitution of the full eligible sample is planned during the last trimester of 2010, and the cohort will be launched at the beginning of 2011. Large-scale, prospective observational cohort studies that include several hundreds of thousands of individuals and that incorporate personal, social, lifestyle, occupational and environmental data as well as biobanks of blood and other biological specimens have become essential resources for studies on the causes of and major risk factors for many diseases. Since the Framingham Study followed-up from 1948 on , the OneCaisse nationale d'assurance maladie des travailleurs salaries (CNAMTS) [The objective of the CONSTANCES ("Cohorte des consultants des Centres d'examens de santé") project is to set up a large population-based cohort to contribute to the development of epidemiologic research and to provide useful public health information. It is conducted in partnership with the National Health Insurance Fund administered by the (CNAMTS) , the pri(CNAMTS) -10.CONSTANCES was also designed as a tool to support the public health objectives of the national government. Indeed, numerous data sources in France provide public health officials with some of the information they need. Nonetheless, these all have limitations. One often-highlighted gap is the lack of large longitudinal studies covering a broad range of health outcomes, taking into account the changes over time of people and the socioeconomic environment ,12. CONSAlthough designed as a general-purpose cohort intended to host numerous nested projects with a very broad scope, the major orientation of CONSTANCES is the study of occupational and social determinants of health. These themes are essential areas of research in public health and epidemiology today, involving numerous health problems and diverse populations.Health risk factors with origins in occupational exposures are numerous: chemical hazards, noise, temperature, vibrations, radiation, biological agents, physical and postural constraints, mental load and stress, hours, and work pace. These exposures affect a high percentage of the population. Psychosocial factors linked to the organization of work and to an imbalance between the individual's efforts and rewards are also sources of potentially pathogenic stress ,14. NumeIn France, the system of universal access to health care corresponds to an ideal of equality with regards to disease and death. Nonetheless, while health status improves generally in the population, social inequalities in health persist, and some have even worsened . MoreoveEpidemiologic data remain sparse on the topic of changes in health with age and more particularly about aging and its relation to health, work, and the life course. Studies are essentially limited to the age groups above 65 years and provide little information about earlier life periods , even thThe source population is that of the people in France whose health insurance is administered by the CNAMTS. Health insurance is compulsory in France, and all salaried workers and their family are affiliated to this fund, which covers more than 80% of the French population (approximately 50 million people).As one of the main study objectives is to provide information on the health status and disease burden of this large part of the French adult population, the CONSTANCES cohort will be a representative sample of the general French population insured by CNAMTS in terms of age (18 to 69 years at inception), sex, and social category.To be able to answer the many questions raised in varied domains, CONSTANCES must be a large sample. In order to assess the potential of CONSTANCES in terms of its capacity to conduct epidemiologic studies likely to have good statistical power, we estimated the number of major health outcomes expected in the CONSTANCES cohort over a moderately long term in a cohort with an age and sex structure identical to that of the French general population aged 18 to 69 years at the 1999 census. Table Because the advantages of longitudinal follow-up increase with its duration and in view of the broad objectives for this cohort, the duration of follow-up should be as long as possible; CONSTANCES planned duration is therefore indefinite. A major concern of long-term prospective cohorts is attrition, potentially inducing biases and affecting the power of the study . It is nOne of the major sources of bias in epidemiologic surveys comes from selection effects, which can bias estimates of disease prevalence or incidence and of associations between exposures and diseases of interest. In longitudinal cohorts, selection effects may occur at inclusion and throughout follow-up because of cohort attrition . The proIn a cohort whose inclusion procedures are the same for all subjects (the case of CONSTANCES), in principle the exposure-disease relation does not differ between subjects who are included and those who are not -26. TherFor descriptive studies of the frequency of health problems and exposures, the parameters of interest must be estimated in a representative sample of the target population. In this regard, the potential concerns for CONSTANCES are mainly incomplete geographical coverage of the districts of recruitment and factors associated with voluntary participation.As detailed below, the cohort participants will be included in 17 Health Screening Centers (HSCs) located in 16 different districts in different regions of France .Using volunteer subjects inevitably produces selection effects, even in studies that use random drawing from an appropriate sampling base, as it is the case of CONSTANCES (see below). At inclusion, individuals may refuse participation (become non-participants), a potential source of bias. To compensate, researchers usually attempt to collect a minimum data set for the non-participants , to facilitate subsequent adjustments for estimating the relevant parameters. This approach nonetheless has some limitations. First, it is not always possible to collect the adjustment data for non-participating subjects. Nor is it always clear whether these data are sufficient to control for potential bias, because we know, for example, that within the same socioeconomic category there are many important differences in terms of health, behavior, lifestyles, social networks, etc. ,29. FinaTo obtain a representative sample of the target population and to minimize the bias associated with selection effects at inclusion and during follow-up in CONSTANCES, we will take the following steps:Caisse nationale d'assurance vieillesse [Système d'information de l'assurance maladie (SNIIR-AM), the National Health Insurance Information System [Centre d'épidémiologie des causes de décès (CepiDc) [The sampling base at inclusion is composed of all persons aged 18 to 69 years and covered by CNAMTS in the catchment areas of the 17 CONSTANCES HSCs. Sampling will be done within the database of the National Retirement Insurance Fund administered by the eillesse which ineillesse . We willn System and the (CepiDc) . As we wThere will nonetheless be attrition due to the failure to return the annual questionnaire. Thus, adjustment for attrition is necessary if the analyses from the questionnaires variables are to be valid. Inclusion in CONSTANCES will take place over a 5-year period (see below). For wave 1, we will distinguish the participants who returned the self-administered questionnaire in year 2, that is, the year following their inclusion (which is year 1), from those who did not. We will have the data collected at inclusion in CONSTANCES (year 1) for all participants as well as the SNIIR-AM and CNAV data corresponding to year 1 or to year 0 (the year before inclusion). The coefficients of adjustment for attrition in year 2 can thus be calculated by a method similar to the one used to calculate the coefficient of adjustment for non-participation. For the following years, we will again distinguish the participants who returned the self-administered questionnaire from those who did not. Thus, the longitudinal follow-up of participants in the SNIIR-AM and CNAV databases, whether or not they drop out of the cohort by not returning the annual questionnaire, will make it possible to update the coefficients of adjustment for attrition.For descriptive purposes, each year we will adjust the cohort data on the reference population. The first year, we will randomly draw from the CNAV files a sample of CNAMTS members in the CONSTANCES districts aged 18 to 69 years. The second year, and respectively the third, fourth and fifth years, this sample of randomly drawn individuals will include people aged 18 to 70 years, then 18 to 71 years, 18 to 72 years and 18 to 73 years. Each of these samples will be twice as large as that of the population of CONSTANCES participants so that the reference population will be significantly greater than the sample. After linkage of this file with the SNIIR-AM files, we will calculate the relevant margins and thus, beyond socioeconomic and demographic characteristics, be able to integrate the variables relative to the health and healthcare utilization characteristics . The quality of weighting will be therefore substantially improved by the calculation of margins specifically related to health, the focus of the CONSTANCES cohort.Everyone with health insurance from CNAMTS, as well as their dependents, is entitled to receive health examinations that include free extensive work-ups conducted in selected HSCs. Overall the HSCs conduct approximately 600,000 health examinations annually. Randomly selected persons will receive an invitation to come to their HSC for inclusion in the CONSTANCES cohort. The 17 selected HSCs are distributed throughout France; they have experience with the recruitment of large numbers of people and with participating in epidemiological studies. All are large, have a staff motivated to work in epidemiology, and use advanced medical equipment; their geographic distribution represents the principal regions of France . This aAccess to the SNIIR-AM , which cHere we summarize the main data to be collected from different sources , at each stage of the study; the detailed list of data can be downloaded from CONSTANCES' website . When posocial position, educational and income level, employment and marital status, household composition, socioeconomic status of parents and spouse, and material living conditions , including geocoding of the residency address.personal and family history ; self-reported health scales ; incident and prevalent diseases ; information on sick leaves, handicaps, limitations, disabilities and injuries and healthcare utilization and management; and date and cause of death. In the HSC examination, weight, height, waist-hip ratio, blood pressure, electrocardiogram, vision, hearing, and lung function, laboratory tests will be measured.smoking and alcohol consumption (past and present), dietary habits and physical activity, marijuana use, sexual orientation.job history; lifelong and current occupational exposure to chemical, physical, and biological agents; postural, mechanical and organizational constraints; and stress at work.evaluation of functional capacities: IADL scale , questiowe plan to collect biological samples (blood and urine) during visits to the HSC and to store the samples for each of the 200,000 participants. For blood, we will store 32 aliquots (0.5 ml) for each subject: 8 buffy-coat aliquots, 4 total blood aliquots (EDTA), 8 plasma aliquots on EDTA PST, and 8 plasma aliquots on Hep Li PST, 4 serum aliquots (Dry SST). For urine, we will keep 8 aliquots. In all, we plan to store about 8,000,000 aliquots. Standardized procedures for biological samples collection will be used, including standardized blood sampling (pre-treatment of the samples in each recruitment center within 30 mn after the collection), transport from each site to the central laboratory within the night (<24 h) at 4-8°C, robotised aliquoting in cryotubes (2D barcodes) in the central biorepository, and storage in deep freezers (-80°C).In addition to this basic biobanking program, CONSTANCES will offer optional programs for specific research projects on subsets of participants, such as washed erythrocytes, RNA, proteins, mononuclear cells, saliva, or hair and nails.The periodicity of follow-up will vary according to the sources. A self-administered mail questionnaire will be sent annually, thus allowing close follow-up, by collecting numerous data without asking subjects for too much work each year. At the same time, it will facilitate rapid response for setting up new studies and establish a sense of loyalty in the participants; too long a delay between two questionnaires is a factor that promotes dropping out ). Some dThe self-administered questionnaires will undergo the standard verifications: percentages of non-response, missing data, delay in return, etc.For the data collected during the inclusion visit to the HSC, we established Standard Operational Procedures (SOP) for each of the examinations. Routine permanent quality control, based on regular on-site inspections by epidemiologic research assistants is planned, including monitoring of equipment used for the examinations, training of personnel, control of data completeness and validity from random samples of participants, etc. These quality control procedures will allow to assess the accuracy, reproducibility, concordance, and internal and external validity of the data collected and to study their factors of variability.For the data extracted from the national databases, particular attention will be paid to validation of the diagnoses extracted from the health-related administrative databases, which will be routinely verified. Initially, we will particularly focus on some major outcomes: ischemic cardiovascular events, cancers, and neurodegenerative diseases. Each suspected outcome reported in the available sources will be routinely verified at the hospitals or with the general practitioners and validated by specialized expert committees.A field pilot took place in seven of the participating HSCs from May 2009 to May 2010 for a four- to five-month period in each center. The pilot is not completely finished, and all data are not yet available. At the time this manuscript was prepared, about 3,500 subjects were included , and the preliminary analysis of the data showed that this sample was close to the general population of adults in France regarding sex, age and socioeconomic status. There was quite a diverse distribution of occupations and working conditions, lifestyle factors, and prevalence rates of various diseases and symptoms were close to those from other available French surveys. Regarding cognitive and physical functioning, there was also a very good variability in the tests results, in spite of the relatively young age of this sample.Finally, the field pilot showed that the procedures for invitation of selected subjects, for data collection and medical examination were quite satisfactory, and that only some marginal adaptations of the protocol were necessary; these are currently being implemented. More detailed results of the field pilot can be found on the CONSTANCES website .Commission nationale de l'informatique et des libertés-CNIL). CNIL verified that before inclusion, clear information is provided to the eligible subjects . Concrete procedures for setting up the two cohorts (participants and non-participants) ensure the confidentiality of the data at every point in its circulation as well as the anonymity of the cohort of non-participants. In addition, CONSTANCES was approved by the National Council for Statistical Information , the National Medical Council , and the Institutional Review Board of the National Institute for Medical Research-INSERM.According to the French regulations, the CONSTANCES Cohort project has obtained the authorization of the National Data Protection Authority and developed complex statistical procedures in order to take into account selection effects at inception as well as during the follow-up of the cohort. CONSTANCES will be a large cohort, including persons living and working in diverse settings, from large cities to small villages in different regions of France, with a broad range of socioeconomic status and trades. Numerous data will be collected at inception, including an extensive medical, physiological and biological examination, and a large biobank will be set up. The follow-up will be very extensive, relying both on active participation of the volunteers through annual questionnaires and regular visits to the HSCs, and on passive methods through the regular linkage to health and socioeconomic national exhaustive databases. Of particular importance is the high frequency of measurements from many different sources, allowing for analyses of lifecourse trajectories of health in relation to personal, social, occupational factors and major life events. Specific efforts were put into the quality of data collection and the validation of main outcomes in order to provide a highly phenotyped cohort. A unique feature of CONSTANCES is also to include a comprehensive set of cognitive and physical tests starting as young as 45 years, which is earlier in the lifecourse than most available studies on ageing.The CONSTANCES has also some limitations. Due to the voluntary participation of cohort members, there will probably be an underrepresentation of hard-to-reach subjects, such as heavy drinkers or socially excluded persons. Comparisons between participants and non-participants at inclusion and during the follow-up through the "non-participants cohort" should allow assessment of potential biases due to selection effects, but lack of sufficient numbers in some categories might be a problem. Even more importantly, CONSTANCES will not offer sufficient power to study rare outcomes or exposures despite its large size. Simulations under several hypotheses regarding the prevalence of exposure and expected relative risk and duration of follow-up since inception, showed that in most of the situations where the relative risk is below 2, especially when interactions have to be taken into account, power will be satisfactory after at least 5 years of follow-up for situations where the incidence of the outcome is over 10/100,000 and the prevalence of exposure over 10% (data not shown). This limit is common to all longitudinal cohorts, and we are currently working with colleagues from other countries on a consortium for networking of prospective studies in Europe where several large-scale prospective cohorts already exist, or are currently under construction. The objective is to increase the standardization and collaboration between these various prospective study resources to meet goals of increasing the sample size and statistical power for multi-factorial risk analyses of infrequent outcomes.The authors declare that they have no competing interests.MZ and MG designed the full protocol and are the joint PIs of the CONSTANCES Cohort project; they also drafted the manuscript. AG, RS and JG designed the sampling protocol and elaborated the statistical procedures. MC, MN, AO, MCP, AQ and CR contributed to the design of the questionnaires, to the linkage with the national databases and the relationship with the HSCs. SB, GR and AS are in charge of the procedures for data collection, secured transmission and of the management of the CONSTANCES database. AB contributed to the development of the SOPs and the relationships with the participating HSCs. JH was in charge of the design of the biobank. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/479/prepub |
Our understanding of the eukaryotic tree of life and the tremendous diversity of microbial eukaryotes is in flux as additional genes and diverse taxa are sampled for molecular analyses. Despite instability in many analyses, there is an increasing trend to classify eukaryotic diversity into six major supergroups: the 'Amoebozoa', 'Chromalveolata', 'Excavata', 'Opisthokonta', 'Plantae', and 'Rhizaria'. Previous molecular analyses have often suffered from either a broad taxon sampling using only single-gene data or have used multigene data with a limited sample of taxa. This study has two major aims: (1) to place taxa represented by 72 sequences, 61 of which have not been characterized previously, onto a well-sampled multigene genealogy, and (2) to evaluate the support for the six putative supergroups using two taxon-rich data sets and a variety of phylogenetic approaches.The inferred trees reveal strong support for many clades that also have defining ultrastructural or molecular characters. In contrast, we find limited to no support for most of the putative supergroups as only the 'Opisthokonta' receive strong support in our analyses. The supergroup 'Amoebozoa' has only moderate support, whereas the 'Chromalveolata', 'Excavata', 'Plantae', and 'Rhizaria' receive very limited or no support.Our analytical approach substantiates the power of increased taxon sampling in placing diverse eukaryotic lineages within well-supported clades. At the same time, this study indicates that the six supergroup hypothesis of higher-level eukaryotic classification is likely premature. The use of a taxon-rich data set with 105 lineages, which still includes only a small fraction of the diversity of microbial eukaryotes, fails to resolve deeper phylogenetic relationships and reveals no support for four of the six proposed supergroups. Our analyses provide a point of departure for future taxon- and gene-rich analyses of the eukaryotic tree of life, which will be critical for resolving their phylogenetic interrelationships. A major remaining gap in our knowledge of the tree of life is the uncertain relationships among eukaryotes, including the many divergent microbial lineages plus plants, animals and fungi. Microbial eukaryotes, often referred to as protists, are an eclectic assemblage of lineages that are defined as eukaryotes that are not plants, animals, or fungi . ClearlyDuring the 1970's and 1980's a revolution in understanding eukaryotic diversity occurred as a result of ultrastructural studies. These data ,3 demoliEarly molecular analyses relied on comparisons of rDNAs from diverse protists and suggested that diplomonads, trichomonads, and microsporidia were basal lineages -7. TheseThe past decade has seen the emergence of six eukaryotic 'supergroups' that aim to portray evolutionary relationships between microbial and macrobial lineages. The supergroup concept is increasingly accepted as evidenced by several reviews ,16 and tc-containing red algal plastid [The six putative supergroups have complex and often unstable histories. The supergroup 'Amoebozoa' was proposed in 1996 ,19 based plastid . 'Excava plastid . The sup plastid . The 'Op plastid . The sup plastid to unite plastid .We believe that comprehensive taxon sampling, coupled with gene-rich analyses, is critical for resolving accurate phylogenies . This isHere, we set out to accomplish two tasks: (1) place newly determined sequences from a diversity of microbial eukaryotes onto relatively well-sampled multigene eukaryote phylogenies, and (2) evaluate the support for the six supergroups. Our approach was to use phylogenetic analyses of four genes from two distinct taxon sets that included 61 newly-characterized sequences. The two taxon sets represent 1) 105 diverse eukaryotic lineages and 2) a reduced 92 taxon set in which long-branch taxa were removed. The four loci, SSU-rDNA, actin, alpha-tubulin, and beta-tubulin, have a rich history in eukaryotic phylogenetics ,12,26. TOur work contrasts with many past efforts that have used either single-gene data with a broad taxon sampling -11, or mSeventy-two sequences were characterized for this study, the bulk of which are newly-characterized (47 sequences) or were previously characterized from other strains (14 sequences), were available as ESTs in public databases (1 sequence) or are previously published and confirmed here , and contained members of all six putative supergroups contained at least three of the four targeted genes; and (2) represented the known breadth of eukaryotic diversity were analyzed under five combinations of data and methods: (1) a four-gene data set as nucleotides excluding third codon positions using RAxML, (2) a four-gene data set as nucleotides excluding third codon positions using MrBayes, 3) a data set of mixed nucleotide (SSU) and amino acid sequences using MrBayes, 4) a three-gene data set as amino acids using MrBayes, and (5) a three-gene data set as amino acids using PHYML and the dimorphid Dimorpha sp. (ATCC PRA-54), and protein coding genes for the thaumatomonad Thaumatomonas seravini and a Thecamoeba-like lineage (ATCC PRA-35) that is currently being described . Hyperamoeba sp. is sister to Physarum in all analyses except in the beta-tubulin protein tree . In many of the analyses, either there is a spurious relationship between ciliates and the Heterolobosea . In all our analyses, S. apogon shows a sister group relationship to the Heterolobosea and Steea Figs. , 2, 3. Sprofiles ,50. Ancy cristae . The phyof genes , suggestkaryotes .Mesostigma viride within the streptophyte branch of the Viridiplantae. This is consistent with a recent multigene analysis of nuclear, chloroplast, and mitochondrial data; the 'Plantae' phyla Glaucophyta and Viridiplantae received strong bootstrap and Bayesian support whereas there was moderate support for Rhodophyta monophyly [We also sampled representatives of all six chromalveolate phyla including multiple members from each phylum. Together, our analysis included new data for 12 taxa out of 43 chromalveolates in the tree. These 12 taxa were placed in their expected positions among the 6 different 'Chromalveolata' phyla, and all received moderate to strong support except for ciliates under Bayesian analyses of amino acid sequences (B:A) and of SSU-rDNA as nucleotides plus amino acid sequences (B:S-A). However, this supergroup is poorly supported or not monophyletic in the three other analyses plus Bigelowiella (chlorarachniophyte) with stramenopiles [The 'Rhizaria' receives only limited support , Glaucophyta, and Viridiplantae – is consistently polyphyletic Fig. , 3. The c-containing photosynthetic eukaryotes and their relatives and includes the cryptophytes, haptophytes, stramenopiles, apicomplexa, dinoflagellates, and ciliates [We find no support for the putative supergroup 'Chromalveolata', despite the addition of numerous species from this lineage; i.e., 43 putative members in the 105 taxon dataset. The chromalveolate hypothesis unites the chlorophyll ciliates . The comciliates ,64,73, tciliates -76 and pciliates ).Relationships among 'Chromalveolata' were recently tested using a 16-nuclear protein dataset that provided moderate bootstrap support for 'Chromalveolata' monophyly when including 'Rhizaria' include: (1) taxon and gene sampling is too limited to support these deep relationships and (2) these putative supergroups do not reflect accurately deep relationships within eukaryotes. Disentangling these alternatives will require the use of both a broad taxon sampling, as used here, combined with greater sequence data.Intriguingly, the level of support in these analyses of four genes, including numerous newly-characterized sequences, matches what emerged from a review of the literature on molecular phylogenetic analyses of eukaryotes in general . In bothAncyromonas and Malawimonas that could potentially form independent lineages. Ultimately, resolving deep nodes will require the use of multigene alignments incorporating a wide diversity of taxa combined with the identification of robust ultrastructural or molecular synapomorphies for proposed clades.As we are using the same set of genes that are present in many other analyses (including some of those used to establish the putative supergroups), there is some circularity in the comparison between our and previously published analyses. Hence, assessment of potential supergroups must await analyses of novel gene data sets sampled from many taxa, in particular including enigmatic taxa such as One hundred and five species from all six eukaryotic supergroups were used in this study. We obtained cultures from the American Type Culture Collection (ATCC), the Provasoli-Guillard National Center for Culture of Marine Phytoplankton (CCMP) and the Culture Collection of Algae at the University of Texas at Austin (UTEX). Cells were frozen in liquid nitrogen and ground with glass beads using a glass rod and/or Mini-BeadBeater™ . Total genomic DNA was extracted using the DNeasy Plant Mini Kit . Some DNA samples were obtained directly from the American Type Culture Collection (ATCC).et al. [et al. [Primers for SSU-rDNA genes are from Medlin et al. with thr [et al. . Other pTo align SSU-rDNA sequences, we used HMMER v2.1.4 whereas Genealogies were inferred using MrBayes , RAxML and PHYMHSY: led on data collection and analysis, contributed to writing; JG: led on data collection and analysis, contributed to writing; YIT: contributed to data collection and analysis, contributed to writing; MW: contributed to data collection; BCC: contributed to data collection; JCC: contributed to data collection; JML: contributed to data collection; DJP: contributed to data interpretation and writing;DB: oversaw data collection and analysis, contributed to writing and revision; LAK: oversaw project and led on much of the writing.Table 1. Table of taxa sampled and sources of genes.Click here for fileFigure 4. Likelihood analysis of the 105-taxon data set of SSU-rDNA + nucleotide sequences of actin, alpha-tubulin and beta-tubulin performed with RaxML. See text and Figure 2 for additional notes.Click here for fileFigure 5. Bayesian analyses of the 105-taxon data set of SSU-rDNA + nucleotide sequences of actin, alpha-tubulin and beta-tubulin performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 6. Bayesian analyses of the 105-taxon data set of amino acid sequences of actin, alpha-tubulin and beta-tubulin performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 7. Likelihood analysis of the 105-taxon data set of amino acid sequences of actin, alpha-tubulin and beta-tubulin performed with PhyML. See text and Figure 2 for additional notes.Click here for fileFigure 8. Likelihood analysis of the 92-taxon data set of SSU-rDNA + nucleotide sequences of actin, alpha-tubulin and beta-tubulin performed with RaxML. See text and Figure 2 for additional notes.Click here for fileFigure 9. Bayesian analyses of the 92-taxon data set of SSU-rDNA + nucleotide sequences of actin, alpha-tubulin and beta-tubulin performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 10. Bayesian analyses of the 92-taxon data set of amino acid sequences of actin, alpha-tubulin and beta-tubulin performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 11. Likelihood analysis of the 92-taxon data set of amino acid sequences of actin, alpha-tubulin and beta-tubulin performed with PhyML. See text and Figure 2 for additional notes.Click here for fileFigure 12. Bayesian analysis of 93 actin amino acid sequences that are in the 105 multigene taxon analysis, performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 13. Bayesian analysis of 96 alpha-tubulin amino acid sequences that are in the 105 multigene taxon analysis, performed with MrBayes. See text and Figure 2 for additional notes.Click here for fileFigure 14. Bayesian analysis of 98 beta-tubulin amino acid sequences that are in the 105 multigene taxon analysis, performed with MrBayes. See text and Figure 2 for additional notes.Click here for file |
Though prediction of protein secondary structures has been an active research issue in bioinformatics for quite a few years and many approaches have been proposed, a new challenge emerges as the sizes of contemporary protein structure databases continue to grow rapidly. The new challenge concerns how we can effectively exploit all the information implicitly deposited in the protein structure databases and deliver ever-improving prediction accuracy as the databases expand rapidly.O(nlogn), where n is the number of instances in the training dataset. In the experiments reported in this article, the proposed predictor delivered an average Q3 (three-state prediction accuracy) score of 80.3% and an average SOV (segment overlap) score of 76.9% for a set of 27 benchmark protein chains extracted from the EVA server that are longer than 100 residues.The new challenge is addressed in this article by proposing a predictor designed with a novel kernel density estimation algorithm. One main distinctive feature of the kernel density estimation based approach is that the average execution time taken by the training process is in the order of The experimental results reported in this article reveal that we can continue to achieve higher prediction accuracy of protein secondary structures by effectively exploiting the structural information deposited in fast-growing protein structure databases. In this respect, the kernel density estimation based approach enjoys a distinctive advantage with its low time complexity for carrying out the training process. In structural biology, protein secondary structures act as the building blocks for the protein tertiary structures ,2. ThereO(nlogn) for carrying out the training process, where n is the number of instances in the training dataset.Though prediction of protein secondary structures has been an active issue in bioinformatics research for quite a few years and many approaches have been proposed ,4-10, a This section reports the experiments conducted to investigate how Prote2S performs in comparison with the other existing predictors of protein secondary structures. The design of Prote2S is based on the relaxed variable kernel density estimator (RVKDE) that we have recently proposed . In the For Prote2S, the training dataset was derived from the PDB version available at the end of May, 2007. In order to guarantee that no protein chains used to generate the training dataset is homologous to the benchmark protein chains on the EVA server , from whThe testing dataset used in the following experiments was derived from the 106 benchmark protein chains released on the EVA server between September 7, 2004 and March 1, 2006. We extracted only those 89 protein chains of which the prediction results made by all the 5 predictors involved in the comparison are available on the EVA server. The testing dataset then comprises 27 long protein chains, each of which contains more than 100 residues, and 62 short protein chains.In addition to the training and testing datasets, we generated a validation dataset for tuning the parameters in Prote2S. How the validation dataset was generated and how the validation process was carried out will be elaborated in the next section.3 score delivered by Prote2S with long protein chains is significantly higher than those delivered by the other predictors. On the other hand, though Prote2S still leads in terms of the SOV score with long protein chains, the difference is not significant.Table Though the prediction accuracy delivered by Prote2S with long protein chains is superior, Prote2S did not perform as well with short protein chains. In fact, the prediction accuracy delivered by Prote2S with short protein chains is inferior to most predictors listed in Table O(nlogn), where n is the number of training instances. Therefore, it is conceivable that Prote2S can effectively cope with the high growth rate of the PDB and deliver ever-increasing prediction accuracy. In this respect, the experiment reported in Table γ = 0.01 based on the model selection process employed in [As mentioned earlier, one of the major distinctive feature of the RVKDE-based predictor is that the average time taken to construct a predictor is in the order of loyed in . The exeO(n2). On the other hand, the training time with the Prote2S increases approximately in the order of O(nlogn). Accordingly, it is conceivable that simply employing the SVM might be impractical for some bioinformatics applications, in which the database involved is already large and still growing fast. Another observation with Table The first observation about the experimental results presented in Table Our proposition concerning the inferior accuracies delivered by Prote2S in Table n' incoming objects is in the order of O(n' log n) [Another aspect of the execution time with a predictor is the time taken to make a prediction. In this respect, it has been shown in our recent article that the average time taken by the RVKDE-based predictor to make predictions with ' log n) . Table 5' log n) with rans1, s2..., sn} be a set of sampling instances randomly and independently taken from the distribution governed by fX in the m-dimensional vector space. Then, with the RVKDE algorithm, the value of fX at point v is estimated as follows:As mentioned above, the design of Prote2S is based on a novel kernel density estimation algorithm. The mathematical fundamentals of the so-called RVKDE can be found in our recent publication . A kerne1) R(si) is the maximum distance between si and its k nearest training instances;2) 3) Γ (·) is the Gamma function ;β and k are parameters to be set either through cross validation or by the user.4) v is predicted to belong to the class that gives the maximum value with the likelihood function defined as follows:For prediction of protein secondary structures, one kernel density estimator is created to approximate the distribution of each class of training instances. As mentioned earlier, in our experiment, each residue is associated with a PSSM computed with the PSI-BLAST software package, and is labeled as one of the three types of secondary structure elements: alpha-helix, beta-strand, or coil, as determined by DSSP. Then, a query instance located at Sj| is the number of class-j training instances, and j training instances. In our current implementation, in order to improve the efficiency of the predictor, we include only a limited number, denoted by k', of the nearest class-j training instances of v while computing where |With the predictions made by the RVKDE based algorithm for the query protein chain, Prote2S carries out a smoothing process as the last step before outputting the results. The smoothing process includes two phases. In the first phase, each single-residue segment of secondary structures with its two neighboring residues belonging to the same secondary structure is examined to determine whether switching the prediction of the single-residue segment to the same secondary structure as its neighbors can form a new segment containing 4 or more residues. If yes, then the switching is carried out. Otherwise, nothing will happen. In the second phase, all the remaining single-residue segments of secondary structures except those predicted to be a coil are located and the prediction of each segment is switched to the secondary structure of its longer neighboring segment.m = 1, β = 3, k = 38, and k' = 60, through a validation process. The validation dataset was derived from the 1903 protein chains deposited into the PDB between June 1 and August 31 in 2007. In order to remove redundancy, BLAST was invoked to guarantee that the BLAST-computed e-value similarity score between any two protein chains in the validation dataset is larger than 0.1. Furthermore, we removed those protein chains that are homologous to one or more of the protein chains used to generate the training dataset with a BLAST-computed sequence identity larger than 25%. As a result, a total of 302 protein chains remained. Among these 302 protein chains, we then included those 45 chains that are longer than 100 residues to generate the validation dataset.In the experiments reported in this article, the 4 parameters in the RVKDE algorithm were set as The authors declare that they have no competing interests.YJO proposed the RVKDE algorithm and conceived the study. DTHC and YYO implemented the Prote2S predictor. HGH, MHY, and CYC designed the experiments reported in this article. All authors read and approved the final manuscript. |
Carboxypeptidase G2, a zinc metalloenzyme isolated from Pseudomonas sp. strain RS-16, which catalyses the hydrolytic cleavage of reduced and non-reduced folates to pteroates and L-glutamate, has been linked to a monoclonal antibody (W14A) raised to human chorionic gonadotrophin. The coupling efficiency and retention of antibody and enzymatic activities are compared for three separate methods of preparing 1:1 conjugates. Preliminary in vitro studies on the cytotoxicity of the free enzyme and the conjugated enzyme towards JAR choriocarcinoma cells are reported. Despite the limitations of the in vitro model, it could be demonstrated that a significant proportion of 10(6) choriocarcinoma cells lost viability when exposed to either free or conjugated enzyme for 72 hours at concentrations of carboxypeptidase G2 of 1-3 units ml-1 of medium. |
Å b = 7.7219 (15) Å c = 11.416 (2) Å α = 102.76 (3)°β = 94.23 (3)°γ = 109.75 (3)°V = 584.0 (2) Å3 Z = 2 Kα radiationMo −1 μ = 0.27 mmT = 153 (2) K 0.30 × 0.24 × 0.18 mm Rigaku R-AXIS RAPID IP area-detector diffractometerABSCOR; Higashi, 1995T min = 0.924, T max = 0.953Absorption correction: multi-scan (4589 measured reflections2061 independent reflectionsI > 2σ(I)1712 reflections with R int = 0.017 R[F 2 > 2σ(F 2)] = 0.037 wR(F 2) = 0.109 S = 1.08 2061 reflections146 parametersH-atom parameters constrainedmax = 0.23 e Å−3 Δρmin = −0.27 e Å−3 Δρ RAPID-AUTO used to solve structure: SHELXTL (Sheldrick, 2008SHELXTL; molecular graphics: SHELXTL; software used to prepare material for publication: SHELXTL.Data collection: 10.1107/S1600536808007733/cv2391sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808007733/cv2391Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
ClC-7 is a ubiquitous transporter which is broadly expressed in mammalian tissues. It is implied in the pathogenesis of lysosomal storage disease and osteopetrosis. Because of its endosomal/lysosomal localization it is still poorly characterized.−/H+-antiporter. We have used rat ClC-7 in CHO cells as a model system to investigate the functionality and cellular localization of the wt transporter and its variant G213R ClC-7 which is the analogue of human G215R ClC-7 responsible for autosomal dominant osteopetrosis type II. Our study shows that rat G213R ClC-7 is functional but has a localization defect in CHO cells which prevents it from being correctly targeted to the lysosomal membrane. The electrophysiological assay is tested as a tool for drug discovery. The assay is validated with a number of drug candidates. It is shown that ClC-7 is inhibited by DIDS, NPPB and NS5818 at micromolar concentrations.An electrophysiological characterization of rat ClC-7 using solid-supported membrane-based electrophysiology is presented. The measured currents show the characteristics of ClC-7 and confirm its function as a ClIt is suggested that the scenario found in the CHO model system also applies to the human transporter and that mislocalization rather than impaired functionality of G215R ClC-7 is the primary cause of the related autosomal dominant osteopetrosis type II. Furthermore, the robust solid-supported membrane-based electrophysiological assay is proposed for rapid screening for potential ClC-7 inhibitors which are discussed for treatment of osteoporosis. Antiport activity was demonstrated for ClC-4 and 5 Members of the family of CLC chloride channels and transporters have received increasing attention in the last years because of their important physiological functions and their implication in pathogenesis. They are, therefore, important targets for drug discovery. CLC proteins can be divided into a group localized in the cellular plasma membrane and one localized in the membranes of intracellular organelles. Interestingly, the members of the first group are Cl− pathway + ATPase In this paper we therefore concentrate on ClC-7, a ubiquitous transporter which is broadly expressed in mammalian tissues For effective lysosomal function and bone resorption ClC-7 requires a β-subunit, Ostm1. Although ClC-7 is correctly targeted to lysosomes, association with Ostm1 enhances ClC-7 stability probably by protecting it from degradation CLCN7 gene have been associated with pathological phenotypes such as different types of osteopetrosis Mutations in the In the following we present an electrophysiological characterization of rClC-7 using solid-supported membrane-based electrophysiology (SSM-based electrophysiology) Furthermore, ClC-7 inhibition is discussed for treatment of osteoporosis A 1 mM octadecyl-mercaptan solution in ethanol was used for the incubation of the gold sensors. The lipid film forming solutions was diphytanoyl-phosphatidylcholin and octadecylamin . Phloretin, Luteolin, Kaempferol, Tamoxifen, Genistein, Quercitin, Furosemide, 2-[3-(trifluoromethyl)anilino]nicotinic acid (NFA), 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid (DIDS), 5-nitro-2-(3-phenylpropylamino)benzoic acid (NPPB), p-chlorophenoxy-acetic acid (CPA), p-chlorophenoxy-propionic acid (CPP), indanyloxyacetic acid 94 (IAA-94) and 9-anthracene-carboxylic acid (9-AC) were obtained from Sigma-Aldrich. NS5818 and NS3736 were synthesized at Bioduro, .CTC ACT TAT GGT GTT CAA TGC - 3′5′ - CCA ACA CTT GTC ACT ACT ; GAG AGT AGT GAC AAG TGT TGG - 3′5′ - GCA TTG AAC ACC ATA AGT ) resulting in EGFP and at position 213 of rClC-7 resulting in the mutant comparable to the human G215R. Mouse Ostm1 was obtained in pFROG and could be transfected directly.Rat ClC-7 was cloned with a C-terminal GFP-fusionprotein into pcDNA5/FRT/TO using HindIII and EcoRV. Point mutations were introduced using the QuikChange Site-Directed Mutagenesis Kit at position 64 of GFP using Effectene . Stable transfectants were selected by maintaining the cells in HAM's F-12 medium , containing 10% FCS, 1% Penicillin/Streptomycin and 600 µg/ml Hygromycin for 10–14 days. Medium was replaced every 2–3 days. These cell lines, constitutively and homogeneously expressing the ClC-7 fusion protein, were additionally transfected with pFROG-mOSTM1 and selected for stable transfectants with 500 µg/ml G418. For single clone isolation, cells were seeded at a theoretical concentration of one cell/well in 96well plates. After 7 days, when single colonies were visible, the clones were expanded and analyzed for their expression pattern using confocal microscopy. For membrane preparation, cells were grown in multiple 15 cm culture dishes. At a confluency of 90–95% cells were harvested and collected by centrifugation (800× g). Subsequently, pellets were flash frozen in liquid nitrogen and stored at −80°C until preparation.Human ClC-Ka (NM_004070) was stably co-expressed with its β-subunit barttin (NM_057176) in CHO cells using the bipromoter vector pBudCE 4.1 (Invitrogen). ClC-Ka was inserted via Hind III and Xba I downstream of the CMV promoter, while Barttin was inserted after the EF-1a promoter using Kpn I and Xho I. Stable clones were selected by 150 µg/ml zeocin (Invitrogen). Cells were cultured and harvested as described before.E. coli (BL21 DE3), purified as described before E. coli polar lipids, LPR = 10) EcClC-1 was expressed in Cell pellets were resuspended in buffer and 1 tablet Roche Complete™) and disrupted in a Parr Bomb . Total membranes were collected by ultracentrifugation and fractionated by density gradient centrifugation To investigate the vesicular localization of the wild type (wt) and mutant ClC-7-EGFP fusion proteins, cells were grown on coverslips for 24 to 48 hours. After reaching a confluence of 50–80% cells were incubated with 50 nM LysoTracker®-Red for 15 min or 1 µM ER-Tracker™-Red for 30 min, respectively (Invitrogen). Samples were analyzed instantaneously with a confocal laser-scanning microscope using the argon laser line at 488 nm for EGFP and a 543 nm HeNe laser for Lyso- and ER-Tracker excitation. Fluorescence was detected through a 500–550 nm band pass filter and a 560 nm long pass filter, respectively. Images were recorded with an Achroplan 63×/0.95 W water immersion objective in multi track mode with sequential excitation of EGFP and Tracker dye, respectively. LysoTracker®-Red was prevented from exposure to broadband illumination before confocal imaging to prevent photoconversion 2, 300 mM NaAsp). EGFP was excited using a 480/20 nm band pass filter, fluorescence emission was detected through a 530/25 nm band pass filter. The samples were analyzed in Greiner 96well flat bottom plates, the optical position was the well bottom.For a quantitative analysis of the membrane fractions the EGFP fluorescence of the ClC-7 fusion proteins was analyzed using a microplate fluorescence reader . Membrane fractions were diluted to an equal concentration of 1 mg/ml in 50 µl buffer and blocked for 1 hour in 5% nonfat dry milk (PBS-T). The blot was incubated with a rabbit-anti-GFP antibody (1∶100) overnight at 4°C. Lysosome or ER-enriched membrane fractions were identified, using a monoclonal mouse anti-LAMP-1 (Abcam) and a polyclonal rabbit anti-calnexin antibody . For detection of mOstm1 and ClC-3 rabbit anti-mOstm1 2R One instrument . The experiments were carried out at room temperature (22°C). After the formation of the SSM 2R sensors (SSM-area ∼7 mm2) using a centrifugation procedure of 800× g for 45 min. For the ClC-7 measurements the 31/45% membrane fractions were used. Before mounting the sensors into the SURFE2R One instrument they were kept in Cl− free buffer . The solution exchange protocol consisted of 3 phases with a duration of 2 s each and a flow rate of 250 µl/s: a flow of nonactivating solution (NA) followed by activating solution (A) followed by nonactivating solution (NA). Solution A contained one or both transported substrates of ClC-7 . In the case of Cl− concentration jumps, NA contained aspartate− at the same concentration as Cl− to minimize solution exchange artifacts. In addition all solutions contained a basic buffer which was 60 mM HEPES, pH 7.2, 3 mM CaCl2, 300 mM Na-aspartate at neutral pH. Detailed buffer compositions are given in the figure legends.Electrophysiological measurements were performed on a commercial SURFE2R One instrument. After changing buffer conditions (eg. pH) the sensors were incubated for 10–15 minutes before measurement to allow equilibration of the internal vesicle volume to the buffer conditions.Different buffers or inhibitor concentrations could be applied automatically using the autosampler of the SURFEWild type (wt) rat ClC-7 and its G213R variant (the rat homolog of human G215R) were cloned as fusion proteins with EGFP. The Flp-In™ expression system was used to generate stably expressing recombinant CHO-cells. Subsequently, the ClC-7 β-subunit mOstm1 When the ß-subunit Ostm1 was co-expressed with wt ClC-7, the EGFP fluorescence and therefore the expression level of ClC-7 increased significantly but localization was not affected in all 12 analyzed clones . In contIn all cell lines, expression in the plasma membrane could not be detected. Furthermore, control patch clamp experiments performed with those cells did not show significant chloride currents. The absence of ClC-7 expression in the plasma membrane of recombinant cell lines is in good agreement with the findings of previous studies Due to the lack of ClC-7 expression in the plasma membrane, standard electrophysiology was not an option. Therefore, SSM-based electrophysiology was applied using membranes prepared from CHO cells. In an attempt to separate plasma membrane and internal membranes, sugar gradient fractionation was used as described in The ClC-7-EGFP fusion proteins (∼120 kDa) could be detected by Western blot in the fractions 31/45% and 45/51% . While tTo quantify the distribution more thoroughly we performed a fluorimetric analysis of the membrane fractions taking aAlso the expression behavior of Ostm1 analyzed by western blot is interBecause ClC-3 and ClC-6 have been shown to be shifted partially into lysosomal fractions upon lack of ClC-7 −) towards the SSM. In view of the very gentle method of cell disruption by pressure homogenization To determine ClC-7 protein activity, equal amounts of fraction 31/45% adjusted to the same total protein concentration were adsorbed to the SSM sensors see and tranWhile non-expressing Flp-In™ CHO cells yielded only very small endogenous currents . For comparison, the same proton concentration jump was applied in the absence of Cl− and the resulting peak current (∼1 nA) subtracted. As displayed, ClC-7 is only weakly selective but shows a significant preference for Cl− over Br− over I−.Ion selectivity was determined for Cl− and I− . Concent+-driven anion-transport which was further examined. Therefore, a 30 mM Cl− concentration jump was applied together with inward directed and outward directed proton gradients and the signals were compared to that obtained in the absence of proton gradients (pH 7.2). In more detail: for the favorable pH gradient a combined Cl− and proton concentration jump was applied . The same proton concentration jump was applied in the absence of Cl− and the resulting peak current subtracted. The resulting difference signal was normalized to a simple Cl− concentration jump . For the unfavorable pH gradient the same procedure was used with pH 9.0 pH inside the vesicles. For comparison, this was done for different members of the CLC protein family: the human Cl− channel ClC-Ka (+barttin), the well characterized Cl−/H+-antiporter EcClC-1 from E. coli and ClC-7 (− channel) activity, EcClC-1 (Cl−/H+-antiporter) and ClC-7 currents were significantly modulated, depending on the direction of the gradient , preventing the determination of a complete IC50. Quercetin and Genistein showed weakly inhibiting effects at 100 µM while CCP, CPA, 9-AC, Tamoxifen and Kaempferol did not inhibit ClC-7 currents in the investigated concentration range (<300 µM). Robust IC50 values could be determined for DIDS, NS5818 and NPPB. DIDS inhibited the currents with an IC50 of 39±3.8 µM, NS5818 with 52±8.0 µM and NPPB with 156±7.8 µM. As an example, the inhibition graphs for DIDS and NPPB are shown in Specificity of the SSM-based electrophysiological ClC-7 assay was tested by screening a number of potential chloride channel inhibitors. Using the SURFEcterized and IC50−>Br−>I− and (3) pH-gradient driven anion transport. In addition, unspecific Cl− transport inhibitors like DIDS and NS5818 inhibited the currents with relatively high affinity Anion specific currents driven by a proton gradient only Modent only . The latl ClC-Ka .Note that pH regulatory effects cannot be excluded in this experimental approach. It is known that ClC-Ka currents in two-electrode voltage clamp measurements SSM based electrophysiology was essential in this study, because ClC-7 is expressed in intracellular membranes i.e. late endosomes and lysosomes, which are not accessible for conventional electrophysiology. Unlike other intracellular transporters of the CLC family such as ClC-4 and ClC-5, which could be investigated in oocytes or mammalian cell lines because of a “spill-over” to the plasma membrane at high overexpression Fluorescence of the ClC-7-EGFP fusion protein was used to check the localization of ClC-7 expressed in CHO cells. In vivo ClC-7 resides in late endosomes, lysosomes and the ruffled membrane of osteoclasts Interestingly, Ostm1 significantly changes the expression pattern of G213R ClC-7, restoring the lysosomal localization to some extent. In addition, G213R ClC-7 co-expressing Ostm1 is characterized by a small preference for the lysosomal membrane fraction 31/45% used for the electrophysiological experiments , resultiThe currents shown in Interesting is also the enhancement of the normalized transporter currents by Ostm1 . This isMutations in ClC-7 or its β-subunit Ostm1 lead to severe pathological phenotypes Mutations can cause a lack of function by direct impairment of protein activity, by a lack of protein expression or by its incorrect trafficking. It has been suggested previously As shown above, the transporter function of G213R ClC-7 is not abolished. At the same time localization studies demonstrate that G213R ClC-7 is retained in the ER while the wt is correctly targeted to the lysosomal membranes . Applied− conductance. Cl− transporters like ClC-5 are not at all expressed in CHO Because of its involvement in bone pathology, ClC-7 is an interesting target for drug discovery. For example, inhibitors of ClC-7 are under discussion for the treatment of osteoporosis Assay quality is commonly estimated by the Z'- factor, with a Z'>0.5 being considered an “excellent” assay In conclusion, the inhibition study proves the suitability of SSM-based electrophysiology for screening of ClC-7 inhibitors. Among the small number of tested compounds no promising drug candidate for the inhibition of ClC-7 could be identified. For a realistic chance of detecting drug candidates larger compound libraries have to be screened using dedicated equipment which is now commercially available |
YKL-40 (chitinase-3-like-1) is a member of "mammalian chitinase-like proteins". The protein is expressed in many types of cancer cells and the highest plasma YKL-40 levels have been found in patients with metastatic disease, short recurrence/progression-free intervals, and short overall survival. The aim of the study was to determine the expression of YKL-40 in tumor tissue and plasma in patients with borderline ovarian tumor or epithelial ovarian cancer (OC), and investigate prognostic value of this marker.YKL-40 protein expression was determined by immunohistochemistry in tissue arrays from 181 borderline tumors and 473 OC. Plasma YKL-40 was determined by ELISA in preoperative samples from 19 patients with borderline tumor and 76 OC patients.YKL-40 protein expression was found in cancer cells, tumor associated macrophages, neutrophils and mast cells. The tumor cell expression was higher in OC than in borderline tumors (p = 0.001), and associated with FIGO stage (p < 0.0001) and histological subtype (p = 0.0009). Positive YKL-40 expression (≥ 5% staining) was not associated with reduced survival. Plasma YKL-40 was also higher in patients with OC than in patients with borderline tumors (p < 0.0001), and it was positively correlated to serum CA-125 (p < 0.0001) and FIGO stage (p = 0.0001). Univariate Cox analysis of plasma YKL-40 showed association with overall survival (p < 0.0001). Multivariate Cox analysis, including plasma YKL-40, serum CA125, FIGO stage, age and radicality after primary surgery as variables, showed that elevated plasma YKL-40 was associated with a shorter survival .YKL-40 in OC tissue and plasma are related to stage and histology, but only plasma YKL-40 is a prognostic biomarker in patients with OC. The prof cancer -8. The hf cancer -8. Furthf cancer -8. It haobtained .Immunohistochemical studies have demonstrated a strong cellular expression of YKL-40 in all germ layers of human embryos and fetuses, including ecto-, meso- and endoderm . The expNeoplastic tissue has also been found to show a higher expression for YKL-40 than the normal counterpart . In glioHigh YKL-40 protein expression has also been found in carcinoma cells from breast -18, coloThere are no published studies on YKL-40 protein expression in OC tissue. Preoperative serum or plasma concentrations of YKL-40 are elevated in 65% of patients with FIGO stage I and II, and in 74% to 91% of patients with FIGO stage III and IV ,24. PatiThe aim of this study was to determine YKL-40 tissue expression in borderline and epithelial OC tissues, its possible correlation to clinical-pathological parameters and plasma YKL-40 levels, and the prognostic value of both YKL-40 tissue expression and plasma levels.The MALOVA study ("MALignant OVArian cancer study") is a multidisciplinary Danish study covering epidemiology, lifestyle factors, biochemistry and molecular biology with the purpose of identifying risk factors and prognostic factors for OC. The design of the MALOVA study is described in details elsewhere . Brieflyrd, 2007, whichever came first, were registered. The relevant hospital files were collected and scrutinized and information on treatment (surgery and chemotherapy), was established. At the end of follow-up, a total of 490 OC patients had died , and 191 OC patients were still alive .In Denmark all inhabitants have a unique personal (10-digit) identification number (CPR number), which is used universally in the Danish society. These identification numbers, which comprise information on date of birth and sex, are registered in the computerized Danish National Central Population Register. The register contains information on e.g. dates of death and emigration. All cases in this study were traced in the register and date of death, emigration or August 23The paraffin embedded tissue from the tumors was used for tissue array analyses. Forty-eight OC and 24 borderline ovarian tumors were excluded because of poor tissue quality or lack of tumor tissue in the collected blocks, and 132 OC and 16 borderline ovarian tumors were excluded due to unreadable YKL-40 expression results, lack of tumor cells in the selected TA cylinders, loss of tissue during the staining procedure or folding/tearing of sections by the microtome. Finally, 42 non-epithelial tumors (28 OC and 14 borderline ovarian tumors) were excluded because epithelial and non-epithelial ovarian tumors differ in embryologic and pathologic characteristics. Together, these exclusions left 473 OC and 181 borderline ovarian tumors, which were suitable for the YKL-40 tissue expression and survival analyses.For the tissue array production, one to two representative areas were marked on a freshly cut H&E stained section from each selected block. Tissue cylinders with a diameter of 2 mm were punched from corresponding areas in the donor tumor block and brought into 2–4 individual recipient paraffin blocks (tissue array blocks), using a custom-made manual Tissue Array Instrument . Once the cores were laid into the recipient block, the paraffin was slightly melted in order to bind the cores into the block. This treatment secured the cores during sectioning. Melting was achieved by placing the blocks in an oven at 37°C for 10 min.A total of 2 to 4 tissue arrays consisting of corresponding viable and representative tissues from each ovarian tumor were constructed in order to minimize the risk of intra-tumor variability. The tissue arrays were sorted with respect to histological subtype and FIGO stage. Four cores of control tissue were placed strategically in each tissue array to ensure unique orientation of every tissue array together with a maximum of 31 different patient tumor samples.Two μm sections from the tissue array blocks were transferred to glass slides . Slides were stored at 4°C for a maximum of 8 days until staining for YKL-40.Prior to staining, the sections were deparaffinized in xylene and rehydrated in graded dilutions of alcohol. In order to demask antigens within the tissue, sections were pretreated in TEG buffer, pH 9.0 (Tris 10 mmol/l and EGTA 0.5 mmol/l), followed by heating in a microwave oven to 98°C for 15 min. Sections were then left to cool in the buffer at room temperature for an additional 15 min. To block endogen peroxidase activity the sections were treated with 0.03% w/v hydrogen peroxide for 5 min. To avoid background staining the sections were then pre-incubated with 5% w/v purified bovine serum albumin (BSA) diluted in TRIS buffer pH 7.6 for 10 min. The primary specific mouse monoclonal antibody against human YKL-40 was diluted 1:100 (38 ng/ml) in 1% w/v purified BSA (Dade Behring) in TRIS buffer pH 7.6 and incubated for 60 min. The secondary antibody EnVisionTM+System-HRP (DAB) was used for 30 min. The colour was developed with DAB added with chromogen for 10 min. Sections were rinsed in water, counterstained in Mayers Hematoxylin for 3 min and finally dehydrated, mounted and coverslipped with Pertex. Washings with 5 mM Tris buffer, pH 7.6 with NaCl 0.9% w/v and Tween 0.1% v/v (TBS) were used between all steps in the procedure. After heating all steps were performed at room temperature in a humidity chamber to avoid air-drying of the sections. The staining process was done manually.Two observers, both experienced in evaluating immunohistochemical stained tissues, simultaneously assessed the patterns of YKL-40 protein expression of each tumor sample. The observers had no knowledge of clinical parameters and study endpoint. Standardization of scoring was achieved by comparison of the scores, and any discrepancies were resolved by consensus. Scoring for YKL-40 protein expression was based on the proportion of cells in a given tumor specimen exhibiting distinct cytoplasmic immunopositivity as well as the intensity of staining . Secondly, the YKL-40 scoring results were transformed into two scales: a two-tiered scale and a four-tiered scale . The four tissue control cores of kidney and liver, respectively, showed consistent staining results. For the general description and the prognostic evaluation both scales were used.Blood samples were obtained no earlier than two weeks prior to surgery from the 95 patients operated at Herlev Hospital and Rigshospitalet, University of Copenhagen. EDTA-blood samples were left on the blood cells at room temperature for less than 8 hours. Following the samples were separated by centrifugation at 2000 g for 10 min. at room temperature and plasma EDTA samples stored in aliquots at -80°C until analysis. EDTA plasma samples collected from patients included in the MALOVA study, who had been treated at other hospitals were not used for plasma YKL-40 measurements, since the plasma obtained from these centers had not been separated from the blood cells within 8 hours after sampling. It is known that EDTA plasma YKL-40 is only stable when samples are processed within 8 hours .Plasma levels of YKL-40 were determined in duplicates by a commercial two-site, sandwich-type enzyme-linked immunosorbent assay using streptavidin coated microplate wells, a biotinylated-Fab monoclonal capture antibody, and an alkaline phosphatase-labeled polyclonal detection antibody. The detection limit was 20 μg/l. The intra-assay coefficient of variation (CV) was ≤ 5.0% and inter-assay CVs ≤ 10.2%. The samples were analyzed blinded to clinical parameters and study endpoint.The reference interval for plasma YKL-40 was determined in 144 healthy women characterized by not being on medication and having no signs of pre-existing disorders such as joint, liver, metabolic or endocrine disease or malignancy.Written informed consent was obtained from all patients. The study has been approved by the scientific ethical committee in the study area (KF01-384/95).rd, 2007. Patients who died from non-related OC were censored in the survival analyses at the date of death. Cases in which patients were alive by this date were censored. Survival probabilities were estimated by the Kaplan-Meier method and tests for differences between strata were done using the log-rank statistic. Graphical presentation using Kaplan-Meier estimates of survival were shown grouping the patients by YKL-40 expression in the tumor tissue dichotomized at 5%. Graphical presentation using Kaplan-Meier estimates of survival were shown grouping the patients by plasma YKL-40 levels dichotomized as normal or elevated compared to age-matched controls. In the univariate survival analyses the YKL-40 expression scale in tumor tissue was dichotomized as < 5% vs. ≥ 5% and the plasma YKL-40 levels by the actual value on the log scale (log transformed). The multivariate Cox regression multivariate analysis was based on FIGO stage, residual tumor after primary surgery, serum CA-125, age and plasma YKL-40 levels by the actual value on the log scale (log transformed). Confidence intervals (95% CI) were based on Wald's test statistic for the corresponding parameters in the Cox regression model, i.e. on the log-scale for the hazard ratios (HR). Model assessment was done using graphical methods, Schoenfeld and martingale residuals. P-values less than 5% were considered significant. All calculations were performed using SAS .Statistical comparisons between groups were carried out using Chi-square or rank sum tests. Association between YKL-40 tissue expression levels and plasma YKL-40 levels was assessed using the Spearman correlation. The clinical endpoint in the OC patients was survival determined as the time from baseline blood sample before operation to time of death updated at August 23Tissue arrays for YKL-40 immunohistochemical analysis were available from 181 patients with borderline ovarian tumors and from 473 patients with OC .borderline ovarian tumors was: level 1 (negative): 44 (24%); level 2: 74 (41%); level 3: 35 (19%) and level 4: 28 (16%). The distribution of the YKL-40 score in the OC samples was: level 1 (negative): 112 (24%); level 2: 101 (21%); level 3: 138 (29%) and level 4: 122 (26%). Figure The distribution of the YKL-40 score in the The association between clinico-pathological variables and YKL-40 score is shown in Table The highest frequency of any level of positivity of YKL-40 protein expression was observed in serous adenocarcinomas, where 123 out of 249 tissues were scored positive (49%).th percentile of the healthy women. Patients with borderline ovarian tumors did not have elevated plasma YKL-40 compared to healthy women. 21% (4/19) of the patients with borderline tumors had a plasma YKL-40 level above the age-adjusted 95th percentile of the healthy women. Table Plasma samples for YKL-40 analysis were available from 19 patients with borderline ovarian tumors and from 76 patients with OC . The median preoperative plasma level of YKL-40 in the OC patients was 125 μg/l (range 20 – 2650 μg/l) and significantly higher than the level in 144 healthy women . 67% (51/76) of the OC patients had a plasma YKL-40 level above the age-adjusted 95Univariate survival analysis demonstrated that YKL-40 tissue expression (negative or ≥ 5% positive tumor cells) was not associated with survival of the 76 OC patients died. Univariate Cox analysis of plasma YKL-40 (log transformed and treated as a continuous covariate) showed significant association with overall survival . Univariate Cox analysis of plasma YKL-40 showed also significant association with overall survival . Figure Performing a multivariate Cox analysis including plasma YKL-40 (log transformed and treated as a continuous covariate), serum CA-125 (log transformed and treated as a continuous covariate), FIGO stage (I-IV), residual tumor after surgery (yes or no), and age showed that only plasma YKL-40 was found of independent prognostic value of overall survival. Age at surgery , radicality after primary surgery , serum CA-125 and FIGO stage were found of no independent prognostic value in OC patients.In the present study we found YKL-40 protein expression in OC cells with a higher expression score in OC than in borderline tumors, and a clear association with FIGO stage and type of histology, but not with survival. We used tissue micro array with a tissue core diameter of 2.0 mm, but although this is comparatively large we do not know whether the degree of heterogeneity of YKL-40 protein expression in OC tissue could have influenced our results. This was, however, not the case in an immunohistochemical analysis of YKL-40 protein expression in tissue micro arrays of breast cancer . Our preThere are no published studies on YKL-40 protein expression in OC tissue, and to our knowledge no publications exist on a close association between serum YKL-40, serum CA-125 and CA15-3 in patients with OC -26. It hIn the present study plasma was available from a small subgroup of patients with borderline ovarian tumors and OCs, and in accordance with the studies mentioned above -26 we alIn conclusion, this study has shown that YKL-40 is expressed in OC cells, and a high expression is associated with a high FIGO stage and histological type of tumor. In contrast to plasma YKL-40, high tumor cell expression of the protein was not associated with poor prognosis. This may be due to contribution to the plasma YKL-40 level from tumor-associated inflammatory cells, which also produce the protein.The authors declare that they have no competing interests.EH contributed to the conception of study design, data collection, method, statistical analysis, interpretation of the results and drafting of the final manuscript. SKK contributed to the conception and design of study and data collection. CKH (Co-Investigator of the MALOVA study) contributed to the conception of study design, data collection and statistical analysis. JB (Co-Investigator of the MALOVA study) contributed to the conception of study design. JSJ contributed to the conception of method, interpretation of the results and drafting of the final manuscript. MR contributed to the conception of method used in the analyses of YKL-40 and interpretation of the results. LO-M. contributed by data collection and statistical evaluation. LHC contributed to the conception of immunohistochemical method and interpretation of the results. IJC contributed to the understanding of statistical analysis and interpretation of results. PAP contributed to the conception of method and the YKL-40 AAb.All authors read and approved the final paper.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/8/prepub |
The dioxolane five-membered ring and the lactone ring adopt half-chair conformations. There are two intermolecular C—H⋯O interactions involving the carbonyl group as an acceptor which stabilize the crystal structure.The title compound, C Å b = 7.8135 (11) Å c = 25.977 (4) Å V = 1177.3 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.13 mmT = 293 K 0.51 × 0.48 × 0.26 mm Bruker SMART APEX CCD area-detector diffractometerSADABS; Bruker, 2001T min = 0.761, T max = 1.000 (expected range = 0.736–0.968)Absorption correction: multi-scan (6682 measured reflections1455 independent reflectionsI > 2σ(I)1261 reflections with R int = 0.131 R[F 2 > 2σ(F 2)] = 0.054 wR(F 2) = 0.134 S = 1.00 1455 reflections173 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.25 e Å−3 Δρmin = −0.32 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809028256/gk2220sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809028256/gk2220Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
A new crystal structure of assembled subunits from the eukaryotic exosome complex gives insight into the interactions underpinning its various functions . Here, we focus on what the emerging structures tell us about the regulation of the exosome interactions with, and actions on, RNA. If a parallel may be drawn between the processes of life and of computation so that DNA is considered the imperfectly replicated template of inherited programs, then what do we make of RNA? Beyond its roles in translation as short-lived intermediary and component of the protein-synthesis machinery, RNA moonlights as a key regulator of gene expression. In its noncoding capacity, RNA boosts astronomically the information content of the DNA-encoded program. With so much RNA about that can impact the computational program, it is imperative that all RNAs—coding as well as noncoding—are maintained at appropriate levels, that the information they confer lasts only as long as needed and no longer, that their quality is controlled, and that they are efficiently scavenged for recycling at the end of their useful lifetimes.Cell, Perhaps unsurprisingly, several biological machines have evolved to meet the exacting demands for RNA turnover, surveillance, and precise maturation of structured precursor RNAs . One sucThe core of the exosome is a ring formed from six nearly identical subunits that are homologs of the eubacterial ribonuclease RNase PH . RNase POne puzzling finding is that the PIN endonuclease subdomain of Rrp44 is exposed to the solvent on the exosome surface, while the exonuclease domain is orientated to intercept the end of any RNA threaded through the central channel of the core. The 3′ exonuclease domain of Rrp44 is presumed to engulf the end of the substrate in the exosome are added in the nucleus to target RNA for decay. It seems that the tail might aid channeling of RNA substrates into the nuclear exosome, and therefore the length of the tail is likely a key signature to mark RNA for destruction. The nuclease protection experiments suggest that the exosome can protect a length of 30 nucleotides in a single-stranded RNA. Degradation cannot be initiated near a stable stem structure, and polymerases can add a single-stranded tail that may act as a “landing pad” for the exosome. In yeast, a major cofactor for the nuclear exosome is the TRAMP polyadenylation complex that is involved in nuclear surveillance of RNAs and RNA-protein complexes . Its comThe question naturally arises why organisms with a nucleus have retained exosomes that look like bacterial PNPase, but have entirely lost the corresponding phosphorolytic activity? We suggest that this could have arisen to prevent the exosome from randomly adding tails to RNA. Polynucleotide phosphorylase and the archaeal exosome can work backward to add tails under conditions when phosphate is low but nucleoside diphosphates are abundant . In its The ring architecture of RNase PH, PNPase, and the exosome is truly ancient, and its conservation is a reflection of its important biological roles and just how deeply embedded it has become in the regulatory repertoire in all domains of life . The emb |
The functions of many schistosome gene products remain to be characterized. A major step towards elucidating function of these genes would be in defining their sites of expression. This goal is rendered difficult to achieve by the generally small size of the parasites and the lack of a body cavity, which precludes analysis of transcriptional profiles of the tissues in isolation.Schistosoma japonicum. This approach helps to solve the gene characterization “bottle-neck” brought about by acoelomy and the size of these parasites. Complementary RNA obtained after isolation from gastrodermis (parasite gut mucosa), vitelline glands and ovary by LMM were subjected to microarray analyses, resulting in identification of 147 genes upregulated in the gastrodermis, 4,149 genes in the ovary and 2,553 in the vitellaria.Here, we describe a combined laser microdissection microscopy (LMM) and microarray analysis approach to expedite tissue specific profiling and gene atlasing for tissues of adult female This work will help to shed light on the molecular pathobiology of this debilitating human parasite and aid in the discovery of new targets for the development of anti-schistosome vaccines and drugs. Schistosoma japonicum. From these dissected tissues we then used a broad molecular biology method to identify the multiple genes active in these tissues. Our approach has allowed us to formulate the basis of a “gene atlas” for schistosome parasites, defining the expression repertoire of specific tissues. The better understanding of the roles of tissues in parasite biology, especially in development, reproduction and interactions with its human hosts, should promote future investigations into pathogenesis and control of these significant parasites.Schistosomes are parasitic worms responsible for important human diseases in tropical and developing nations. There is urgent need to develop new drugs and vaccines to augment current treatments for this disease. In recent years, concerted efforts by many laboratories have led to extensive genetic sequencing of the parasites, and the publication of genome sequence for two agents of schistosomiasis appears imminent. This genetic information has revealed many molecules expressed by the schistosome parasites for which no functional information is available. This lack of information extends to ignorance of where in the complex multicellular schistosome parasites the genes are expressed. We integrated two molecular and cellular techniques to address these knowledge gaps. We used laser microdissection microscopy to dissect small but highly important tissues involved in nutrition and reproduction from sections of female Schistosoma are parasitic blood flukes responsible for the serious but neglected human disease of schistosomiasis in situ hybridization have been at the vanguard of functional studies of schistosome proteins Members of the genus Schistosoma mansoni and S. japonicumConcerted international efforts have been directed at defining functional relevance of the predicted 14–16,000 schistosome genes to identify potential targets for drug and vaccine therapies Schistosoma japonicum, as a means to expedite functional characterization of schistosome gene products. Our approach incorporates methods of laser microdissection microscopy (LMM) to generate tissue-specific transcriptional extracts for subsequent microarray analysis. This work follows hypotheses Here, we report on tissue-specific gene expression analysis of adult female Schistosoma japonicum-infected Oncomelania hupensis hupensis snails, collected from Anhui Province, China, were provided by the National Institute of Parasitic Diseases-CDC, Shanghai. Adult worm pairs were perfused 6 weeks post-challenge from infected ARC Swiss mice. Two batches of approximately 25 live female parasites were flat embedded in Tissue-Tek Optimal Cutting Temperature compound (OCT) and snap-frozen on dry ice. The sample blocks were stored at −80°C, prior to sectioning with sterile blades in a cryostat. Sections were cut at 7 µm and mounted onto a sterilized polyethylene-naphthalene membrane on a microscope slide . The slides were then stored at −80°C.The use of mice in this study was approved under Project P288 by the Animal Ethics Committee of the Queensland Institute of Medical Research. For transmission electron microscopy, female parasites were fixed in 3% glutaraldehyde in 0.1 M phosphate buffer at pH 7.4 for 2 h, post-fixed in potassium ferricyanide-reduced osmium tetroxide, followed by 5% aqueous uranyl acetate, dehydrated in acetone and embedded in Epon resin. Ultrathin sections were viewed on a JEM 1011transmission electron microscope operated at 80 kV.6 µm3 of tissue) was collected separately from each of the tissues onto 500 µl opaque adhesive caps (P.A.L.M. Microlaser Technologies). The areas amount to the collection of many 1000's of microdissected elements for each tissue. For control tissue, we used 12 S. japonicum females that were snap-frozen in OCT and sectioned by cryostat. Control sections were collected onto 6 sterile glass slides. Entire sections were then scraped by sterile scalpel blades from the slides into RNA extraction buffer (below) for analysis. The control samples therefore represent the transcriptional repertoire of entire females.Thawed cryo-sections were fixed immediately in 100% methanol for 30 seconds, stained with 1% Toluidine blue for 10 seconds, washed in diethylpyrocarbonate (DEPC)-treated water, 2×10 seconds, and allowed to dry for 20–30 min before microdissection. A PALM microbeam laser catapult microscope (P.A.L.M. Microlaser Technologies) was used to microdissect the gastrodermis from posterior regions of female worms, and the ovary and vitelline tissues from the stained frozen sections. An area of approximately 4 million squared µm kit using the manufacturer's instructions and quantified using a Nano-Drop ND-1000 spectrophotometer . The quality of total RNA was assessed using a Bioanalyser RNA Pico Lab Chip (Agilent) prior to storage at −80°C.S. japonicum and S. mansoni. The microarray consists of 19,222 target contiguous sequences (contigs) printed twice from two independent probe designs, and includes 12,166 probes derived from S. mansoni, and 7,056 probes derived from S. japonicum. An overview of the design and composition of the microarray is present in Full details of the design and construction of the schistosome microarray used have been reported 260 and A550 by spectrophotometry.A 300 ng aliquot of total RNA from each sample was converted into complementary RNA was synthesized and labeled with the fluorophore Cyanine 3-CTP (CY3c) and hybridized according to the manufacturer's instructions . Microarray hybridisations were performed in duplicate for all samples. The yield, concentration, amplification efficiency and abundance of CY3c were measured at AHybridized slides were scanned using an Agilent Microarray Scanner (B version) as tiff files and processed with the Feature Extraction 9.5.3.1 Image Analysis program (Agilent) to produce standardised data for statistical analysis. All microarray slides were assessed for background evenness by viewing the tiff image by Feature Extraction. Feature extracted data was analysed using GENESPRING .Absent when the processed signal intensity was less than two fold the value of the processed signal error value. Features were deemed Marginal when the measured intensity was at a saturated value or if there was a substantial amount of variation in the signal intensity within the pixels of a particular feature. Features that were not Absent or Marginal were deemed Present. Data points were included only if Present or Present, Absent and probes or contigs retained if all data points were Present or Present, Absent.Microarray data were normalised using a normalisation scenario for “Agilent FE one-color” which including “Data Transformation: Set measurements less than 5.0 to 5.0”, “Per Chip: Normalize to 50th percentile” and “Per Gene: Normalize to median”. Data sets were further analysed using published procedures based on one-colour experiments Microarray data have been submitted to the Gene Expression Omnibus public database, under accession numbers GPL7160 and GSE12706.http://www.blast2go.de on all contigs. This presented a further overview of the gene ontologies that are modulated between tissue types in adult female S. japonicum (S. japonicum lifecycle we used the software ErmineJ to produce extended list of GOs associated with each of the microdissected tissue types Batch BlastX (6 frame translation protein homology) was performed at aponicum . This inS. japonicum tissues and whole worm control tissue were chosen for validation of microarray data using real time PCR as described S. japonicum was used for normalisation of data from all experiments. Each experiment was performed in duplicate, and the confidence threshold (CT) of the second set was normalised to the first set before evaluation. This was done by importing the standard curve of the first set to that of the second using Rotor Gene 6 software A total of 9 gene sequences indentified as differentially expressed among the three We targeted three female tissues, namely, gastrodermis (absorptive gut lining) of the posterior halves of the worms, ovary, and the vitelline glands and 2. WIn view of the closely knit organization of schistosome tissues, it was important to know whether the three tissues under investigation represented homogenous cell populations. Ultrastructural assessment indicated that the ovary and gastrodermis were homogenous . We had For microarray analysis, unfixed frozen females were sectioned by cryostat onto membrane-coated slides, stained with toluidine blue and microdissected using a PALM laser catapult microscope . Total RPrincipal component analysis (PCA) is a multi-dimension reduction method that allows the visual presentation of a complex data set, so that distances between plotted points represents the relative similarity of each datasets. Usually plotted in an X,Y,Z formation, each axis represents a distinct subset of data points, or in the current application, gene lists. Gene expression profiles of the three microdissected tissues and the control sample were analysed by PCA . The poiComplete lists of genes enriched for each tissue sample after normalization, together with lists of selected genes of interest enriched for each tissue are presented . Major gNine transcripts that were enriched in one of the 3 tissues were selected for validation of expression level by real time PCR using cDNA templates from the microdissected and control samples . ExpressAfter filtering the microarray data and normalizing signal relative to female germinal tissues, we identified 214 probes representing 147 genes enriched for the gastrodermis . ComparaThe enriched genes of the gastrodermis relative to female germinal tissues included proteases of the haemoglobinolytic cascade, membrane-associated molecular transporters, actin and associated molecular motors. A highly enriched gene of the gastrodermis, represented by Contig5007, is a hitherto uncharacterized gene with uncertain sequence identity, but which contains motifs with similarity to the meprin family of metalloproteinases, and an erythrocyte-binding protein of malaria parasites. This molecule potentially represents a novel class of proteinases involved in haemoglobinolysis in these vascular parasites Additionally, transcripts encoding proteins previously localized to the outer tegumental surface of the parasite were enriched for the gastrodermis relative to other tissues. Although these molecules have been previously recognised as tegumentary components, their occurrence in the syncytial gastrodermis is not surprising. Transcripts for divalent metal transporters, particularly a member of the Zinc regulated transporter/iron regulated transporter family (ZIP) family were enriched for the gastrodermis. Schistosomes have high dietary requirements for iron Other transcripts enriched for the gastrodermis (relative to ovary and vitelline tissues) represent genes encoding lysosomal proteins, namely, cystinosin, lysosomal acid membrane glycoprotein (Lamp1/CD68), lysosomal alpha mannosidase and acid phosphatases , althougWe identified 6,645 probes representing 4,149 upregulated genes for the polycomb, enhancers of polycomb, and Peter pan homologues of vertebrates and ecdysozoans Polycomb genes, not previously recognized for platyhelminths, repress Hox expression in embryogenesis leading to cellular and zonal differentiation in embryos. Discovery of genes involved in embryonic differentiation will provide new insight into developmental cascades in the complex multi-generational schistosome life-cycle, leading in turn to a better understanding of differentiation of the intraovular embryo, the stage primarily responsible for pathogenesis in schistosomiasis.Genes enriched for the ovary (relative to the gastrodermis) included a number encoding proteins associated with cytokinesis, fertilization and coated pit-mediated endocytosis . OocytesExpression analysis of vitellaria revealedS. japonicum, alleviating the technology hurdles imposed by the acoelomate nature of this platyhelminth and expediting localization of multiple genes. Tissue-specific expression profiling has been performed previously for cavitate invertebrates, incorporating LMM or gross dissection methods S. japonicum genes, thereby providing a valuable molecular platform to shed light on the complex physiology and biochemistry of schistosomes, the pathogenesis of schistosomiasis, and to develop new treatments and effective interventions for its control.The integration of microarray analysis of LMM-dissected tissues has provided the means to establish a gene expression atlasing strategy for Figure S1Major Gene Ontologies of genes represented at greater than or equal to a 2 fold in (a) gastrodermis (b) ovary and (c) vitelline tissues. The number of probes in each gene ontology is noted.(9.80 MB TIF)Click here for additional data file.Figure S2Principal Component Analysis of the 7,623 flag filtered genes showing the gene expression profile of control, gastrodermis (gut), ovary and vitellaria of female S. japonicum.(0.08 MB TIF)Click here for additional data file.Table S1Complete lists of contiguous sequences listed in the custom designed schistosome microarray manufactured by Agilent Technologies used in this study. Column A (ProbeID): Unique identifier of probe on the microarray. Column B (Sequence): Nucleotide sequence of the 60mer probe. Column C (EST Sequence): Complete nucleotide sequence of the assembled EST contig. Column D (TargetID): Contig designation for either S. japonicum (Contig) or S. mansoni (TC). Column E (Accessions): Genbank accession number corresponding to the EST sequences. Column F (Description-Nucleotide): BLASTn annotation result based on nucleotide sequence. Column G (GeneSymbols): Designation of primary or secondary probe design to the corresponding contig. Column H (Protein Homology): BLASTX annotation result based on protein sequence. Column G (Gene Ontology): Gene Ontology number and description.(29.52 MB XLS)Click here for additional data file.Table S2Gene Ontology categories from 2 fold or higher differentially expressed gene detected in the three microdissected tissues.(0.04 MB XLS)Click here for additional data file.Table S3Primer Sets for real time PCR validation of a subset of genes that were upregulated in the three microdissected tissues examined.(0.02 MB XLS)Click here for additional data file.Table S4Complete list of differentially expressed genes, shown on separate sheets of an Microsoft Excel File. ALL DATA Sheet: Relative fold change of all contigs normalised to control. Fold change for gastrodermis is normalised to the signals from an average of ovary and vitelline and individually against the two germinal tissues. The fold change for vitellaria or ovary are normalised to the signal from gastrodermis. Legend: Systematic: Probe identifiers. A full list of probes is shown in (17.43 MB XLS)Click here for additional data file. |
Radiologic examination of the hands and abdomen revealed abnormal findings that gave a clue to the diagnosis.A 15-year-old girl was referred to our hospital because of lethargy, palpitation and headache. Physical examination revealed a girl with short stature, café-au-lait spots, and left thumb abnormality. The hematologic parameters of the patient included hemoglobin 5.5 g/dL, WBC 2.96×10What is the abnormal finding on this plain radiograph of the hands ?Figure What are the abnormal findings on this abdominal CT scan ?Figure What's your diagnosis?FOR THE ANSWER, VISIT:http://www.saudiannals.netThe abnormal finding in Fanconi anemia (FA) is an autosomal recessive disease, characterized by congenital abnormalities,23Congenital abnormalities include skin pigmentation and/or café au lait spots, short stature, malformation of the skeleton . Congenital malformations of the thumbs are variable and often bilateral.17The most important clinical features of Fanconi anemia are hematological. Fanconi anemia is the commonest type of inherited bone marrow failure syndrome and the incidences of aplastic anemia, myelodysplastic syndrome (MDS), and acute myeloid leukemia (AML).81011Allogeneic stem cell transplantation from an HLA-matched sibling donor is the only curative therapy, and mild conditioning regimes are used because of the sensitivity of patient's cell to DNA damage.1213 |
Papaver somniferum) produces a diverse array of bioactive benzylisoquinoline alkaloids and has emerged as a model system to study plant alkaloid metabolism. The plant is cultivated as the only commercial source of the narcotic analgesics morphine and codeine, but also produces many other alkaloids including the antimicrobial agent sanguinarine. Modulations in plant secondary metabolism as a result of environmental perturbations are often associated with the altered regulation of other metabolic pathways. As a key component of our functional genomics platform for opium poppy we have used proton nuclear magnetic resonance (1H NMR) metabolomics to investigate the interplay between primary and secondary metabolism in cultured opium poppy cells treated with a fungal elicitor.Opium poppy (Metabolite fingerprinting and compound-specific profiling showed the extensive reprogramming of primary metabolic pathways in association with the induction of alkaloid biosynthesis in response to elicitor treatment. Using Chenomx NMR Suite v. 4.6, a software package capable of identifying and quantifying individual compounds based on their respective signature spectra, the levels of 42 diverse metabolites were monitored over a 100-hour time course in control and elicitor-treated opium poppy cell cultures. Overall, detectable and dynamic changes in the metabolome of elicitor-treated cells, especially in cellular pools of carbohydrates, organic acids and non-protein amino acids were detected within 5 hours after elicitor treatment. The metabolome of control cultures also showed substantial modulations 80 hours after the start of the time course, particularly in the levels of amino acids and phospholipid pathway intermediates. Specific flux modulations were detected throughout primary metabolism, including glycolysis, the tricarboxylic acid cycle, nitrogen assimilation, phospholipid/fatty acid synthesis and the shikimate pathway, all of which generate secondary metabolic precursors.The response of cell cultures to elicitor treatment involves the extensive reprogramming of primary and secondary metabolism, and associated cofactor biosynthetic pathways. A high-resolution map of the extensive reprogramming of primary and secondary metabolism in elicitor-treated opium poppy cell cultures is provided. Papaver somniferum) is the world's oldest medicinal plant and produces several pharmaceutically important benzylisoquinoline alkaloids, including the analgesics morphine and codeine, the muscle relaxant and vasodilator papaverine, the antineoplastic drug noscapine and the antimicrobial agent sanguinarine. Benzylisoquinoline alkaloid biosynthesis in opium poppy begins with the condensation of dopamine and 4-hydroxyphenylacetaldehyde by norcoclaurine synthase (NCS) to yield (S)-norcoclaurine [S)-norcoclaurine to more than 80 benzylisoquinoline alkaloids in opium poppy have been isolated [Opium poppy [Catharanthus roseus leaves [Brassica rapa leaves [1H NMR). Although the use of 1H NMR for metabolite fingerprinting in the biomedical field is well established, reports of its application to plants are less extensive [Alterations in metabolite profile can be considered the ultimate cellular consequence of environmental perturbations. Together with other relatively unbiased and high-throughput technologies, metabolomics has facilitated an improved understanding of cellular responses to environmental change. Reports of metabolite profiling in the context of defence-related plant secondary metabolism, although rare, include the analysis of elicitor-treated (GC-MS) , caroten (GC-MS) , and stus leaves , caffeics leaves , and hyda leaves using prxtensive .We have previously used Fourier transform ion cyclotron resonance-mass spectrometry (FT-ICR-MS) to show that substantial modulations in the metabolome of elicitor-treated opium poppy cell cultures are accompanied by major alterations in the transcriptome . Althoug1H NMR to characterize the metabolome of elicitor-induced opium poppy cell cultures. We use a novel tool, Chenomx NMR Suite v. 4.6, to overcome many prior limitations in the analysis of 1H-NMR spectra [J-coupling information. This library was used to analyze the spectra of sample extracts and create mathematical models for detected metabolites in a cumulative manner. The chemometric strategies of principal component analysis (PCA) and orthogonal partial least-squares-discriminant analysis (OPLS-DA) were used to extract and display the systematic variation in the datasets. Our results show that the induction of secondary metabolism in response to elicitor treatment is accompanied by an extensive reprogramming of specific primary pathways.The advantages of nuclear magnetic resonance (NMR) spectroscopy over MS for metabolomics applications include the relative ease of sample preparation, non-destructive analysis, the potential to identify a broad range of compounds, an enhanced capacity for definitive compound identification, and the provision of structural information for unknown compounds ,15. Seve spectra . The sof2O by 1H NMR. Figure Aqueous extracts of control and elicitor-treated cell suspension cultures of opium poppy were analyzed in DThe PCA scores plot Figure shows raOrthogonal partial least-squares-discriminant analysis (OPLS-DA) was performed on three groups of time-points: 0–10 h, 20–50 h and 80–100 h. This algorithm reveals more subtle changes in the occurrence and concentration of specific metabolites by focusing on compounds responsible for the discrimination between two classes (i.e. control and elicitor-treated samples). Modulations in metabolite profile within these three time-point groups were predominantly responsible for the discrimination between control and elicitor-treated cell cultures according to the PCA Figure . OPLS-DAA customized opium poppy NMR spectral library was created to identify and quantify individual metabolites [see Additional file Eleven amino acids were detected in control and elicitor-treated samples. The levels of most amino acids increased between 50 and 100 h in control cultures, but remained low in elicitor-treated cells. The amino acids glutamine and glutamate, which are involved in nitrogen metabolism, were generally lower in elicitor-treated cells relative to controls at time points after 5 h. Asparagine is also involved in nitrogen metabolism and generally showed higher levels 5 h after elicitor treatment, but overall was higher in 100-h control extracts. Tyrosine, the precursor to benzylisoquinoline alkaloids, increased in abundance between 1 and 50 h in elicitor-treated cells compared with controls. Tyramine levels were lower in elicitor-treated cells between 5 and 30 h, but were higher at 80 and 100 h compared with controls. Phenylalanine also increased from 2–10 h post-elicitation, but the largest cellular pools were detected in control cultures at 80 and 100 h. Two non-protein amino acids, GABA and β-alanine, showed a rapid accumulation in elicitor-treated cultures. It is notable that β-alanine was the only metabolite absent in control cultures and induced by elicitor treatment. Coumarate, an intermediate in phenylpropanoid metabolism and a derivative of phenylalanine, initially accumulated in both control and elicitor-treated cells, but decreased in abundance from 50–100 h. The increase in benzoate levels was more pronounced in elicitor-treated cells, reached a maximum at 50 h and thereafter declined gradually.cis-aconitate pools were relatively similar and stable in control and elicitor-treated cells, but remained substantially higher in elicitor-treated cells at 80 and 100 h. Levels of 2-oxoglutarate gradually increased in both control and elicitor-treated cultures, but declined in elicitor-treated cells from 30–100 h. Succinate and fumarate levels were generally stable, but succinate pools were higher from 50–100 h in elicitor-treated cells. Oxaloacetate levels were lower in elicitor treated cells 5–80 h post-elicitation.Erythrose 4-phosphate (E4P) and phosphoenolpyruvate (PEP) are precursors to the shikimate pathway. The abundance of E4P reflected the modulation of cellular carbohydrate pools. An initial increase in E4P levels in both control and elicitor-treated cells was followed by a more rapid decline in elicitor-treated cultures. In contrast, PEP levels remained relatively stable, but spiked 20 and 30 h post-elicitation and at 100 h in control cultures. Most tricarboxylic acid (TCA) cycle intermediates could be identified. Citrate levels increased in elicitor-treated cells and were higher at all time points compared with controls. In contrast, O-Phosphocholine, choline and ethanolamine are involved in phospholipid metabolism, however only O-phosphocholine levels increased in elicitor-treated cultures. In contrast, choline and ethanolamine showed spikes only late in the control time course. The level of caprylate, which is involved in fatty acid biosynthesis, increased and was marginally higher in elicitor-treated cells between 2- and 50 h post-elicitation.1H NMR complements our previous attempt to deploy FT-ICR-MS to profile changes to the metabolome of opium poppy cell cultures in response to treatment with a fungal elicitor. Several interesting comparisons can be made. First, FT-ICR-MS provided quantitative information on 992 analytes, although only about 2% of these were identified based solely on comparison with available molecular mass data and corresponding molecular formulae [1H NMR metabolomics coupled with Chenomx NMR Suite. The identification of compounds based on 1H NMR spectra is more reliable than the use of molecular mass, which only provides a molecular and not a structural formula. Proton NMR also revealed abundant cellular metabolites that were not detected by FT-ICR-MS. Notable among these were several amino acids, none of which were found in the extensive molecular mass database used in our previous study [N-methylcoclaurine, N-methylstylopine, protopine, dihydrosanguinarine and sanguinarine were identified by FT-ICR-MS [2O. 1H NMR has proven effective and complementary to FT-ICR-MS for the compound-specific profiling of a plant cell metabolome.The application of formulae . In contus study . In contT-ICR-MS . HoweverThe components in the elicitor preparation responsible for inducing the defence response in opium poppy cell cultures are not known. However, it has been hypothesized that fungal cell wall glucans are involved. Although we cannot rule out the possibility that minor changes in the detected metabolite profiles resulted from degradation of compounds in the fungal hydrolysate, dynamic and substantial modulations in the levels of numerous metabolites strongly supports genuine and profound changes in the plant cell metabolome.1H NMR spectra from key time points showed that resonances in the spectral region corresponding to carbohydrates decreased substantially in the 30 and 100 h samples from elicitor-treated cells, compared with controls cycle. Glutamine and glutamate serve as nitrogen donors for the biosynthesis of compounds such as amino acids, nucleotides, chlorophylls, polyamines and alkaloids [Nitrogen assimilation in elicitor-treated opium poppy cell cultures has been reported to primarily involve NH4+ . In contlkaloids . The GS/lkaloids . Howeverlkaloids , and glulkaloids . Both aclkaloids .Pseudomonas syringae-infected tomato leaves, suggesting that asparagine, and not glutamine is primarily involved in the transport of nitrogen to healthy parts of the plant [The down-regulation of the GS/GOGAT cycle in elicitor-treated opium poppy cells raises the question: how is nitrogen assimilated and stored for the massive demands of alkaloid biosynthesis? In some species asparagine rather than glutamine is preferred for the transport and/or storage of nitrogen. In elicitor-treated opium poppy cells, asparagine increased in abundance later than most amino acids. The concentration of asparagine also increased in he plant .2 (PLA2) hydrolyzes phospholipids such as phosphatidylcholine (PC) into a lysophospholipid (lysoPC) and a fatty acid [2 activity was induced in Botrytis cinerea-infected tobacco leaves, compared with controls, but not in response to drought, wounding, reactive oxygen intermediates, salicylic acid or MeJA [2 induction is specifically associated with pathogen challenge and not to a general stress response. In parsley and tobacco cell cultures, PLA2 was also induced in response to elicitor treatment [O-phosphocholine increased in response to elicitor treatment. The first step in choline biosynthesis involves the decarboxylation of serine to ethanolamine [N-methyltransferases on free-bases [2, the relatively low abundance of cellular phosphocholine pools early in the time course might reflect increased flux through the phosphatidyl-base pathway to lysoPC, which has been implicated in pH signaling in elicitor-treated Eschscholzia californica cells [2 has also been reported to play an important role in the production of linolenic acid, the precursor to jasmonic acid (JA), in response to stress [Phospholipids play several roles in cellular function including signal transduction, membrane trafficking and cytoskeletal rearrangement, and have also been implicated in the hypersensitive response and systemic acquired resistance . Phosphotty acid . PLA2 ac or MeJA . This sureatment . In opiunolamine . Cholineee-bases , phosphoee-bases or phospee-bases . Since pee-bases , the subca cells . PLA2 hao stress . It is no stress . These dM. truncatula cell cultures [2+/calmoldulin [GABA is a ubiquitous non-protein amino acid synthesized from glutamate by glutamate decarboxylase (GAD) in a pathway known as the GABA shunt that bypasses several steps of the TCA cycle. GABA is converted to succinate semialdehyde by GABA transaminase and then oxidized to succinate by succinic semialdehyde dehydrogenase. In plants, GABA generally accumulates in response to biotic and abiotic stresses . GABA lecultures . In opiumoldulin ,38 cytopmoldulin and glutmoldulin . GABA acmoldulin . GABA anmoldulin . GABA comoldulin .M. truncatula cells [β-Alanine is a non-protein amino acid synthesized mainly by polyamine (i.e. spermine and spermidine) degradation and involved in coenzyme A (CoA) biosynthesis via pantothenate ,45, uracla cells . The indThe shikimate pathway begins with the condensation of E4P and PEP, and links carbohydrate metabolism with aromatic amino acids and derivatives in plants and microorganisms through the formation of chorismate . AlthougPAL) transcripts within 2 h post-elicitiation [Phytophtora megasperma [PAL and C4H transcript levels were induced in response to elicitor treatment, but returned to basal levels within 100 h [Musa acuminata roots in response to Fusarium oxisporum elicitors [Phenylpropanoids are induced in response to many stresses including UV, pathogen challenge, wounding, low temperature and nutrient deficiency . Levels itiation . Two pheitiation . BA was gasperma . BA and gasperma . For exagasperma and benzgasperma . Similarin 100 h . Three ain 100 h . Ferulatlicitors ; thus, BTyrosine and tyramine are precursors to both benzylisoquinoline alkaloid and hydroxycinnamic acid amide metabolism in opium poppy. Tyrosine/DOPA decarboxylase (TYDC), which converts tyrosine and DOPA to tyramine and dopamine, respectively, was rapidly induced upon elicitation . Tyramin1H NMR is a useful tool to characterize the metabolic response of plant cell cultures to environmental perturbations, such as elicitor treatment [1H NMR metabolomics and targeted profiling.Metabolite profiling by reatment ,9. An imThe metabolic demands of the defence response in elicitor-treated opium poppy cell cultures involves the coordinate transcriptional induction of key components of both primary and secondary pathways . Our resPapaver somniferum cv. Marianne) cell suspension cultures were maintained under fluorescent lights at 23°C on Gambourg 1B5C medium consisting of B5 salts and vitamins, 100 mg L-1 myo-inositol, 1 g L-1 hydrolyzed casein, 20 g L-1 sucrose, and 1 mg L-1, and 1 mg L-1 2,4-dichlorophenoxyacetic acid . Cells were sub-cultured every 6 d using a 1:3 dilution of inoculum to fresh medium. Fungal elicitors were prepared according to [2) of Botrytis cinerea mycelia grown on potato dextrose agar were used to inoculate 50 mL of 1B5C medium including supplements, but lacking 2,4-D. Mycelium cultures of B. cinerea were grown at 120 rpm on a gyratory shaker at 23°C in the dark for 6 d. Mycelia and medium were homogenized and autoclaved at 121°C for 20 min. One milliliter of the fungal homogenate was added to 50 mL of cultured cells in rapid growth phase (2–3 d after subculture). Cells were collected by vacuum filtration at different time points after elicitor treatment. Control cultures (i.e. not treated with the elicitor) were also collected at each time point. All samples were stored at -80°C until used.Opium poppy , and re-lyophilized. Samples were re-dissolved in D2O containing 100 mM KD2PO4, pH 7.000 ± 0.002, 10 mM NaN3, and 0.5 mM 2,2-dimethyl-2-silapentane-5-sulfonate (DSS) as an internal standard.Frozen cell culture tissue (0.75 g) was ground to a fine powder under liquid nitrogen with a mortar and pestle and extracted in three 10-mL aliquots of 80% (v/v) ethanol. Aliquots were pooled and centrifuged for 10 min to pellet cell debris. The supernatant was lyophilized in a vacuum centrifuge at ambient temperature, re-dissolved in 5 mL H1H NMR spectra were acquired using the standard Bruker noesypr1d pulse sequence in which the residual water peak was irradiated during the relaxation delay of 1.0 s and during the mixing time of 100 ms. All experiments were performed on a Bruker Advance 600 spectrometer operating at 600.22 MHz and equipped with a 5 mm TXI probe at 298°K. A total of 256 scans were collected into 65,536 data points over a spectral width of 12,195 Hz, with a 5 s repetition time. A line broadening of 0.5 Hz was applied to the spectra prior to Fourier transformation, phasing and baseline correction. Additional NMR experiments performed to confirm chemical shift assignments included total correlation spectroscopy (TOCSY) and heteronuclear single quantum coherence spectroscopy (HSQC), using standard Bruker pulse programs.1H NMR spectra were compared against a library containing 212 plant-specific compounds. This library contains the unique 1H NMR spectra of each standard compound recorded at 600 MHz quantified by the addition of a known amount of DSS, which also served as a chemical shift indicator. For the purposes of this study, one-dimensional 1H NMR signatures corresponding to selected compounds not present in the standard Chenomx library, including those of several benzylisoquinoline alkaloids, were used to create a custom opium poppy database [see Additional file pareto scaled to minimize the influence of baseline deviations and noise. For OPLS-DA, class difference (e.g. control versus elicitor-treated) was the Y-matrix. The quality of each model was determined by the goodness of fit parameter (R2) and the goodness of prediction parameter based on the fraction correctly predicted in a 1/7 cross-validation (Q2).Identification and quantification of individual metabolites was performed using the Profiler module of the Chenomx NMR Suite v.4.6 . 1H NMR, proton-nuclear magnetic resonance mass spectroscopy; OPLS-DA, orthogonal partial least-squares-discriminant analysis; PCA, principal component analysis.DSS, 2,2-dimethyl-2-silapentane-5-sulfonate; FT-ICR-MS, Fourier transform ion cylotron resonance-mass spectrometry; KZ conceived the experimental design, performed the sample preparation and data analysis, and wrote the first draft of the manuscript. AW supervised and assisted with the bioinformatics and statistical analyses. HV supervised the NMR spectroscopy. PF conceived of the study, prepared the figures and finalized the manuscript.Bin numbers used in PCA and OPLS-DA, the regions of the spectra they represent and compounds present within those regions. Variable importance numbers pertain only to OPLS-DA and larger numbers indicate a greater contribution of that bin to observed variance between control and elicited cells.Click here for file1H NMR signatures are available in a Chenomx NMR Suite compound database customized for opium poppy. An asterisk denotes a metabolite not present in the standard Chenomx library, but added to the customized database.List of metabolites for which one-dimensional Click here for file |
Autotaxin (ATX) is an extracellular lysophospholipase D that generates lysophosphatidic acid (LPA) from lysophosphatidylcholine (LPC). Both ATX and LPA have been shown to be involved in many cancers. However, the functional role of ATX and the regulation of ATX expression in human hepatocellular carcinoma (HCC) remain elusive.In this study, ATX expression was evaluated in tissues from 38 human HCC and 10 normal control subjects. ATX was detected mainly in tumor cells within tissue sections and its over-expression in HCC was specifically correlated with inflammation and liver cirrhosis. In addition, ATX expression was examined in normal human hepatocytes and liver cancer cell lines. Hepatoma Hep3B and Huh7 cells displayed stronger ATX expression than hepatoblastoma HepG2 cells and normal hepatocytes did. Proinflammtory cytokine tumor necrosis factor alpha (TNF-α) promoted ATX expression and secretion selectively in Hep3B and Huh7 cells, which led to a corresponding increase in lysophospholipase-D activity. Moreover, we explored the mechanism governing the expression of ATX in hepatoma cells and established a critical role of nuclear factor-kappa B (NF-κB) in basal and TNF-α induced ATX expression. Further study showed that secreted enzymatically active ATX stimulated Hep3B cell invasion.This report highlights for the first time the clinical and biological evidence for the involvement of ATX in human HCC. Our observation that links the TNF-α/NF-κB axis and the ATX-LPA signaling pathway suggests that ATX is likely playing an important role in inflammation related liver tumorigenesis. Hepatocellular carcinoma/cancer (HCC) is one of the most common malignant tumors worldwide . It mostPrevious microarray analysis from our laboratory identified autotaxin (ATX) as one a gene with enhanced mRNA expression in human hepatitis associated HCC . ReportsLPA is an important lipid mediator that elicits a broad spectrum of biological effects by activating G protein-coupled receptors (GPCRs). The biological functions of LPA included, but not limited to cell proliferation, migration, platelet aggregation, smooth muscle contraction, and cytoskeletal reorganization. In the context of cancer, LPA could induce stress fiber formation, membrane ruffling, and lamellipodia formation -17. The We have previously examined ATX mRNA expression in human HCC tissues . Here weP = 0.0053). A statistical difference in expression of the ATX protein between HCC associated with an inflammatory background and those without inflammatory changes in the adjacent liver was also evident (P = 0.0003). In addition, HCC without cirrhosis displayed lower level of ATX expression than those with cirrhosis (P = 0.00031). These data have not only confirmed our previous observation at the protein level, but also revealed its association with inflammation, which support the potential role of ATX in the pathogenesis of human HCC.Table To gain a better insight into the expression and function of ATX in HCC, we examined the expression of ATX in three human liver cancer cell lines , a human normal embryonic liver cell line CL-48, and human normal primary hepatocytes. As shown in Figure The expression of ATX is regulated by growth factors and cytokines. For example, FGF and EGF have been shown to induce ATX expression, whereas certain cytokines such as interleukin-1 (IL-1), IL-4 and interferon-gamma (IFN-γ) decrease the expression of ATX mRNA in cultured fibroblast-like synoviocytes (SFC) . InflammP < 0.01, Figure P < 0.05). In parallel, more LPC was hydrolyzed in TNF-α treated group than control group (data not shown). A similar effect was observed in Huh7 cells, where TNF-α treatment induced an approximately 1.8-fold increase of LPA generation , albeit the absolute LPA levels were lower , suggesting an autocrine action. Specifically knockdown of ATX in Hep3B cells resulted in significantly reduced chemotactic potential of the conditioned medium from Hep3B cells. To further elucidate whether ATX-LPA linked to the invasion of Hep3B cells, we evaluated Hep3B cell invasion in the presence and absence of exogenous LPC (18:1). We found that addition of LPC (1 μM) to EMEM/BSA did not induce invasion of Hep3B cells. However, addition of LPC to Hep3B conditioned medium resulted in a 1.8-fold greater rate of invasion above the vehicle control . In addition, it was noted that the presence of LPC in conditioned medium from ATX siRNA-transfected Hep3B cells failed to induce Hep3B cells invasion. These data suggest that LPC itself is not a chemoattractant, and an ATX-dependent action is required for the activity. To directly test whether LPA is the molecule that involved in the invasion process, we tested the effect of LPA on cell invasion in Hep3B cells. LPA was found to dose-dependently induced the invasion of Hep3B cells, which peaked at 5 μmol/L . Two highly conservative consensus sequences for NF-κB binding sites were identified in ATX promoter region 2000 nt upstream of the transcription start site from 9 eutherian mammals , inter-cellular adhesion molecule (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1) and growth factors in endothelial cells -33. In aChronic inflammation has long been associated with the development of liver cancer. Three lines of evidence obtained from the current study support a link between ATX expression/function to inflammation in liver diseases. First, our immunohistochemistry data from human liver tissue showed the differential expression of ATX in HCC with different etiologies. Hepatitis literally means inflammation of the liver, and is the major cause of HCC. ATX expression in hepatitis-related HCC tissues is significantly elevated compared to those HCC tissues developed from non-cirrhotic "non-inflammatory" background which indeed show no signs inflammatory cell infiltration as we observed in the samples from patients with chronic active hepatitis or steatohepatitis. Secondly, the ATX expression levels correlated well to the derivative origins in HCC cell lines related to inflammation. Hep3B cells were derived from a patient with hepatitis and therefore may have unique response systems that are associated with the inflammatory background of a hepatitis infected liver . Rice laTaken together, we have shown for the first time the clinical and biological significance of ATX in human HCC. We have also demonstrated for the first time a novel regulation mechanism of ATX expression in human liver cancer cells. The connection between TNF-α/NF-κB pathway and ATX signaling provides new insight into the molecular pathways involved in HCC pathogenesis and indicates that ATX may play a potential role in the connection between inflammation and tumorigenesis in the complex liver microenvironment. Whether this influences initiation, promotion, or metastatic potential remains to be further studied. Since inflammation is the most potent risk factor for human HCC, these findings are highly significant for this research field.TNF-α, parthenolide and fatty acid-free BSA were purchased from Sigma . LPC (1-oleoyl) was obtained from Avanti Polar Lipids, Inc. . ATX activity assay reagents were from Echelon Biosciences, Inc. . Purified recombinant ATX protein and rabbit polyclonal antibody against ATX and were generous gifts from Dr. Timothy Clair ; the polyclonal antibody against ATX was prepared by immunization of rabbits with the peptide ARVRDIEHLTSLDFFRK.This study was approved by Indiana University Institutional Review Board. Liver tumor tissue was collected from patients undergoing resections for HCC at Indiana University Hospital. Normal tissue (n = 10) was obtained from patients undergoing non-liver disease related surgeries. The fresh tissue was formalin fixed, and paraffin embedded for immunohistochemistry. Thirty-eight HCC cases were applied for this study. Eleven of them had HCV infection, seven had HBV infection and ten had non-alcohol steatohepatitis (NASH), as confirmed by serological testing or PCR testing of benign or tumor DNA. Another ten cases of HCC samples were observed in non-cirrhotic liver and they developed in an otherwise normal liver and without identified risk factors. No pathological evidence of inflammatory infiltrates within the background liver was identified, and here they are named as normal-HCC.CL-48, HepG2 and Hep3B cell lines were obtained from American Tissue Culture Collection and were cultured in Eagle's Minimum Essential Medium (EMEM) with 10% fetal bovine serum at 37°C, 5% CO2. Huh7 cell line was a generous gift provided by Dr. Charles M. Rice's lab and was cultured in Dulbecco's Modified Eagle's Medium (DMEM) with 10% fetal bovine serum at 37°C, 5% CO2. Human normal primary hepatocytes were purchased from Lonza and maintained in hepatocyte culture medium . Cells were serum-starved overnight and then treated with TNF-α (10 ng/ml) or parthenolide in serum free media containing 0.1% BSA. Total RNA was extracted or cell lysate was prepared after stimulation for the indicated time.Small interfering RNA (siRNA) duplexe targeting human ATX and negative control siRNA were purchased from Ambion . Cells were cultured to 60-70% confluency and then transfected with 10 nM of ATX siRNA or 30 nM negative siRNA using Transfection siPORT™ NeoFX™ kit (Ambion) according to the manufacturer's recommendations. Transfected cells were incubated at 37°C and 5% CO2 for 68-72 hours. Cells were harvested for total RNA or protein preparation and conditioned media were collected for invasion assay.Conditioned media were prepared by incubating 70% confluent cells in 100 mm dishes for 24 hours in serum-free MEM or DMEM containing 0.1% fatty acid-free BSA. Conditioned media were harvested, clarified by centrifugation, and filtered through a 0.22 μm filter. The conditioned media were concentrated by Amicon Ultra-15 Centrifugal Filter Units before using for immunoblot. At the same time, total cell extracts were prepared from cell monolayer incubated in RIPA buffer , 2 mM phenylmethylsulfonylfluoride (PMSF) and protease inhibitor cocktail. Fifteen micrograms of total cellular protein was resolved by SDS-PAGE. Blots were probed with appropriate antibodies. Anti-β-actin was used for loading control.Total RNA was isolated from cells using the RNeasy kit following the manufacturer's instructions . 2 μg total RNA was reverse-transcribed in a total reaction volume of 20 μl using the high capacity cDNA reverse transcriptase kit as described by the manufacturer. Single stranded cDNA products were then analyzed by real-time PCR using standard commercially available TaqMAN probes for ATX (Hs00196470_m1). The amount of target gene was normalized to the internal standard 18S rRNA (Hs99999901_s1) levels and reported as a relative value.The conditioned serum-free medium from Hep3B and Huh7 cells with or without TNF-α stimulation was concentrated (40-fold) using Amicon Ultra 50,000 (Millipore). EMEM and DMEM without cells were used as control. ATX/lyso-PLD activity in concentrated conditioned media was analyzed using fluorogenic substrate FS-3 according to the manufacture protocol. Briefly, 10 ul concentrated medium was mixed with 5 uM FS-3 and assayed in 96-well plate. The change of fluorescent intensity was measured by SpectraMax Gemini EM Fluorescence Microplate Reader with excitation and emission wavelengths of 485 and 528 nm, respectively.Lipids were extracted from conditioned media and analyzed using LC-MS ,50. Brie4 cells were added to the top insert, and 750 μl of conditioned medium with or without 1 μM LPC (18:1) was added to the bottom chamber. To determine the effect of LPA on the invasion, serum-free MEM containing 0.1% fatty acid-free BSA with or without LPA were added to the bottom chamber. After 24 hours incubation at 37°C in a CO2 incubator, non-invaded cells were removed from the upper surface of the filter with the cotton swab; cells that migrated through the gel insert to the lower surface of the membrane were fixed with 100% methanol, stained with 1% Toluidine blue and counted using a light microscope at 50 × magnification. Each sample was tested in triplicate at least in two independent assays. Results were expressed as mean cell number per field ± SD.According to previously described methods , invasioSerial 5-micron thick sections of formalin-fixed paraffin embedded tissue were cleared with xylene and rehydrated through graded ethanol and finally immersion in distilled water. Slides were then rinsed in Tris-buffered saline (TBS). Antigen retrieval was performed by using the Dako Target Retrieval kit containing a citrate buffer (pH 6.0) for 10 min at 95°C. Dako's Avidin Biotin blocking system was used for 10 min, and the tissue sections were then rinsed with TBS. The nonspecific binding sites were blocked by incubating with Dako's Protein Block for 10 min. Tissue sections were then incubated with the polyclonal rabbit antibody against ATX (7.8 μg/ml) overnight at 4°C. After washing with TBS, the secondary antibody, Dako Link (Dako LSAB2 kit) was applied for 20 min and then rinsed with TBS. Additional washing was followed by incubation with streptavidin horseradish peroxidase for 20 min. Immunoreactivity was visualized by incubation of sections with 3, 3'-diaminobenzidine in the presence of hydrogen peroxide. Sections were counterstained with light hematoxylin and mounted with a coverslip. All of the procedures were performed at room temperature except the primary antibody incubation. Microscopic fields evaluated and scored were those with the highest degree of immunoreactivity ("hot spots"). Five fields (40 × fields) per section were analyzed. An intensity score was assigned to each case on a scale from negative to high .Data are presented as means ± SD. Analysis of the significance of differences between two groups was performed by two tailed student's t-test using Instat software . P-values of < 0.05 were considered statistically significant. Fisher's exact test was used for the ATX immunoreactivity analysis, and P value < 0.05 was deemed significant.The authors declare that they have no competing interests.MAM supervised and coordinated the study and revised the manuscript. JMW designed the study, performed all the experiments, analyzed the data and prepared the manuscript. YX revised the manuscript and contributed to the LC-MS assay. ZZ performed the LC-MS assay. JS and HS reviewed the manuscript. RS contributed to human tissue acquisition, specimen pathology reviewing and immunohistochemistry data analysis. MY performed the statistic analysis of immunohistochemistry data. All authors read and approved the final manuscript. |
Prioritising control measures for occupationally related cancers should be evidence based. We estimated the current burden of cancer in Britain attributable to past occupational exposures for International Agency for Research on Cancer (IARC) group 1 (established) and 2A (probable) carcinogens.We calculated attributable fractions and numbers for cancer mortality and incidence using risk estimates from the literature and national data sources to estimate proportions exposed.5.3% (8019) cancer deaths were attributable to occupation in 2005 ; women, 2.3% (1657)). Attributable incidence estimates are 13 679 (4.0%) cancer registrations ; women, 3616 (2.2%)). Occupational attributable fractions are over 2% for mesothelioma, sinonasal, lung, nasopharynx, breast, non-melanoma skin cancer, bladder, oesophagus, soft tissue sarcoma, larynx and stomach cancers. Asbestos, shift work, mineral oils, solar radiation, silica, diesel engine exhaust, coal tars and pitches, occupation as a painter or welder, dioxins, environmental tobacco smoke, radon, tetrachloroethylene, arsenic and strong inorganic mists each contribute 100 or more registrations. Industries and occupations with high cancer registrations include construction, metal working, personal and household services, mining, land transport, printing/publishing, retail/hotels/restaurants, public administration/defence, farming and several manufacturing sectors. 56% of cancer registrations in men are attributable to work in the construction industry and 54% of cancer registrations in women are attributable to shift work (breast cancer).This project is the first to quantify in detail the burden of cancer and mortality due to occupation specifically for Britain. It highlights the impact of occupational exposures, together with the occupational circumstances and industrial areas where exposures to carcinogenic agents occurred in the past, on population cancer morbidity and mortality; this can be compared with the impact of other causes of cancer. Risk reduction strategies should focus on those workplaces where such exposures are still occurring. For substances that are already established as human carcinogens, for example using the International Agency for Research on Cancer (IARC) classification, estimation of attributable burden provides useful indicators of the contribution of different risk factors and has become widely used in public health research is widely used, for example, in the estimation of global burden of disease . We idenPreliminary results for six cancer sites, showing the developing methodology have been previously published . There are several methods for estimating the AF but all depend on knowledge of the disease risk due to the exposure of interest and the proportion of the target population exposed .Risk estimates were obtained from key studies, meta-analyses or pooled studies, taking into account quality . Where possible we selected risk estimates adjusted for important confounders or non-occupational risk factors, for example, smoking for lung cancer, smoking and alcohol use for laryngeal cancer. Where only a narrative review was available giving a range of risk estimates, we calculated a combined estimate of the relative risks (RRs) based on a random-effects (for heterogeneous RRs) or fixed-effects (for homogeneous RRs) model. Formal systematic reviews and meta-analyses were carried out to estimate risk estimates for laryngeal and stomach cancers related to asbestos exposure.Dose–response risk estimates were generally not available in the epidemiological literature nor were proportions of those exposed at different levels of exposure over time available for the working population in Britain. However, where possible risk estimates were obtained for an overall ‘lower’ level and an overall ‘higher’ level of exposure to the agents of concern. The risk estimates for occupational exposure to ionising radiation were derived using generalised linear dose–response models of excess RR per unit of cumulative radiation dose from the United Nations Scientific Committee on the Effects of Atomic Radiation . Cumulative lifetime dose was estimated using data from the Central Index of Dose Information (CIDI) . For airA substantial proportion of the excess is likely to occur in the large number of workers with low exposures for whom our estimates of average risks are inevitably unreliable. Where no risk estimate could be identified for very low or background levels of exposure, we estimated an RR for the ‘lower exposed’ group by (1) taking the harmonic mean of all the available ratios of ‘higher’ to ‘lower’ RR estimates for cancer-exposure pairs for which data were available and (2) applying this average ratio to the ‘higher’ level estimates to obtain ‘lower’ level RR estimates; if this was less than one, it was set to one. We defined the period during which the relevant exposure for the cancer in the target year 2005 as the risk exposure period (REP). For solid tumours, a latency of 10–50 years was assumed giving an REP of 1956–1995; for haematopoietic neoplasms, 0–20 year's latency was assumed giving an REP of 1986–2005. The proportion of the population ever exposed to each carcinogenic agent or occupation in the REP was obtained from the ratio of the numbers ever exposed to the carcinogens of interest in each relevant industry or occupation within Britain over the total number of people ever employed database and the CAREX data for Britain relate only to the period 1990–1993. For the LFS and CoE, an available year was chosen to represent numbers employed about 35 years before the target year of 2005, as this was thought to represent a ‘peak’ latency for the solid tumours, and is also close to the mid-point of the REP for estimating numbers ever exposed across the period (for which a linear change in employment levels was implicitly assumed). Where the Census of Employment was used, the data are for 1971. Where the LFS was used, the first year available and therefore used was 1979 for solid tumours, and 1991 for short latency cancers. When CAREX data were used, adjustment factors were applied to take account of the change in numbers employed in the primary and manufacturing industry and service sectors in Britain over the REP. Adjustment for employment turnover over the period for grouped main industry sectors was also carried out see . As expoTo estimate the AFs for each cancer and occupational carcinogen, we used Levin's method if risk estimates came from an industry-based study, a review or meta-analysis, together with estimates of the proportion of the population exposed from independent national sources of data . MiettinThe AF for mesothelioma was derived directly from several UK mesothelioma studies that suggest 96–98% of male mesothelioma cases are due to occupational or paraoccupational exposure were appAFs for all the relevant carcinogenic agents and occupational circumstances were combined into a single estimate of AF for each separate cancer. To take account of potential multiple exposures, we used strategies including partitioning exposed numbers between overlapping exposures or estimating only for the ‘dominant’ carcinogen with the highest risk. The IARC Monograph process has been taking place over many years and has resulted in overlap between substances evaluated. For lung cancer, for example, 32 occupations or carcinogenic agents are evaluated. We estimated AFs for 21 of these; for example, substances such as coal tars and pitches and processes such as coal gasification and coke production were included within our evaluation of polycyclic aromatic hydrocarbons (PAHs). Where exposure to multiple carcinogens remained, it was assumed that the exposures were independent of one another and that their joint carcinogenic effects were multiplicative. The AFs were then combined to give an overall AF for that cancer using a product sum (n=6362) of cancer deaths in 2005 in men and 2.3% (n=1657) in women in Britain have been estimated to be due to occupation giving an overall AF of 5.3% (n=8019). The combined AFs for registrations are 5.7% (n=10 063) for men in 2004 and 2.2% (n=3616) for women giving an overall AF based on registrations of 4.0% (n=13 679). These are lower than for deaths because of the large numbers of non-melanoma skin cancer (NMSC). The results for four of the cancers, bladder, leukaemia, NMSC and sinonasal, are lower than previously estimated is given in stimated . Only niThe AFs by cancer site range from less than 0.01–95% overall, the most important cancer sites for occupational attribution being, for men, mesothelioma (97%), sinonasal (46%), lung (21.1%), bladder (7.1%) and NMSC (7.1%), and for women, mesothelioma (83%), sinonasal (20.1%), lung (5.3%), breast (4.6%) and nasopharynx (2.5%). Occupation also contributes 2% or more overall to cancers of the larynx, oesophagus, soft tissue sarcoma (STS) and stomach, with in addition for men melanoma of the eye (due to welding) and non-Hodgkin's lymphoma (NHL).Our study has quantified for the first time the impact of occupation on the burden of cancer in Britain for all 24 cancer sites and the carcinogens that IARC have classified as having sufficient (group 1) or limited (group 2A) evidence in humans. Unlike other estimates of cancer burden, we have also evaluated the impact within different industry sectors, so facilitating prioritisation and implementation of preventive action. Our results are greater than other estimates for some cancer sites, partly due to differences in the numbers of cancers and carcinogens considered. For example, the global estimate of occupational cancer (μg m−3), with the lowest levels (EC<25 μg m−3) reported for enclosed areas separated from the source, such as drivers, train crew, parking attendants, vehicle testers and utility service workers.Diesel engines have a wide range of industrial applications including on-road equipment (most heavy and medium duty trucks and buses use diesel engines), and off-road applications in the mining, rail, construction, distribution and farming industries and in the military, including the use of diesel-powered heavy equipment, locomotives, forklift trucks, ships, tractors and generators. In a recent review, the highest levels of elemental carbon (EC) were reported for enclosed underground work sites in mining and construction . Mortality from NMSC is low but there may be appreciable morbidity from disfigurement as the lesions tend to be on the head and neck; their high prevalence represents a considerable health service burden (The ANs and AFs presented in this paper provide a basis on which to inform prioritisation of future effort both for health and safety strategic planning and for research to fill information gaps. Reduction and removal of these carcinogens might be expected to increase average life expectancy. Other measures such as years of life lost and disability-adjusted life years will be estimated as part of our on-going study.In summary, this project is the first to quantify in detail the burden of cancer due to occupation specifically for Britain. It highlights the impact of such exposures on cancer morbidity and mortality, together with the occupational circumstances and industrial areas where exposures to these agents occurred in the past; this can be compared with the impact of other causes of cancer. Risk reduction strategies should focus on those workplaces where such exposures are still occurring. |
Bacterial biofilm is ubiquitous in nature. However, it is not clear how this crowded habitat would impact the evolution of bacteriophage (phage) life history traits. In this study, we constructed isogenic λ phage strains that only differed in their adsorption rates, because of the presence/absence of extra side tail fibers or improved tail fiber J, and maker states. The high cell density and viscosity of the biofilm environment was approximated by the standard double-layer agar plate. The phage infection cycle in the biofilm environment was decomposed into three stages: settlement on to the biofilm surface, production of phage progeny inside the biofilm, and emigration of phage progeny out of the current focus of infection.stf gene, with the majority of them being single-nucleotide insertion/deletion mutations occurring in regions with homonucleotide runs.We found that in all cases high adsorption rate is beneficial for phage settlement, but detrimental to phage production (in terms of plaque size and productivity) and emigration out of the current plaque. Overall, the advantage of high adsorption accrued during settlement is more than offset by the disadvantages experienced during the production and emigration stages. The advantage of low adsorption rate was further demonstrated by the rapid emergence of low-adsorption mutant from a high-adsorption phage strain with the side tail fibers. DNA sequencing showed that 19 out of the 21 independent mutant clones have mutations in the stf gene would ensure the existence of side tail fiber polymorphism, thus contributing to rapid adaptation of the phage population between diametrically different habitats of benthic biofilm and planktonic liquid culture. Such adaptability would also help to explain the maintenance of the stf gene in phage λ's genome.We conclude that high mutation rate of the The bacterial biofilm is a dynamic, surface-associated structure often consisted of many different species of bacterial populations embedded in an exopolysaccharide matrix secreted by the bacteria. For many bacterial species, existence in the benthic habitat of the biofilm is an integral part of their life cycles ,2. The b5 to 108 cfu/cm2, with thickness at the tens to hundreds of μm range [9 cfu/mL, a much higher concentration than commonly encountered in the planktonic state . In fact, one characteristic of the biofilm is the high cell density [It is generally believed that biofilms structures are resistant to many stresses, including bacteriophage (phage) infections ,4. Howevi.e., the homogeneously mixed liquid culture), it is not clear if these general conclusions can also be extended to the condition with densely populated bacterial cells embedded in the biofilm matrix. However, we can imagine that the success of a phage in a biofilm condition would probably depend on its ability to competitively complete the aforementioned stages of settlement-production-emigration.For the few studies focusing on the effect of host density on the evolution of phage life history traits ,12, the In this study, we used the agar-entrapped bacterial cells and the agar matrix as a simulacrum for the e.g., the top agar gel, two types of high-adsorption (HA) λ strains were constructed: (1) the HA-Stf (with the genotype of stf+), which carries the side tail fibers, and (2) the HA-J1077-1 (with the genotype J1077-1), a host range mutant carrying a modified tail fiber protein J [-8, 1.85 ± 0.63 × 10-9, and 7.44 ± 5.47 × 10-11 phage-1cell-1mL-1min-1 for HA-Stf, HA-J1077-1, and LA-wt, respectively. However, it is to be noted that these adsorption rates were estimated using cells in stationary phase, not the customary exponential phase, and without the addition of Mg2+. It has been shown that phages adsorb much less readily under the condition used in this study [1077-1 >> LA-wt.To assess the impact of phage adsorption rate on the settlement, production, and emigration stages of the phage life cycle in a biofilm-like environment, rotein J . As showtructed: the HA-Sis study . NeverthlacZα+, generating blue plaque, and lacZα-, generating clear "white" plaque) were also engineered into the genomes of the above phage strains by fusing the α-fragment, encoded by E. coli's lacZ gene, with the phage's endolysin protein R (encoded by the R gene) [27 = 19.19, p = 0.0018). That is, under our assay condition, there is a slight, but significant cost associated with the blue marker. To minimize the marker effect, all the results described below were conducted with both marker states .Two isogenic markers ( R gene) . In liqu R gene) . HoweverPost hoc unplanned comparisons among means using the Tukey-Kramer HSD test showed that, irrespective of the top-agar concentrations, the ranking of settlement rates is HA-J1077-1 > HA-Stf > LA-wt. As would be expected, the settlement rate was also influenced by the top-agar concentrations. Again, unplanned comparisons among means showed that the settlement rates are significantly different between 0.27% and 0.8%, but not between other comparisons.In a well-mixed liquid culture, all else being equal, the phage with the higher adsorption rate would, on average, have a shorter time adsorbing onto a susceptible host, thus resulting in a shorter generation time and a higher growth rate (fitness) ,13. Ther1077-1 strain, while having the intermediate adsorption rate, has the highest settlement rate. Nevertheless, we still observe the expected positive correlation between the adsorption rate and the settlement rate when comparing between the LA and HA phages. It is only by comparing between HA-Stf and HA-J1077-1 did we witness the contrary to our expectation. One possible explanation may lie in the somewhat different morphology of these phage strains. HA-Stf's extra side tail fibers, extending out from the phage virion, would make it bulkier than the other two strains, which are expected to have the same shape. The extra hydrodynamic volume, while inconsequential when in liquid culture, could impede HA-Stf's ability to efficiently diffuse into the biofilm matrix to gain access to the embedded cells. Overall, our results showed that, all else being equal, high adsorption rate would also result in high settlement rate. But the morphology of phage virion could also be expected to exert its effect in the biofilm-like environment.Interestingly, our result seems to suggest the existence of an optimal adsorption rate for phage settlement. We found that the HA-JOnce the infection plaque was formed, two factors may affect the phage progeny's prospect of migrating out of the current plaque: (1) the size of the plaque and (2) the productivity of the plaque. All else being equal, we assume that a larger plaque size would provide a larger surface area for the phage progeny to migrate out of the current plaque. The same rationale also applies to plaque productivity.F = 26.09, p < 0.0001). Furthermore, unplanned comparisons among means showed that the ranking of the plaque size is LA-wt > HA-J1077-1 (2.02 ± 0.339 mm2) ≈ HA-Stf (1.73 ± 0.339 mm2).We determined the plaque size for each phage strain. As the analysis showed, the phage strain has a significant effect on the plaque size . Interestingly, depending on whether the phage strain has side tail fibers or not, the top agar concentration has a differential effect on plaque productivity. For the LA-wt and the HA-J1077-1 strains (both without side tail fibers), the plaque productivity is not significantly affected by the top agar concentration, while for the HA-Stf strain it is negatively correlated with the top agar concentration . Again, unplanned comparisons among means showed that the HA-Stf productivities are significantly different between the 0.8% and 0.27% top agar concentrations (about 6.5-fold), but not between the other comparisons.We also determined the plaque productivity for each phage strain under different top-agar concentrations Figure . Unplann1077-1), except when the top agar concentration is 0.8%, in which case the HA-J1077-1's emigration rate is significantly higher than that of the HA-Stf.Once the progeny phages have emerged from the current plaque, they would need to diffuse out of the confine of the plaque in order to start new infections. We hypothesized that, all else being equal, more high-adsorption phages would be found associated with the host cells and cell debris, rather than being free-floating in the biofilm matrix, thus contributing to their reduced chance of diffusing out of the plaque. To test such a possibility, we determined the emigration rates of all three phage strains under different top agar concentrations. In this case, the emigration rate is defined as the proportion of plaque-embedded phage progeny that have successfully diffused out of the top agar gel within a prescribed 30 min period. The results are shown in Figure 1077-1 and LA-wt), while the differences in the determined emigration rate is between eight- to thirteen-fold (mainly between HA-Stf and LA-wt) , the phage strains are easily distinguishable by the chromogenic reaction on the agar plate. Progeny phages emerged from the resulting plaques were allowed to diffuse out of the plaques into the liquid medium to simulate the spread of emerging phages via carrier liquid phase. Figure 1077-1 phage, the relative frequency of the LA-wt phage increased from the initial 10% to >98% after just a single production-emigration event. Interestingly, the LA-wt phage's advantage over HA-J1077-1 is similar across all three top agar concentrations Figure .1077-1 phages, it is striking to observe that, even after several rounds of serial production-emigration experiments, the LA-wt phage's relative frequency was persistently maintained at 74-90% in the presence of HA-Stf , λ outer membrane (lom), side tail fiber , and tail fiber assembly (tfa) were sequenced. The results are shown in Figure stf gene. Curiously, no mutation was found in the sequenced region in the remaining two isolates. Out of these 19 isolates, 15 carry a frameshift and 4 missense mutations. Interestingly, all the missense mutations were found clustered at the 5' end of the gene while the frameshift mutations were distributed throughout the rest of the gene, but unevenly and two insertions at the next position, 21573 . Closer inspection of the gene sequences showed that, with one exception (GP20), all the insertion/deletion mutations occurred in regions with short homonucleotide runs in the sequence. It has been long known that, possibly due to slippage of DNA polymerase during DNA replication [To find out the genetic basis for the observed large plaque morphology, 21 independent GP mutants were isolated and genes involved in tail fiber the biofilm matrix and adsorb onto the bacterial cells embedded inside it. That is, besides the adsorption rate, the virion size (morphology) may also determine the success of the settlement. In our phage collection, the phage with the highest adsorption rate also has the largest virion bulk, due to the presence of side tail fibers. Therefore, the seemingly reduced settlement rate for the HA-Stf phage may simply be due to its larger size, rather than its very high adsorption rate. However, to test such a hypothesis more phage strains with high adsorption rates but without the side tail fibers would be needed. Nevertheless, our results demonstrated that different genetic solutions to solve the same phenotypic imperative in one environment could have different fitness ramifications when in a different environment.Since the processes of adsorbing onto host cells in liquid and settling onto biofilm are similar to each other, both governed by the diffusion of phage particles in the medium, we expected that the phage with a higher adsorption rate in liquid culture would also have a higher settlement rate on the biofilm. However, our result suggested the possibility of an optimal adsorption rate for settlement, for HA-JOur results showed negative relationships between adsorption rate and plaque size, plaque productivity, and emigration rate, but only to a certain extent. It seems that the adsorption rate has a diminished effect on these traits once it has exceeded certain values. Though there are several theoretical models on the development of plaque size ,22 and rOne possible reason for our observed patterns may be because of the very crowded condition of the bacterial lawn embedded in top agar gel. Because of high cell density in the top agar layer, the proportion of high-adsorption phages that are able to diffuse for a long distance before encountering, and subsequently binding to, neighboring bacterial cells would be smaller than the low-adsorption phages. As a result, more low-adsorption phages would be able to diffuse farther, thus generating a larger plaque size. Because high-adsorption phages would likely be adsorbed onto bacterial cells in their immediate surrounding, restricted local diffusion would also increase the chance of multiple infection. Even though the burst size of multiple infection is generally larger than that of the single infection, the average phage progeny produced per infecting phage would be smaller . If all emigrants are GP phages and would actually emigrate at a rate that is similar to the LA-wt phage , it means that on average an HA-Stf plaque would contain ~5.36 × 105 GP phages (= 500/9.33 × 10-4), almost 12% of the total phage population in an average HA-Stf plaque (= 5.36 × 105/4.60 × 106). Such a high proportion of GP mutants within HA-Stf plaques could be explained by the strong selective advantage of these low adsorption rate phages in a biofilm-like environment, but also by the early appearance of these mutants during plaque formation.The selective pressure is such that the most remarkable result from our study is the emergence of large-plaque variants evolved from the ancestral HA-Stf during the transfer. Apparently, the HA-Stf plaques contain a mixture of phages, possibly with high proportion of the GP phages. For example, there would be on average ~500 phages emigrated out of the HA-Stf plaque under the condition of 0.8% top agar gel . However, these two evolutionary responses may likely have different implications when the phage is experiencing selection in the biofilm habitat.From our previous and curr1077-1 phage. Assuming that under our experimental condition, the large plaque phenotype is a reliable indicator for low adsorption rate, this result would suggest that it is difficult to obtain low-adsorption variants from HA-J1077-1 phage. However, as we have shown, the low-adsorption variants, the GP phages, are readily available from the HA-Stf phage. Furthermore, by subjecting one of the GP mutants, GP1, and its host E. coli in a chemostat culture, we are able to evolve the large-plaque variant back to a small-plaque version in its J [1077-1 phage. The J1077-1 allele [J, as the template and J1077-labFor/J1077-labRev as the primer pairs. The resulting plasmid, pZE1077-1, which contains three mutations when compared to the wt J, was transformed into a λ lysogen SYP052 [J, entire lom and part of orf401. After thermal induction, only the recombinant can form plaques. To differentiate different phage strains, a functional and defective α-fragment of E. coli's β-galactosidase were fused at the end of phage λ's endolysin protein R, resulting in blue or clear ("white") plaques [The goal of phage strain construction is to construct isogenic phage strains that differ in two traits: adsorption rate and marker state. The laboratory wild-type (wt) phage λ strain is designated as the low-adsorption (LA) strain, because it lacks the side tail fiber (Stf) and has the wt tail fiber J. Two types of high-adsorption (HA) phages were constructed: (1) the HA-Stf phage, which retains the wt J but regains the Stf, and (2) the HA-Jin its J . The conin its J . Similarin its J was also1 allele was cons1 allele , with pZ1 allele containin SYP052 , which h plaques . The ide plaques .E. coli XL1 blue cells at room temperature for 20 min. The mixture was then mixed with 3 mL of molten H-top agar with or without the addition of ~14.3 mM IPTG and ~0.06% X-gal and poured onto a plate containing 40 mL of freshly prepared LB-agar . The plate was incubated overnight at 37°C.One hundred μL of appropriately diluted phage solution was pre-adsorbed with 100 μL of freshly grown 4 phages were inoculated in a flask containing 10 mL of TB medium (1% tryptone and 0.5% NaCl) with ~107 (for the HA-Stf strain) or ~108 (for the LA and HA-J1077-1 strains) cells/ml. Two different cell concentrations were used because lower cell concentration allows a more precise determination of free phage concentration for phages with a very high adsorption rate, like HA-Stf. The experiments were performed at 37°C with constant shaking (250 rpm/min) for 15 minutes. Overnight cultures of E. coli XL1 Blue in the stationary phase, rather than the typical exponential phase, were used. At time 0, 5 and 15 min, 300 μl of the culture was withdrawn and immediately filtered on a 0.2 μm 96-well filter plate . The number of free phages in each sample was then determined by plating. Six replicates were performed for each phage strain. An exponential function (y = beat-), where a and b are the parameters to be estimated, and t the time, was used to fit the data from individual experiments. The adsorption rate (with unit of phage-1cell-1mL-1min-1) was obtained by dividing the estimated parameter a (with unit of phage-1mL-1min-1) with each determined cell concentration.Approximately 4.5 × 10To estimate the phage productivity in plaques, individual agar plugs, each containing a single plaque, were removed from the agar plate using 1 mL pipette tips that had their tip-ends enlarged by cutting with a sterilized razor blade. The resulting agar plugs were extracted with 1 mL of the TB medium and a glass tissue homogenizer with a Teflon plunger (VWR). The extractate was plated in triplicates to determine the number of phages per plaque. The productivity for each phage strain was estimated by extracting 18 random plaques (nine with the blue marker and nine with the white marker) per strain per top agar concentration.3 marked LA-wt phages and ~5 × 103 marked HA-Stf or HA-J1077-1 phages alone were placed on an LB agar plate with 100 μl overnight culture of E. coli XL1 Blue cells embedded in 3 mL molten H-top agar mixed with IPTG and X-gal (see above). After 30 minutes of incubation, the solution was aspirated and the plate dried for 10 minutes before overnight incubation at 37°C. Plaques emerged in the next day were counted and treated as the number of phages able to settle from the liquid phase onto the top agar. The experiment was performed twelve times with both marker states (six times with LA-wt-blue vs. HA-Stf-white and six times with LA-wt-white vs. HA-Stf-blue) per top agar concentration. Since HA-J1077-1 was included in the experiment at a later time, its settlement rate was conducted alone without the presence of the LA-wt strain.To determine the effect of adsorption rate on phage's ability to settle on the cells embedded in top agar, 5 mL of TB medium containing ~5 × 101077-1 phages were plated on XL1 Blue lawn and incubated at 37°C for overnight (see above for plating condition). The next day, 5 mL of TB medium was poured on the plate and incubated at room temperature. After 30 min, the liquid was aspirated, collected, and appropriately diluted so that approximately a total of 100 - 200 phages were plated. The extraction process was repeated three times. The emigration rate was calculated as follows: ϕadif is the number of type a diffused phages and ϕatot is the total number of a phages on the plate, which was estimated as the product of the average plaque productivity (Pa), by the number of plaques on the plate (na).To determine the effect of adsorption rate on phage's ability to produce progeny and emigrate out of the current plaque, approximately 20 marked LA-wt and 180 marked HA-Stf or HA-J1077-1-white or HA-Stf-white and six times with LA-wt-white vs. HA-J1077-1-blue or HA-Stf-blue) per top agar concentration.Besides the full-strength standard top agar concentration (0.8%), 2/3- (0.53%) and 1/3-strength (0.27%) of concentrations were also used to determine the effect of top agar concentration on phage diffusion. The experiment was performed twelve times with both marker states . Images of four to five replicate plates, each containing ~100 plaques were taken and analyzed using the ImageJ software. The plaque size was converted from the original unit in pixel to mmJ and the entire lom, stf, and tfa genes. Lysogen cells, containing independent large-plaque prophage, were used as the DNA template for PCR amplification. Sequencing primers are listed in [additional file To ensure only a single phage genome was sequenced, large-plaque variants derived from the HA-Stf phages were first made into lysogenic strains. Previously described protocol for PCR-DNA sequencing was usedlme function of nlme package, R version 2.4). In all models, replicate was used as a random factor . Top agar concentration , phage strain and transfer number were used as categorical fixed variables. Also, when analyzing plaque productivity, the variance function varIdent (library nlme) was used to accommodate heterogeneity in variance among different top agar treatments [Phage settlement rate, plaque productivity, emigration rate, and the proportion of HA-Stf or HA-1077-1 phages in populations during the production-emigration competitive transfer experiment were analyzed with linear mixed models (eatments .RG: original idea, project design, λ strain constructions, experiments, statistical analyses, writing. YS: λ strain constructions. INW: project design, statistical analyses, writing, supervision. All authors read and approved the final manuscript.stf sequences of independent large-plaque variants derived from the HA-Stf phagePartial . Tables showing partial stf sequences of independent large-plaque variants derived from the HA-Stf phage.Click here for fileAdsorption profiles of HA-Stf, LA-wt phages, GP1 and GP1R7. Figure showing examples of HA-Stf, LA-wt phages, GP1 and GP1R7 adsorption profiles.Click here for fileCompetitive serial transfer experiments between LA-wt and HA-Stf. Figure showing the results of competitive serial transfer experiments between LA-wt and HA-Stf in 0%, 0.27%, 0.53% and 0.8% agar.Click here for fileList of bacterial and phage strains, plasmids, and primers. Tables showing all bacterial and phage strains, plasmids, and primers used in this studyClick here for file |
The educational climate is crucial in postgraduate medical education. Although leaders are in the position to influence the educational climate, the relationship between leadership skills and educational climate is unknown. This study investigates the relationship between the educational climate in clinical departments and the leadership skills of clinical consultants responsible for education.The study was a trans-sectional correlation study. The educational climate was investigated by a survey among all doctors in the departments. Leadership skills of the consultants responsible for education were measured by multi-source feedback scores from heads of departments, peer consultants, and trainees.Doctors from 42 clinical departments representing 21 specialties participated. The response rate of the educational climate investigation was moderate 52% (420/811), Response rate was high in the multisource-feedback process 84.3% (420/498). The educational climate was scored quite high mean 3.9 (SD 0.3) on a five-point Likert scale. Likewise the leadership skills of the clinical consultants responsible for education were considered good, mean 5.4 (SD 0.6) on a seven-point Likert scale. There was no significant correlation between the scores concerning the educational climate and the scores on leadership skills, r = 0.17 (p = 0.29).This study found no relation between the educational climate and the leadership skills of the clinical consultants responsible for postgraduate medical education in clinical departments with the instruments used. Our results indicate that consultants responsible for education are in a weak position to influence the educational climate in the clinical department. Further studies are needed to explore, how heads of departments and other factors related to the clinical organisation could influence the educational climate. Postgraduate medical education (PGME) is a work-based education where learning and teaching takes place in a clinical context. On the one hand the young doctor (trainee) is under education and on the other hand he is a member of the staff in the clinical department. The clinical departments face the challenge of creating an educational environment that is supportive and learning-oriented and at tHowever, the concept educational climate has been used indiscriminately with culture, environment or learning context . NeverthThe organisational culture, according to Schein , is closHowever we do not know much of these educational leaders in PGME. In a previous study on the clinical consultant responsible for education (CRE) in clinical departments, we found that stakeholders expected the CRE to develop and improve the educational climate , which iThe purpose of this study was to explore the relationship between the educational climate in clinical departments and leadership skills in clinical consultants responsible for PGME.The study was a trans-sectional correlation study on the relationship between the educational climate in clinical departments and leadership performance of CREs. The unit of analysis is the clinical department.Postgraduate medical education in Denmark is governed by the Danish National Board of Health. For clinical departments participating in PGME, it is mandatory to nominate one of the clinical consultants in the department to be leader of PGME in the department (CRE). The CRE has responsibility for a highly diverse group of trainees undergoing a number of different PGME programs at each clinical department. At the same time the position of a CRE is an important link between the administrative line and the educational line as shown in Figure This investigation took place in the Northern Educational Region in Denmark. This region covers one third of the country and includes both university and non-university hospitals. CREs from clinical departments with more than three consultants in addition to the head of the department and more than three trainees were eligible for inclusion.CREs who had previously participated in a leadership course for CREs were excluded as they were included in another study also collecting multi-source feedback (MSF) data. Thus, a total of 79 CREs and their departments were eligible for inclusion. Participants were contacted by phone and informed about the study, the questionnaire on the educational climate and the MSF procedure. All gave informed consent. Confidentiality was guaranteed and participants were assured that it would be impossible to trace findings to individual participants, clinical departments or hospitals. The study was presented to the ethical committee for Viborg and Aalborg County. In our jurisdiction studies of this kind do not need approval.®) was used to collect data.Various instruments have been introduced to measure educational climate in PGME ,21. We c® was used to collect dataMulti-source feedback is a widely accepted tool for measuring leadership skills -24. In tMean scores of educational climate and MSF were calculated. If an item score was missing it was replaced by a mean of all other scores in the same category from the same respondent, provided that more than half of the items in the category were scored. If scores on more than half of the items were missing the respondent was excluded from further analysis. Separate mean scores were calculated for each of the three categories in the educational climate questionnaire, and separated into mean score from specialists and from trainees. Similarly, separate mean scores were calculated for the two overall categories "leadership skills" and "management skills" in the MSF procedure.The overall educational climate score and scores for the three categories in the educational climate questionnaire were correlated to the overall MSF scores and the scores for leadership skills and management skills, respectively using Pearson's correlation coefficient. Scores from trainees and specialists were compared using Oneway ANOVA. A p-value < 0.05 was considered significant.Descriptive statistics were used to examine whether characteristics of study sample were comparable to the background population. For this purpose the departments were categorised according to specialty type into 1) cognitive specialties , 2) surgical specialties and 3) technical specialties .Figure An average of ten doctors answered the questionnaire on the educational climate in each department. The response-rate was 52% (420/811). In the MSF-process each CRE had ten respondents on average . The response rate was high 84.3% (420/498). Mean educational climate and MSF scores are shown in Table Surprisingly, this study did not show a significant correlation between the educational climate in clinical departments and the leadership performance of the CRE. There could be various explanations for this finding including both internal and external validity threats.Firstly, the scores on the educational climate were quite high with a mean score of 3.9 (SD 0.3) on a five-point Likert scale. Moreover, MSF scores on leadership performance were quite high with a mean value of 5.4 (SD 0.6) on a seven-point Likert scale. Both results might indicate an instrumentation bias. However, the scores on the educational climate in our study varied from 3.0 and 4.5. An educational climate score of 3.0 should be considered a low score, since there is a tendency to get positive scores in measurements of educational climate ,26. LikeThe response rate was moderate 52% (420/811) on the questionnaire on the educational climate and might pose a threat to the validity of these results. In average we got response from ten doctors from each department, which is enough to get a reliable measurement of the educational climate .Finally, we chose to calculate a total MSF score for all respondents. When measuring leadership performance through an MSF procedure you usually separate the respondents into subgroups according to their position in the organisation. Many studies have shown that you perceive the leaders' performance differently according to your position in the organisation . HoweverThe rather high average score in educational climate and MSF scorings might indicate a positive selection bias. However, we excluded the departments where CREs had previously voluntarily signed up for a leadership course and most probably represented the most enthusiastic CREs in the region. Moreover, our study sample included 56 departments covering CREs and departments from a whole region in the country and comprising both university and non-university hospitals in addition to representing many specialties. Even with the lower representation of technical specialties in our study population compared to the background population we feel confident that the results reflect the population in general. Especially since the ratio between the cognitive and surgical specialty departments was the same in the study and the background population. The MSF instrument was developed in a way that only doctors could be invited as respondents. Extending the respondent groups to other staff groups in the department might be considered in future studies in order to achieve a more equal representation of specialties.In summary, although we acknowledge limitations to our study these do not fully account for our findings. Therefore other explanations to the lack of relation between educational climate and CREs' leadership skills might be speculated, including organisational issues of PGME.In one way PGME relates to a parallel organisation outside the organisation of hospitals and other health care organisations where PGME takes place ,28. PGMECREs might be fairly good leaders but acting in a system that makes it difficult to be perceived as a leader of education and creator of the educational culture. Additionally, the educational climate might be so mixed up in the work environment that maybe focus should be on the working culture instead of isolating the educational climate. This would involve asking other staff groups about their perception of the working culture in the clinical departments.To further explore factors that influence the educational climate it might be relevant to focus on the leadership performance of the administrative heads of the clinical departments. In particular how the head of the department prioritises PGME and attends to the educational mission in the department. This might have significant influence on the CRE's possibility to excert leadership of education and fulfil expectations .Our results indicate that there is no relationship between the educational climate in clinical departments and the leadership performance of educational leaders of PGME in the department. The separated administrative and educational lines of reference in PGME might explain this lack of relation. Future studies should focus on exploring how administrative leaders of clinical departments and perhaps other factors related to the clinical organisation influence the educational climate.PGME: Postgraduate medical education; MSF: Multi-source feedback; CRE: Consultant responsible for education in clinical department; DNBH: Danish National board of Health; SD: Standard deviation; PHEEM: Postgraduate hospital educational environment measureThe authors declare that they have no competing interests.BM and LM made substantial contributions to the conception, design and the acquisition of data. BM analyzed the data. BM, LSM, AJJS and CR made substantial contribution to the interpretation of data and drafting of the manuscript. BM, LSM, AJJS and CR all made substantial contributions in critically revising the manuscript and content. All authors have given final approval of the version published.BM: MD, MHPE and associate professor in postgraduate medical education is director for specialist training at Aarhus University Hospital, Skejby, Denmark.LSM: MD, PhD and associate professor in postgraduate medical education is consultant at the Department of Internal Medicine and director for specialist training at the Regional Hospital, Viborg, Denmark.AJJS: MD, PhD is professor of medical education and scientific director of the Institute for Education, Faculty Health, Medicine and Life Sciences, Maastricht University, Netherlands.CR: MD, PhD, MHPE is professor of medical education and director of Centre for Clinical Education, Copenhagen University and Capital Region, Rigshospitalet, Denmark.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1472-6920/10/62/prepub |
Poor growth of children in developing countries is a major public health problem associated with mortality, morbidity and developmental delay. We describe growth up to three years of age and investigate factors related to stunting (low height-for-age) at three years of age in a birth cohort from an urban slum.452 children born between March 2002 and August 2003 were followed until their third birthday in three neighbouring slums in Vellore, South India. Field workers visited homes to collect details of morbidity twice a week. Height and weight were measured monthly from one month of age in a study-run clinic. For analysis, standardised z-scores were generated using the 2006 WHO child growth standards. Risk factors for stunting at three years of age were analysed in logistic regression models. A sensitivity analysis was conducted to examine the effect of missing values.At age three years, of 186 boys and 187 girls still under follow-up, 109 boys and 93 girls were stunted, 14 boys and 12 girls were wasted (low weight-for-height) and 72 boys and 66 girls were underweight (low weight-for-age). In total 224/331 (68%) children at three years had at least one growth deficiency (were stunted and/or underweight and/or wasted); even as early as one month of age 186/377 (49%) children had at least one growth deficiency. Factors associated with stunting at three years were birth weight less than 2.5 kg 'beedi-making' in the household , maternal height less than 150 cm , being stunted, wasted or underweight at six months of age and having at least one older sibling .A high proportion of urban slum dwelling children had poor growth throughout the first three years of life. Interventions are needed urgently during pregnancy, early breastfeeding and weaning in this population. In developing countries, poor growth of children under five is a major public health problem. Children with poor growth have high rates of mortality and morbidity ,2 and caThere are large urban slums in India and it has been suggested that between 50-94% of children are underweight in different slum populations in Northern India . HoweverWe have conducted a longitudinal birth cohort in an urban slum community in Vellore, South India and measured children's growth monthly for three years. We describe here growth throughout the first three years of life and the factors related to poor growth within this population.The design of the study has been reported previously ,13. In bHeight and weight at birth, where available, were obtained from delivery records available at the first home visit. Subsequently, height and weight were obtained by field workers at the study clinic using single measurements. Weight was measured using a Salter weighing scale to the nearest 100 grams. Recumbent length was measured using a standard infantometer up to the child's first birthday or until the child was able to stand, and subsequently using a stadiometer, both to the nearest millimetre. The instruments were calibrated at least once a week. Field workers were retrained and procedures standardised once every three months.We calculated total duration of illness; we defined major illness as diarrhoea, lower respiratory infection, tuberculosis, jaundice, central nervous system infection, seizures or convulsions, neonatal sepsis, neonatal jaundice, congenital diseases, burns, scalds, fracture, crush injuries, dengue, and physician diagnosed malnutrition; and defined minor illness as fever, cough or cold, asthma, wheezing, bronchiolitis, exanthematous fever (except measles), skin morbidities, eye morbidities, ear, nose and throat morbidities, incessant crying, abrasions and bites, pica, aphthous ulcer, localised infections, anaemia and loss of appetite. These comprised caregiver diagnosis of minor illness during field worker visits and physician diagnosis of minor and major illness from visits to the study clinic and from hospital admissions .et al. unpublished). Gastro-intestinal illness was more common in the first year of life than in the second and third years, occurring at a rate of 3.6 episodes per child year (and a median of 8 days of illness) in the first year of life . More severe illnesses and mortality were low due to the close monitoring, support and free health care provided to the cohort. Compared with other developing country settings, the better health care received by our cohort could explain our finding that cumulative illness was not associated with stunting at three years of age. This suggests that nutrition might have played a greater role in the rates of stunting, wasting and underweight than illness. A total of 14 children received limited nutritional interventions of high calorie meals during the study and only after clinical diagnosis of Grade III malnutrition (51-60% of expected weight for age) of the Indian Academy of Pediatrics classification. Furthermore, we showed that the odds of stunting at 36 months were increased by growth faltering as early as six months of age. Independent of other effects, low birth weight was also a strong risk factor for growth faltering at 6 months and stunting at 36 months. All children started breastfeeding in this population although only a few continued to exclusively breastfed till six months of age . These findings suggest that in this setting the children are not getting the chance to recover from early growth faltering. It is possible that breastfeeding and/or weaning practices may have been inadequate and that maternal undernutrition, as suggested by the association we found between stunting at 36 months and maternal height, could contribute to the growth failures [Growth faltering has multi-factorial aetiology including poor nutrition and illness among other factors. Although morbidity was high it was primarily respiratory illness [, and Glafailures .Wealth of the household could also impact on the rates of growth faltering that we observed. We did not find an association between stunting at 36 months and socio-economic status but this was because children in the study were a homogeneously low or low-middle socio-economic status. Poorer households in the area are involved with beedi work, which was associated with stunting at 36 months. In a previous publication we had also found that morbidity was associated with beedi work . Finallya priori established that we would only exclude height measurements that were grossly out of line with a child's growth curve and that all weight measurements would be used as transcribed. The multiple imputations we carried out on the missing values and subsequent random effects logistic regression gave odds ratios and confidence intervals broadly in line with the complete case analysis. A sensitivity analysis that we carried out also showed our estimated odds ratios were fairly robust to the missing values in our data. This approach has given more confidence in the associations we identified.Growth data was collected as a small part of the main rotavirus study, which after six months of age had very low rates of dropout. We obtained scheduled growth measurements on at least 88% of occasions. Thus, we are able to generalise our results within this population. There were some very low z-scores, in relation to the standard, for example less than -6SD, but these were cross-checked and most were found to be correct, hence we included children in our population who would be excluded from large-scale surveys where it is not possible to check individual children to the same degree. As growth was not the primary outcome of the study only single measurements were taken each month. We therefore have no measure of the reliability of the anthropometric measurements so we maWe considered stunting, wasting and underweight together, to get an overall picture of the burden of malnutrition as suggested by Svedburg's "composite index of anthropometric failure (CIAF)" which waWe found that growth faltering was common among these urban slum dwellers, even from one month of age. We looked at monthly transitions in growth and found that children with normal growth were highly likely to have normal growth in the next month. Similarly, children with a growth faltering were highly likely to have growth faltering the following month. Stunted children were more likely to stay stunted in the following month whereas wasted children were not as likely to stay wasted. This indicates the chronic nature of stunting; that once stunting occurs a child is more likely to remain stunted, while wasting could be corrected. The chronicity of stunting was especially so for children who were stunted in combination with underweight or underweight and wasted.Although complementary feeding, such as the Indian governmental 'mid-day meal' program, has been effective in decreasing severe malnutrition in school-going children, the early and chronic nature of the growth failures in pre-school children indicate that health policy makers should rethink strategies to address undernutrition, which is highly prevalent in countries such as India ,26,27. TThe authors declare that they have no competing interests.AMR carried out the statistical analysis and drafted the manuscript. BPG coordinated the study and assisted with statistical analysis and drafting the manuscript. VPV assisted with the analysis and interpretation of the data. JM assisted in the design and coordination of the study and with the statistical analysis. SJ assisted with the analysis of the data and critically revised the manuscript. GK conceived the study and assisted with the design and coordination of the study and helped to draft and revise the manuscript. All authors read and approved the final manuscript.Imputation of missing values. Details are provided of covariates used in imputation models and imputed values.Click here for fileSensitivity analyses for stunting at 36 months. Details are provided of estimated odds ratios and confidence intervals for 16 sensitivity analysis models.Click here for fileAnalysis of growth faltering at six months and sensitivity analyses. Details are provided of estimated odds ratios and confidence intervals for our secondary outcome, growth faltering at six months, and for 8 sensitivity analysis models.Click here for file |
Assisted dying has wide support among the general population but there is evidence that those providing care for the dying may be less supportive. Senior doctors would be involved in implementing the proposed change in the law. We aimed to measure support for legalising physician assisted dying in a representative sample of senior doctors in England and Wales, and to assess any association between doctors' characteristics and level of support for a change in the law.We conducted a postal survey of 1000 consultants and general practitioners randomly selected from a commercially available database. The main outcome of interest was level of agreement with any change in the law to allow physician assisted suicide.The corrected participation rate was 50%. We analysed 372 questionnaires. Respondents' views were divided: 39% were in favour of a change to the law to allow assisted suicide, 49% opposed a change and 12% neither agreed nor disagreed. Doctors who reported caring for the dying were less likely to support a change in the law. Religious belief was also associated with opposition. Gender, specialty and years in post had no significant effect.More senior doctors in England and Wales oppose any step towards the legalisation of assisted dying than support this. Doctors who care for the dying were more opposed. This has implications for the ease of implementation of recently proposed legislation. Several countries or states have legislation permitting or decriminalising euthanasia or physician assisted suicide (PAS). These include Switzerland ; The NetGroups favouring a change in the law have presented opposition to euthanasia or PAS as primarily religious , and oneIn recent years three attempts have been made to change the law in England and Wales to allow assisted dying for the terminally ill through Bills presented to Parliament by the human rights lawyer Lord Joffe : the PatUnder the terms of the Assisted Dying Bill, it would have become legal for doctors to prescribe a lethal dose of medication to patients who requested it, if the patient was diagnosed with a terminal illness, considered to be suffering unbearably, and had mental capacity to make the decision . "TerminThe Assisted Dying for the Terminally Ill Bill was defeated in the House of Lords in May 2006, but given the support for assisted dying by groups such as Dignity in Dying, and the state of public opinion, it is likely that a further Bill will be presented to Parliament in the future.The proposed change in the law would affect the working practices of many senior doctors in England and Wales, but there are few peer-reviewed studies of their views. The most recent, published in 2006, surveyed the views of GPs in Wales. The response rate was 65%, the number responding was 1202, and 62% of these opposed a change in the law to allow physician assisted suicide . In 1999There are many other (non peer-reviewed) surveys of British doctors' views in the public domain, a total of fourteen of which are thoroughly reviewed in the seventh appendix of the 2005 report of the House of Lords Select Committee on the Assisted Dying for the Terminally Ill Bill . In addiThere is evidence from Europe that health professionals, especially those who work with the dying, are similarly less supportive of a change in the law than the public: A Swiss survey contacted 726 palliative care specialists, 148 oncology clinicians and 140 medical students over the years 2000–2005. About a third of the members of professional groups were doctors, the rest being other healthcare professionals. The response rates were 56%, 59% and 'near 100%' respectively. The palliative care specialists were 44% in support of PAS, the oncology clinicians were 73% in favour, as were 77% of the medical students .Even in countries where PAS is legal, support for this practice is far from universal among doctors. A Swiss group investigated the views of 2589 GPs, physicians, gynaecologists, oncologists and geriatricians in that country. The responders numbered 1650 (64%), and of them 32% had ever been asked to assist with a patient's suicide. Of these, 49.7% refused. Among those who had never been asked to assist with a suicide, 59% reported they would refuse .There have been no published studies examining attitudes to PAS across all specialities and general practice in England and Wales, the region of jurisdiction of the proposed Bill. In this study we aimed to measure support for legalising physician assisted suicide, in any form, in a representative sample of senior doctors working in the NHS in England and Wales.We found more doctors opposed than supported a change in the law to permit Physician Assisted Suicide, and that religious doctors were more likely to oppose such a change. Doctors who reported working frequently with the dying were also more likely to oppose a change in the law, but there was no effect of specialty, gender or years in post.We sent questionnaires to 1000 senior doctors in England and Wales randomly sampled from the Informa Healthcare Medical Directory 2005/2006 , a commeWe asked those receiving the questionnaire to provide details of their specialty, how long they had been a GP or consultant, their gender and how much their day to day work involved the management of dying people. We also asked them to rate how religious they felt they were.We provided a brief synopsis of the Assisted Dying for the Terminally Ill Bill which included the definition of the terms used in the Bill, and a clarification of what is and is not currently legal in the UK . We telephoned non responders after six weeks and resent questionnaires if required. On telephoning it was clear that a number of potential participants had moved, died or retired, and the denominator for the participation rate was adjusted to take account of this.Each questionnaire was given a unique number, so that those who responded were not sent another questionnaire, but we removed all identifying information before the analysis.We gained permission for the study from the Institute of Psychiatry, King's College London Research Ethics Committee.not be changed to allow assisted suicide". A secondary outcome was level of agreement with the statement, "I would be prepared to prescribe a fatal drug to a terminally ill patient who was suffering unbearably, were that course of action to become legal in the future". These were both ascertained using five-point Likert-type scales, which were then converted into three-point scales consisting of 'agree', 'neither agree nor disagree' and 'disagree' with legislation change to allow any form of physician assisted suicide, and with preparedness to carry out PAS, were it legal.The main outcome of interest was level of agreement with the statement: "The law should We performed separate univariable and multivariable analyses predicting the outcomes using polytomous methods. These are similar to logistic regression but they allow more than two outcomes to be predicted simultaneously. Covariates were gender, specialty, frequency of working with the dying, level of religiousness, years in post, and whether the respondent had read any of the Assisted Dying Bill. There were four relative risk ratios and confidence intervals produced for each exposure. For the main outcome these were disagreeing with any change in the law against agreeing with change and disagreeing with any change in the law against no opinion. For the secondary outcome the relative risk ratios represented not being prepared to carry out PAS were it legal against being prepared to do so, and not being prepared to carry out PAS against reporting no opinion.A response rate of 50% was achieved once we had accounted for exclusions Figure . We founMost of the responders (93% – not shown) filled in all or nearly all of the questionnaire, leaving three or less of the 50 items blank.Thirty-two percent of responding doctors reported having read at least some of the Bill. This did not differ by specialty (34% to 39%), except for surgical specialties, who were much less likely to have read the Bill (15%). Female doctors reported having read at least some of the Bill more frequently than male doctors (42% vs 27%).Overall, 39% (95% CI: 34% to 44%) of the sample supported changing the law to permit PAS, 49% (44% to 54%) were opposed to a change and 12% (7% to 15%) neither agreed nor disagreed with any change. Most supporters of change in the law endorsed the option to 'agree' with some legislative step towards physician assisted suicide, whereas most doctors who were opposed to a change endorsed 'disagree strongly' than indicated they, personally, would facilitate PAS (31%) (z = 2.22 P = 0.027). There was no association between gender and being prepared to facilitate PAS. Those who worked with the dying, rated themselves as more religious, and had read at least some of the Bill were less likely to report being prepared to assist in PAS. These effects were robust to the effects of correcting for the other exposures as potential confounders Table . There wSenior doctors are divided in their views about a change in the law to allow PAS, and fewer are in favour than are the general public in the UK ,9. This One explanation for our findings among those who work frequently with the dying could be that it is the strong culture of palliative care in the UK which has resulted in the responding doctors being opposed to a change in the law to allow assisted suicide. There were only six respondents in the survey who reported their speciality, even in part, as palliative care and all six were opposed to a change in the law. Excluding them from the analysis however, made no substantial change to the findings (not shown).The views of doctors who do not care for the dying are more like those of the general public, with 66% of those never caring for the dying supporting a change in the law, whilst 72% of those caring for the dying on a daily basis oppose it. This difference is not accounted for by stronger religious beliefs in those who care for the dying. Doctors who had read at least some of the Bill were more opposed to legalisation, an effect which was independent of religion and having a role in caring for the dying. It may be that greater knowledge of the proposed law influenced views, but is perhaps more likely that those most opposed take a greater interest in the debate.Could it be that doctors' opposition to a change in the law stems from an over-optimistic belief in their ability to relieve suffering for the dying? The finding that the doctors who regularly care for the dying are more opposed than those who do not, argues against this view. It suggests instead that intimate knowledge and clinical experience of patients who are dying negatively influences views about PAS.Fewer doctors stated that they were prepared to facilitate PAS if legalised, than were in favour of a change in the law. Some doctors who opposed any change in the law but stated they were prepared to facilitate physician assisted suicide were it to become legal, but there were more who supported a legal change but would not be prepared to carry out the act if permitted under law.We have compared the findings of our study with surveys examining the views of the general public. Surveys of this subject are vulnerable to over- or under-estimation due to insufficient explanation of concepts and question choice which makes one answer more likely than others, meaning that their findings should not necessarily be accepted uncritically. As an example, the YouGov poll is critiThe responders and non-responders in the sample were similar on all of the criteria we were able to measure, suggesting no serious problem of response bias within the sample Table . The MedThe response rate of 50% was disappointing but is superior to similar surveys ,21. EffoWe suggest that qualitative research is required to understand doctors' views better. The opposition of doctors most closely involved in the care of the dying to a change in the law may pose a practical difficulty for implementing any new legislation, since under the terms of the Bill, those likely to be most involved in the process of assessment prior to assisted suicide are more opposed to a change in the law.We showed that senior doctors in the England and Wales are divided over the issue of physician assisted suicide, with more opposing than supporting any change in the law to allow this practice. This is at variance with the results of surveys of the general public which show a high and stable degree of support. Thirty one percent of the doctors questioned would be prepared to facilitate assisted suicide were it legalised, which has implications for policy makers and for those considering how this practice might be implemented were it to become law.WL, AP and MH have all experience of working in a palliative care setting. MH, WL, AP and LR do not have any religious affiliation. MH was on the Royal College of Psychiatrists working group on Assisted Dying, and during a consultation run by the College, voiced concern about a change in the law based on his experience of caring for people requesting assisted dying.Every task associated with this paper was carried out by one or more of the authors. The original idea for the study was by MH and WL. WL gained ethical approval, carried out the database work and drafted the questionnaire. WL and AP shared the administrative tasks associated with the mailings. Telephone follow ups were carried out by AP and WL. LR organised the returned questionnaires and carried out the data entry. WL, AP and LR carried out the analysis. AP and LR drafted the paper initially and all authors contributed to the manuscript. MH supervised all of the above processes. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:Appendix. The synopsis of the Assisted Dying Bill, the definition of terms and the used questions from the questionnaire sent to participants.Click here for file |
Thirty-four evaluable patients were treated with vinorelbine, a novel, semisynthetic vinca alkaloid, as first-line chemotherapy for advanced breast cancer. They received vinorelbine 25 mg m-2 i.v. given weekly for a maximum of 16 cycles. Two patients achieved a complete remission and 15 a partial remission, giving a response rate of 17/34 ; median response duration was 5.8 months. The median progression-free interval was 4.4 months and median survival 9.9 months. Treatment was generally well tolerated. Fatigue was the most common side-effect. The main reason for dose adjustments was myelosuppression; 68% of patients had WHO grade 3 or 4 neutropenia and there was one death attributed to neutropenic sepsis. Nausea/vomiting and neuropathy were mild and alopecia was uncommon. This study confirms vinorelbine as a highly active, well-tolerated agent in advanced breast cancer worthy of evaluation in combination chemotherapy regimens. |
Staphylococcus aureus, Streptococcus dysgalactiae subspecies equisimilis and Streptococcus pneumoniae, were detected in synovial fluids from 6, 2 and 2 patients, respectively. In 3 patients only 23S rRNA analysis was positive; 2 synovial fluids contained S. dysgalactiae subspecies equisimilis and 1 S. pneumoniae). The present study indicates a significant contribution by PCR with subsequent DNA sequencing of the 23S rRNA gene analysis in recognizing and identification of microorganisms from synovial fluids. Consecutively collected synovial fluids were examined for presence of bacterial DNA followed by DNA sequencing of amplicons, and by conventional bacteriological methods. One or more microorganisms were identified in 22 of the 227 synovial fluids originating from 17 patients. Sixteen of the patients had clinical signs of arthritis. For 11 patients molecular and conventional bacterial examinations were in agreement. Establishment of molecular methods for detection of microbiological etiologies of infectious diseases, including sequencing of the genes coding for bacterial rRNA, has provided new tools for identification of the etiology of infections , 2. The Infective arthritis is a severe and painful condition which can be complicated by tissue destruction and permanent damage of the joint, and in addition, the mortality rate for in-hospital infective arthritis ranges from 7% to 15%, despite antibiotic use . Since aIn the present study, 227 non-selected synovial fluids, both from native and artificial joints, consecutively sent to the laboratories of clinical microbiology in three different hospitals in the Copenhagen area of Denmark, were analysed for presence of a 700-bp segment of the bacterial 23S rRNA gene in parallel to conventional analysis by microscopy and culture.Specimen sampling and patients: All consecutively unselected synovial fluids, irrespective of tentative diagnosis, sent to the Departments/Unit of Clinical Microbiology, at Copenhagen University Hospitals, Rigshospitalet and Herlev Hospital, and at Statens Serum Institut, were included in the study. A substantial number of the synovial fluids were expected to be sterile. If possible the synovial fluids were divided before analysis. Otherwise, PCR was performed on the synovial liquid remaining after conventional microbiological examinations. The remaining fluid was kept at -20. Sixteen of the patients had clinical signs of arthritis, while status was unknown for one. Seven patients had an arthroplasty and 3 patients suffered from rheumatoid arthritis, of which 2 patients had both. In 5 of 7 patients arthroplasties had to be removed and in 1 patient with arthroplasty lifelong antibiotic treatment was initiated.Patient data, on the 17 patients from whom synovial fluids contained bacterial DNA and/or gave growth of bacteria, were obtained from the patient records. Six of the patients were females and 11 were males. The median age was 64-years with a range from 1 to 80 years and a chocolate agar with heat-treated defibrinated horseblood (SSI) and cultured for 2 days at 37 and cultured for two days at 37 .PCR assay: The primers used for the amplification of 23S rDNA were Uni-F (5`-TAA CGG TCC TAA GGT AGC GAA ATT-3`) and Uni-R (5`-GAT AGG GAC CGA ACT GTC TCA CG-3`), which produced a 700-bp fragment of 23S rDNA. The PCR mixture , contained 1 x PCR buffer, 2.5 mM MgCl2, 200 µM each deoxynucleoside triphosphate, 200 µM each primer and 1.25 U of Taq DNA polymerase (Qiagen). One and 5 µl samples were tested in PCR. The amplification profile was 95 oC for 15 min, followed by 40 cycles at 94 oC for 30 s, 60 oC for 30 s and 72 oC for 30 s. Amplicons were resolved on a 2% agarose gel, visualized by ethidium bromide under UV illumination and digitally recorded.DNA sequencing: Both DNA strands of the amplicons were sequenced on an ABI PRISM 3100 Avant Genetic Analyzer (applied Biosystems) using Uni-F and Uni-R as sequencing primers and the BigDye v. 3.1 kit (Applied Biosystems). Sequencing data were edited using the SeqScape Software (Applied Biosystems) and only data from overlapping sequences were used in the data processing. Using default parameters in the BLAST search engine, the edited sequencing data were then compared to sequences deposited in the “Bacteria” NCBI database and E-values for the best and the next best matches [ matches , 9.Microbiological examinations:For 11 patients molecular and conventional bacterial examinations were in agreement (Table 1). Staphylococcus aureus, Streptococcus dysgalactiae subspecies equisimilis and Streptococcus pneumoniae, were detected in synovial fluids from 6, 2 and 2 patients, respectively. Coagulase negative staphylococci (CNS) were grown in addition to S. dysgalactiae subspecies equisimilis from one patient (case 7) and their presence interpreted as a contamination. In one patient as well Citrobacter freundii as Pseudomonas aeruginosa was grown and 23S rRNA analysis demonstrated C. freundii, but polymicrobial infection could not be excluded. In 3 patients each only culture or 23S rRNA analysis , respectively, was positive. Of the solely culture positive cases, S. aureus was grown in 2 synovial fluids and CNS in 1 synovial fluid, while the 23S rRNA analysis examinations, in the cases with S. aureus grown, were insufficient because of less than 1 ml fluid examined/inhibition of PCR reaction. Of the solely 23S rRNA analysis positive synovial fluids 2 contained S. dysgalactiae subspecies e-quisimilis and 1 S. pneumoniae. For the 23S rRNA positive synovial fluids, differences in percentage of similarity and Maxscore between best and second best taxon match resulted in good favor of the identified microorganism. S. dysgalactiae subspecies equisimilis, was detected by 23S rRNA gene analysis, but only grown from 1 patient and from 3 patients S. aureus was grown, but only detected by 23S rRNA gene analysis in synovial fluid from 1 patient. The last 2 patients (case 16 and 17) had CNS grown and a suspected polymicrobial etiology by both methods, respectively.In synovial fluids from nine patients microorganism were detected by microscopy, either streptococci or staphylococci . As well culture as 23S rRNA gene analysis were positive in these instances, except in one patient (case 3) only having pneumococci detected by the 23S rRNA gene analysis. No microorganisms were seen in synovial fluids from 8 patients. From three patientsThe aim of the present study was to investigate to what extent PCR of the bacterial 23S rRNA gene and DNA sequencing of the amplicon could add to microbiological diagnosis obtained by culturing of synovial fluid. PCR and DNA sequencing resulted in identification of an infecting organism in three patients, whom were negative by culture. This is equivalent to an 17% increase in positive rate. Though the number of examined synovial fluids preferably could be higher, PCR and DNA sequencing contributed importantly in the microbiological diagnosis of patients suspected of infective arthritis in agreement with recent literature -12. BothIn a study on diagnosis of joint infection by PCR on swabs or synovial fluids from 154 patients, no significant gain was achieved as compared to conventional culturing . In partStaphylococcus aureus, beta-hemolytic streptococci and to a lesser extend Streptococcus pneumoniae [Kingella kingae has been recognized as the etiologic agent in approximately 15% of cases in which a microorganism is recognized [K. kingae were found. Detection of microorganisms which are difficult to culture is considered a major advantage for the new molecular diagnostic methods [S. dysgalactiae subspecies equisimilis (n=2) and S. pneumoniae (n=1) were detected supporting superior detection in such situations by PCR for 23S the rRNA gene analysis [The main etiologic agents of infective arthritis are Gram-positive cocci such as eumoniae , which acognized , 12. Onl methods . StreptoCoxiella burnetii, Bartonella henselae and Tropheryma whipplei has been detected and identified by DNA amplification and sequencing [Molecular diagnostic methods allows detection of microorganisms that are difficult to culture, including bacteria considered as exotic. In other sites of infection, e.g. infective endocarditis quencing . In agrequencing , 8.S. dysgalactiae and sign of ostitis with several illuminations on a bone scintigraphy.Advantage of examining for bacterial ribosomal genes is predicted in the cases where antibiotics have been given prior to isolation of the samples. Such benefit of using the molecular method was achieved for 2 of the PCR positive, but culture negative samples. In 1 case (case 3) streptococci were identified by microscopy. This patient was admitted with pneumonia and sepsis and pneumococci were cultured from the blood, and the patient eventually died. In another case (case 6) a new sampling of synovial fluid three weeks later was culture positive with an identical microorganism. This patient had an arthroplasty related infection, and was treated with penicillin and dicloxacillin. Finally, the arthroplasty was removed and the patients had an arthrodesis. In the third patient (case 5) synovial fluid was positive for bacterial DNA of the 23S rRNA gene,but culture negative; additional findings were a positive blood-culture with C. freundii as P. aeruginosa were isolated both pathogens were thought to be of significance, whereas the coagulase-negative staphylococci detected in case 10 were considered as a contaminant.There is good agreement in identification of microorganisms when using phenotypic and ribosomal gene sequencing methods . Also, iIn conclusion, the present study indicates a significant contribution by use of bacterial 23S rRNA gene analysis in detection and identification of microorganisms from synovial fluids. Continued suspicion of infective arthritis despite of negative cultures should lead to the use of molecular diagnostics |
This retrospective study evaluated, according to hormone receptor status, the antitumor effects of bisphosphonate especially on survival and disease progression in breast cancer patients with metastatic bone disease.Of 317 patients with initial bone metastasis and known breast cancer subtypes, 230 patients (72.6%) had hormone receptor (HR) positive tumors, and 87 patients (27.4%) had HR negative tumors. We assessed the primary outcome of overall survival (OS), after adjusting for other factors, comparing a group that received bisphosphonates (BPs) with a group that did not receive it.P = 0.019). In multivariate analysis, disease free interval > 2 years (P = 0.036), a sum of metastatic sites < 3 (P = 0.034), and BP treatments (P = 0.007) were significant factors for survival in HR negative patients.87.8% of HR positive and 69.0% of HR negative patients received BPs with a median number of 17.7 cycles. Although BPs treatment made no survival benefit in HR positive group, HR negative patients showed a significant prolonged survival when they received BPs treatment (hazard ratio = 0.56 [95% CI 0.34 to 0.91], Bisphosphonate treatment can result in a survival benefit in metastatic breast cancer patients with HR negative tumors. The median survival time after the diagnosis of bone metastases is approximately two years, although it may increase with new treatment regimens . As pati studies -6. These studies -9.P = 0.01) [Recently, Gnant et al. reported that zoledronate, in an adjuvant setting, significantly prolonged disease-free survival beyond the time achieved with endocrine therapy alone . Now, seThe antitumor effects of BPs have not been investigated in the metastatic setting, although BPs are now widely used in metastatic breast cancer. Most studies focused on the development of skeletal related events (SREs) and the quality of life of patients with metastatic bone disease . In thisThis retrospective study included a total of 317 breast cancer patients with initial bone metastases, whose hormone receptor (HR) status and HER2 status were known, and who were treated between June 2001 and July 2007 at the National Cancer Center Hospital, Korea. Of these, 87 patients (27.4%) had HR negative tumors. A tumor was considered to be HER2 positive if the primary or metastatic tumor was scored 3+ by HER2 immunohistochemistry (IHC) or by amplification of the HER2 gene by the method of fluorescent in situ hybridization (FISH). If a tumor's score was 2+ by IHC, the tumor was reanalyzed using FISH. Metastatic bone disease (MBD) was diagnosed mostly by means of radionuclide bone scans performed for follow-up. Magnetic resonance imaging was done when patients showed skeletal related symptoms such as pain, fractures, or neurologic signs with equivocal bone scan results.Patients with bone metastases were followed up until August 2008, and their medical records were reviewed for clinical data, including age at the initial diagnosis, age at diagnosis of disease recurrence, initial stage of the disease, pathological type, disease-free interval, number and site of metastases, treatment after diagnosis, especially bisphosphonate treatment, and survival interval from the diagnosis of disease recurrence or initial stage IV presentation.The administered bisphosphonates (BPs) differed according to the periods of treatment, compliance, tolerability, and insurance strategy. The types of bisphosphonate used were zoledronate or pamidronate. These drugs were given at three or four week intervals. Patients who received more than three consecutive months of bisphosphonate treatment were designated as members of the bisphosphonate group (BP group), and other patients were designated as members of the non-bisphosphonate group (non-BP group).For the evaluation of the bisphosphonate effect on bone metastasis, we assessed the progression of bone metastasis, time to progression of bone disease (TTP_BD), and development of skeletal related events (SREs). SREs were defined as pathological fractures, or surgery or palliative radiation to bone in order to treat or prevent impending fractures or cord compressions. Disease progression in bone was defined as the appearance of any new bone lesions, or the progression of existing bone metastases, including the development of SREs. To monitor the side effects of bisphosphonate, the serum levels of creatinine and total calcium were regularly checked. Bisphosphonate treatment was temporarily stopped before and after dental procedures. Patients undergoing bisphosphonate treatment were instructed to take an oral calcium supplement containing vitamin D.This study protocol was approved by the Institutional Review Board for the National Cancer Center (IRB protocol number NCCNCS 08-195). Because this was a retrospective analysis that involved no additional risk to patients, the Institutional Review Board approved a waiver of informed consent.P values were 2-tailed, with 5% significance levels. All statistics were calculated using SPSS® 13.0 software .Descriptive statistics, including sample size, median, and range, were reported for continuous variables. Discrete variables were summarized using frequencies and percentages. Clinical parameters and treatment response were compared using 2-way tables, chi-square, and Mann-Whitney U test. Time to progression of bone disease (TTP_BD) and overall survival (OS) were estimated by Kaplan-Meier analysis and compared using the log-rank test. Cox proportional hazard model was used to identify the independent predictive factors that significantly influenced the overall survival of patients with metastatic bone disease. The proportionality assumption for the Cox regression and the log rank test was checked and verified by using the log-log plot. All P < 0.001), the BP group had better prognostic factors, such as HR positivity (P < 0.001), negative HER2 receptors (P = 0.035), fewer visceral metastases (P = 0.002), bone only metastases (P = 0.014), and fewer metastatic sites (P = 0.006), compared to the non-BP group. There was no significant difference in use of anti-HER2 therapy between BP and non-BP groups.Among 317 patients with bone metastases at diagnosis, 262 (82.6%) patients were treated with BPs during follow-up. The median number of cycles of BP treatment was 17.7 , and the median interval between cycles was 31 days. Patients' characteristics are shown in Table P = 0.059). The overall survival (OS) was significantly longer in the BP group . Although the rate of progression of bone disease and the incidence of SREs (except for the first event) were higher in the BP group, there was no statistical difference in the time to progression of the bone disease (TTP_BD) according to BP treatment > 2 years, sum of metastatic sites < 3, and no visceral involvement (Table It has been known that patients with hormone receptor (HR) positive tumors tend to develop more bone metastasis than those with HR negative tumors. As shown in Table P = 0.117, P = 0.104 respectively) received BP treatments. Although more patients in the BP group developed disease progression in bone and of SREs (except for the first event), these associations were not statistically significant . TTP_BD was not significantly different between the two groups patients were treated with BP for metastatic bone disease. There was no significant difference in the baseline characteristics between the BP and the non-BP groups, except that more patients had weight bearing bone metastases in the BP group compared to the non-BP group (1) Table . The ratups Fig. .P = 0.040, Fig. P = 0.040), a sum of metastatic sites ≥ 3 , and BP treatments were significant factors for survival in HR negative patients. These results were verified through multivariate analysis , which stimulates osteoclastic resorption by increasing the production of the receptor activator of the nuclear factor-κB ligand (RANKL) by osteoblast and stromal cells. The RANKL binds to its receptor, RANK, on osteoclast lineage cells, induces differentiation into mature osteoclasts, and stimulates osteoclast activity ,13. Nitrin vitro . N-BPs ain vitro . Among vin vitro .In contrast to the consistent preclinical antitumor effects of BPs, the results of clinical studies in breast cancer have shown conflicting findings. Diel and Powles indicated that clodronate treatment prevented skeletal metastases with no effect on visceral metastases, and improved overall survival ,18-20. HIn this study, we investigated the effect of BP in a metastatic setting, specifically in patients with metastatic bone disease from breast cancer. The most important limitation of this retrospective study is that the use of BPs was based on the clinical decision to prevent complications such as pathological fracture, bone pain, and hypercalcemia. Patients who had experienced SREs secondary to bone metastasis tended to be put on bisphosphonate more often. Consequently, patients with BP group in this study developed more often progression of bone disease and SREs, because BP treated group had more advanced and complicated bone disease at the outset of BP use. Conversely, patients with bone metastasis who did not have symptoms or had only minimal tumor burden tended not to receive BP treatment. Therefore, patients with more indolent bone disease had greater propensity to be included in the non-BP group. With these inherent unbalances, TTP_BD was not significantly different according to BP treatment in both HR positive and HR negative groups.In the first analysis, including all patients with metastatic bone disease, favorable OS was expected in the BP group, as a result of an imbalance in hormone receptor status, the presence of visceral organs involvement, and other important prognostic factors. It was still possible that BP treatment was an important factor for survival because far more patients with HR positive tumors received BP treatment. In the next analysis, we corrected for this confounding factor by looking separately at patients with HR positive tumors within the BP-treated vs. untreated groups. In these patients, HER2 positivity and visceral organ involvement were important factors for OS, but there was no significant difference in OS with or without BP treatment. In HR negative patients, on the contrary, an OS difference was significant in favor of the BP treatment. HR negative patients' characteristics were well balanced between the BP treated and untreated groups. There was no concern for a possible interaction between hormonal therapy and BPs in HR negative patients.These results are contrary to those of Saarto's clodronate study. In that study, 10-year disease free survival was much worse in the clodronate treatment group, especially in estrogen receptor (ER) negative patients . It was In this study, it may appear that there were unexpected interactions of anti-hormonal treatment with BPs in HR positive patients. Recently, studies of the role of zoledronate in preventing treatment-induced bone loss in pre- and post-menopausal breast cancer patients were performed. They showed that hormonal treatment combined with zoledronate did not influence the survival or disease progression in hormone responsive breast cancer ,23. FurtAnother limitation of this study was that patients receiving different N-BPs were included. Variation in the N-BPs made it difficult to compare the efficiency among the N-BPs zoledronate and pamidronate. There is preclinical data showing that zoledronate is much more potent than other BPs. However, this has not been confirmed in clinical settings. Clinically, the choice among the various N-BPs is dependent on the adherence of patients and preference of clinicians .We conclude that BP treatment may give a survival benefit in metastatic breast cancer patients, particularly in patients with HR negative tumors, which are known to have a poorer prognosis. We believe that this analysis adds insight into the roles of BPs in metastatic breast cancer, in addition to their ancillary role in supportive care. Based on these results, new strategies could be investigated for the possible benefits of BP treatment in metastatic breast cancer patients without bone involvement.HR: hormone receptor; BPs: bisphosphonates; N-BPs: nitrogen containing bisphosphonates; OS: overall survival; DFI: disease free interval; MBD: metastatic bone disease; SREs: skeletal related events; TTP_BD: time to progression of bone disease; IHC: immunohistochemistry; FISH: fluorescent in situ hybridization; RANKL: receptor activator of the nuclear factor-κB ligand; TRAIL: tumor necrosis factor-related apoptosis-inducing ligand.The authors declare that they have no competing interests.IHP and JR designed the study and conducted the data acquisition. IHP and BHN performed the statistical analysis. IHP, JR and BHN participated in the interpretation of the data. IHP and JR drafted and revised the manuscript. IHP, JR, BHN, YK and KSL participated in critical review of the manuscript. All authors read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2407/9/154/prepub |
Although orthotopic heart transplantation has been an effective treatment for end-stage heart failure, the incidence of allograft failure has increased, necessitating treatment options. Cardiac retransplantation remains the only viable long-term solution for end-stage cardiac allograft failure. Given the limited number of available donor hearts, the long term results of this treatment option need to be evaluated.709 heart transplants were performed over a 20 year period at our institution. Repeat cardiac transplantation was performed in 15 patients (2.1%). A retrospective analysis was performed to determine the efficacy of cardiac retransplantation. Variables investigated included: 1 yr and 5 yr survival, length of hospitalization, post-operative complications, allograft failure, recipient and donor demographics, renal function, allograft ischemic time, UNOS listing status, blood group, allograft rejection, and hemodynamic function.Etiology of primary graft failure included transplant arteriopathy (n = 10), acute rejection (n = 3), hyperacute rejection (n = 1), and a post-transplant diagnosis of metastatic melanoma in the donor (n = 1). Mean age at retransplantation was 45.5 ± 9.7 years. 1 and 5 year survival for retransplantation were 86.6% and 71.4% respectively, as compared to 90.9% and 79.1% for primary transplantation. Mean ejection fraction was 67.3 ± 12.2% at a mean follow-up of 32.6 ± 18.5 mos post-retransplant; follow-up biopsy demonstrated either ISHLT grade 1A or 0 rejection (77.5 ± 95.7 mos post-transplant).Cardiac retransplantation is an efficacious treatment strategy for cardiac allograft failure. The International Society for Heart Lung Transplantation (ISHLT) estimates that over 65,000 heart transplants have been performed worldwide. With the increasing population of heart transplant patients there is an associated large population of patients suffering from allograft failure resulting from 3 major categories: acute rejection, primary graft failure, and transplant arteriopathy. Several clinical and experimental strategies to treat graft failure have been proposed, but these options have not yet proven to be long-term clinical solutions. Cardiac retransplantation remains the only viable long-term treatment for end-stage cardiac allograft failure.A few studies have evaluated outcomes following cardiac retransplantation and have demonstrated good results -4. UnforFrom April 1987 to May 2007 seven hundred and nine patients underwent orthotopic heart transplant for end-stage heart failure from various causes. Etiologies included ischemic heart disease (42.6%), dilated cardiomyopathy (55.6%), and other causes (1.8%). During this same period of time fifteen patients underwent repeat orthotopic heart transplantation.Adverse factors, that could potentially limit long-term survival, were carefully examined and utilized as exclusion criteria included severe pulmonary hypertension, active or recent malignancy, evidence of end organ damage due to diabetes, major chronic disabling illness , symptomatic peripheral vascular or carotid artery disease, active mental illness or psychosocial instability, HIV antibodies, intolerance of immunosuppression, and history of noncompliance. Only a fraction of patients felt to be suitable candidates for retransplantation received organs. Ultimately, whether a patient was retransplanted was determined primarily by organ availability and compatibility. Patients who were not candidates for retransplantation were not supported by ventricular assist devices.At the University of Pennsylvania the average waiting time for heart transplant once listed with UNOS is 7.0 months. The majority of patients are transplanted within 1 year of listing (52.0%), while 15.2% of patients are transplanted within 30 days of listing. Only 5.7% of patients on the UNOS waiting list expire while awaiting transplantation at our institution .The majority (50.0%) of patients were UNOS status 1A at the time of transplantation . The average survival of initial grafts, excluding hyperacute rejection (n = 1) and metastatic melanoma in the donor (n = 1) as the causes of retransplantation, was 62.1 ± 32.6 months. This study was performed utilizing existing data available in the University of Pennsylvania transplantation database along with clinical patient records.Total ischemic time for allografts prior to reperfusion was 163 ± 29 minutes. 42.9% of all allograft anastomosis were performed in a bicaval fashion, the remainder were performed with a biatrial anastomosis. Average cardiopulmonary bypass time was 148 ± 48 minutes.st year, every six months during the 2nd year, and then annually. Transthoracic echocardiography (TTE) was performed once a month for the 1st 3 months, every 6 months for the 1st year, and then on an annual basis.Myocardial rejection was scored utilizing the ISHLT histopathologic grading nomenclature. Myocardp-value of less than 0.05 was considered statistically significant.Quantitative data are expressed as mean ± standard error of the mean (SEM). Variance between two groups was evaluated using the chi-square test. A Cardiac retransplantation accounted for 2.1% of all heart transplants performed at our institution. Primary transplant allograft failure was due to transplant arteriopathy (66.7%), acute rejection (20.0%), hyperacute rejection (6.6%), and a post-transplant diagnosis of metastatic melanoma in the donor (6.6%). One patient in this study was supported on extracorporeal membrane oxygenation (ECMO) for 24 hours, secondary to hyperacute rejection, while awaiting retransplantation. There were no untoward sequallae following ECMO. None of the patients were supported on ventricular assist devices (VAD).2. On average patients remained intubated for only 8.6 ± 4.3 hours and remained in the CT SICU for 3.5 ± 1.0 days. Average length of hospital stay was 13.2 ± 4.5 days. Patients remained in the hospital in order to undergo surveillance myocardial biopsies prior to discharge.Post-operatively patients were recovered in the cardiothoracic surgical intensive care unit (CT SICU) until they were hemodynamically stable for transfer to the cardiothoracic step-down unit. Mean post-operative cardiac index was 3.4 ± 0.7 l/min/mTransthoracic echocardiography was performed 24 hours following transplantation. Mean ejection fraction immediately following transplant was 65.6 ± 14.2%. Three patients demonstrated moderately decreased left ventricular function which resolved prior to hospital discharge without the assistance of pressors. Two patients had mild tricuspid regurgitation (TR) while an additional two patients demonstrated moderate TR. Three out of four patients with tricuspid regurgitation underwent biatrial anastomosis, while the remaining patient with moderate TR had bicaval anastomosis. Mean ejection fraction on discharge was improved to 68.9 ± 6.8%. All patients underwent percutaneous endomyocardial biopsies prior to discharge. Ten patients demonstrated no histopathologic evidence of rejection. Four patients had mild rejection (ISHLT Grade 1), while 1 patient had moderate rejection (ISHLT Grade 3A).There were no major hemodynamic complications following retransplantation necessitating operative reexploration. One patient suffered a mild, non-debilitating cerebrovascular event without residual deficit. Another patient required a right sided thoracostomy tube for a hemothorax. Two patients required hemodialysis for a short period of time immediately following transplantation, but regained adequate renal function prior to discharge. Mean 24 hour chest tube output was 525 ± 202 cc. On average patients were transfused with 3.3 ± 1.6 units of packed red-blood cells.Patient survival following primary heart transplant at our institution is 90.9% 1 year following transplant and 79.1% 5 years following transplant. This is better than the international average heart transplant survival as published by the ISHLT for primary cardiac transplantation with survivals of roughly 85% at 1 year and 70% at 5 years. PatientOnly 1 patient expired due to failure of the retransplanted allograft. One day following retransplantation a patient expired secondary to overwhelming fungal sepsis resulting from presumed colonic necrosis. There was 1 late death 9 months following retransplant resulting from micronodular cirrhosis diagnosed 4 months following transplant. Lastly, a patient expired 27 months following retransplantation due to metastatic lung cancer.As demonstrated in this study, cardiac retransplantation can be safely performed in appropriately selected patients with good outcomes. We have demonstrated long term viability following cardiac retransplantation that approaches that of primary cardiac transplantation. With appropriate patient selection, meticulous intra- and post-operative care, and careful myocardial surveillance cardiac retransplantation is a very effective and viable treatment strategy.Alternate therapeutic options for cardiac allograft failure are limited as minimal benefits have been demonstrated with percutaneous coronary interventions, coronary artery bypass grafting, valvular repair, plasmapheresis, or medical management -15. TherThe literature on cardiac retransplantation is ambiguous with several studies reporting divergent findings. Shuhaiber and colleagues in a retrospective review evaluating cardiac retransplants found a higher risk of death after retransplantation when compared to primary allograft failure. Risk factors for cardiac retransplantation were ischemic time, age, and ventilator dependence at the time of transplant, these were similar risk factors for cardiac transplantation. OptimizA high volume transplant center published a retrospective review of their retransplant experience and reported slightly lower but beneficial short- and long-term results following cardiac retransplantation. This fiFrom a theoretical and immunologic standpoint, retransplantation in a patient with long standing immunosuppression may actually provide the appropriate milieu for diminished rejection, decreased coronary vasculopathy, and longer allograft survival. One of the most controversial post-transplant issues has been the utilization of induction therapy with cytolytic anti-lymphocyte antibodies such as OKT3 and thymoglobulin. Encouragingly, induction therapy has been associated with decreased rates of allograft rejection,21. But,Along similar lines retransplantation in patients with prolonged initial graft survival, ie. greater than 15 years, will likely have longer retransplant graft function as compared to patients who suffer hyperacute rejection or repeated bouts of rejection and rapid onset allograft dysfunction. Rapid rejection implies a profound immunologic response with less tolerance of allogenic grafts. A large, multi-institutional retrospective study found worse survival in patients undergoing cardiac retransplantation for early graft failure and acute rejection; with survival rates for patients that underwent retransplantation <6 months after initial transplant manifesting worse survival. TherefoCardiac retransplantation raises further interesting management questions. For instance, does it matter if we do not resect all of the previous heart? The renal transplant literature suggests that the presence of multiple organs from different donors increases the risk of organ rejection. One can theorize that this situation would hold true for cardiac retransplants with residual tissue from the initial donor as well as a heart from a second donor. Therefore, if a patient has had a biatrial anastomosis at the initial transplant, should all of the initial donor aorta, pulmonary artery, and atria be resected to decrease immunogenicity and rejection associated with the "chimera"? The literature in both clinical and experimental cardiac transplant models thus far fails to answer these issues. These questions exemplify our basic understanding of cardiac retransplantation and the need to expand our knowledge so that we can optimize outcomes.In conclusion, cardiac retransplantation is an efficacious treatment strategy for cardiac allograft failure with good long-term results.The authors declare that they have no competing interests. |
One of the water molecule is disordered over two positions, with occupancies of 0.83 (3) and 0.17 (3). In the crystal structure, molecules are linked into a three-dimensional network by intermolecular O—H⋯O, O—H⋯, O—H⋯N and N—H⋯O hydrogen bonds. π–π interactions involving Br-substituted benzene rings, with a centroid–centroid distance of 3.552 (3) Å are also observed.In the title compound, C Å b = 8.679 (2) Å c = 24.289 (5) Å β = 112.42 (3)°V = 1804.9 (8) Å3 Z = 4 Kα radiationMo −1 μ = 2.32 mmT = 298 K 0.23 × 0.20 × 0.20 mm Bruker APEXII CCD area-detector diffractometerSADABS; Sheldrick, 2004T min = 0.618, T max = 0.654Absorption correction: multi-scan (14447 measured reflections3897 independent reflectionsI > 2σ(I)1997 reflections with R int = 0.074 R[F 2 > 2σ(F 2)] = 0.051 wR(F 2) = 0.135 S = 1.02 3897 reflections261 parameters20 restraintsH atoms treated by a mixture of independent and constrained refinementmax = 0.32 e Å−3 Δρmin = −0.53 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809033522/ci2888sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809033522/ci2888Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
EST sequencing projects are increasing in scale and scope as the genome sequencing technologies migrate from core sequencing centers to individual research laboratories. Effectively, generating EST data is no longer a bottleneck for investigators. However, processing large amounts of EST data remains a non-trivial challenge for many. Web-based EST analysis tools are proving to be the most convenient option for biologists when performing their analysis, so these tools must continuously improve on their utility to keep in step with the growing needs of research communities. We have developed a web-based EST analysis pipeline called ESTPiper, which streamlines typical large-scale EST analysis components.The intuitive web interface guides users through each step of base calling, data cleaning, assembly, genome alignment, annotation, analysis of gene ontology (GO), and microarray oligonucleotide probe design. Each step is modularized. Therefore, a user can execute them separately or together in batch mode. In addition, the user has control over the parameters used by the underlying programs. Extensive documentation of ESTPiper's functionality is embedded throughout the web site to facilitate understanding of the required input and interpretation of the computational results. The user can also download intermediate results and port files to separate programs for further analysis. In addition, our server provides a time-stamped description of the run history for reproducibility. The pipeline can also be installed locally, allowing researchers to modify ESTPiper to suit their own needs.Daphnia pulex cDNA sequencing project. A web server hosting ESTPiper is provided at to now support projects of all size. The software is also freely available from the authors for local installations.ESTPiper streamlines the typical process of EST analysis. The pipeline was initially designed in part to support the For these taxa, EST sequencing remains (for now) the only efficient way to discover genes on genome-wide scale, since the repetitive elements still pose an unsolved challenge for whole genome assembly. Even for species with draft genome sequences, ESTs remain the gold standard for accurate gene structure annotations (delineating intron-exon and gene boundaries) and serve a variety of biological research applications . In most cases, significant computational resources are also needed . Therefore, web-based EST analysis pipelines are critical for biologists to perform their analysis simply, via a web browser, without unnecessary technical hassles. Although some web-based tools for EST analysis are becoming available, their scope and capacities need continuous improvements. To enrich the biologists' toolkit, we have developed a web-based computational pipeline called ESTPiper, which streamlines typical EST analysis steps. In the sections below, we discuss the technical implementation of ESTPiper, its unique features compared to other web-based EST analysis tools, and the application of ESTPiper in support of the Daphnia pulex genome sequencing project .Expressed sequence tags (ESTs) are generated by single-pass sequencing of complementary DNA (cDNA) . Becauseiewed in -4). Becaiewed in . After EPlantGDB ) usuallyThe ESTPiper flow chart is illustrated in figure de facto standard program for converting DNA sequence trace files generated by the Sanger method into nucleotide sequences. To speed up the file upload for large numbers of trace files, ESTPiper only accepts compressed data files in either .ab1 or .scf format and produces the sequence and the corresponding quality file in FASTA format.ESTPiper incorporates the Phred program for basei.e., E-value cutoff 1 × 10-20). The output of this step is the cleaned sequence and quality files in FASTA format.To obtain high quality EST assemblies, contaminant sequences are properly identified and removed. These include sequences from ligated adaptors, cloning vectors and the bacterial host. ESTPiper first invokes the commonly used LUCY program for vectde novo assembly using the popular CAP3 program [e.g., .fwd and .rev for sequences generated from forward and reverse sequencing primers, respectively), such clone-pair information can be used to produce unigene clusters that include non-overlapping contigs. For this purpose, ESTPiper performs single-linkage clustering by default. The user may choose a more stringent clustering criterion, i.e., at least two EST clones must be shared for linking two contigs together in order to reduce potential false linkages . ESTPiper provides program to asseme, e.g., ).i.e., the start and end position of each aligned EST on genomic scaffolds) allow the user to cluster overlapping ESTs into unigene sets. Genome-based EST clustering is usually considered more accurate than de novo assembly [de novo assemblers solely consider the pairwise EST sequence overlap, and may mistakenly assemble different transcripts from paralogous genes into the same cluster, which is a serious problem for species that have extensive gene duplicates. Moreover, de novo assemblers often disconnect alternative transcripts derived from the same gene locus into different clusters, thus overestimating the number of expressed genes. Therefore, we have implemented a genome-guided strategy for clustering the mapped ESTs similar to other published studies .If a draft genome sequence for the species of interest is available, ESTs are routinely aligned to genomic DNA for gene discovery, for annotation of intron-exon structures, and for identifying alternative splice forms. For such purposes, we have also implemented a genome-alignment module. Specifically, the BLAT program , which iassembly ,14-16. Ws . Parignments . If multe.g., [i.e., biological process, molecular function, and cellular component) and at a user-selected GO hierarchical level. ESTPiper also allows the user to input a list of GO terms and reference set , and to perform statistical analyses that identify overrepresented functional attribute terms. Specifically, the p-value of each GO term is calculated based on the hypergeometric test with Benjamini and Hochberg multiple testing correction [The next natural step when processing ESTs is to identify the potential protein products encoded by the clustered unigene sequences, particularly whether they are similar to known sequences in proteomic databases. Therefore, each assembled contig sequence is searched against the UniProt protein database using the.g., ). The GOrrection .e.g., Coprinus cinereus, Daphnia pulex). The coding strand of each assembled sequence must be pre-defined before designing microarray probes, which is seldom straightforward. In ESTPiper, the coding strand is determined by a simple two-tier strategy. First, sequences on DNA strands that match to the protein database , are confidently determined from the BLAST output. If a sequence has no match to protein sequences , the sequence is passed to the OrfPredictor program [Despite increasing popularity of whole-genome tiling arrays and expression profiling by direct sequencing, oligonucleotide arrays remain an efficient and cost effective tool for studying co-transcriptional biases of genes on a large scale for species without full-genome sequence information. Therefore, designing microarray oligonucleotide probes is a critical task for biologists to create gene chips for their functional genomic investigations. Previously, our Center conducted an extensive survey to compare the existing microarray probe design programs and chos program , which ie.g., assembled contig sequences) to be imported within other preferred computer programs for further analysis . In addition, ESTPiper provides an option for the user to select and combine multiple modules automatically. Data can be effectively transferred among adjacent modules without any human intervention. Parameters can be saved for repeated use, i.e., the user can input previously returned parameter files for multiple new runs with different source data.Each of the above steps is completely modularized. Therefore, depending on the user's specific needs, multiple entry points into the pipeline are possible. For example, instead of starting with base calling for processing trace files, the user can simply upload pre-processed FASTA-format sequence files and quality scores (perhaps generated by others) into our pipeline for assembly. Similarly, intermediate results can be downloaded from our pipeline . Instead, biologists often prefer web-based analysis tools, where data can be uploaded on a host machine and the analysis can be performed through an easy-to-use interface. Therefore, several online tools have been published recently that simplify computational tasks. Although helpful, none of the existing web-based tools offer a comprehensive EST analysis workflow. For example, many tools are limited in scope: e.g., OREST [e.g., de novo EST assembly, microarray probe design). For general-purpose EST analysis tools, preAssemble [de novo EST assembly but users must perform base calling and annotation elsewhere. ESTExplorer [e.g., e2g [i.e., BLAST) and ab initio prediction for coding strand determination. In addition, we also enhanced the de novo assembly function. Specifically, beyond simply invoking CAP3 as other services do, ESTpiper provides users an option to perform single-linkage clustering based on clone-pair constraints. This allows the user to better define a true set of unigenes . Furthermore, some of existing web-based tools allow researchers to process only relatively small input files. For example, ESTpass imposes an upper limit of 10,000 ESTs (or 20 Mbyte file size) on files uploaded to their web server. We impose no file size limit for ESTPiper. However, we do recommend that users input less than 100,000 EST sequences to ensure successful de novo assembly without running out of computer memory on our current server. Yet we have nonetheless successfully assembled more than 150,000 Daphnia ESTs with our present configuration.A number of standalone software packages are available for EST data analysis -37. Howe., OREST is only Assemble and WebTAssemble specialiAssemble mainly fExplorer and ESTpExplorer extend E.g., e2g for geno.g., e2g for probe.g., the programs, parameters, input data, and corresponding results). We believe that this feature will greatly facilitate tracking results, especially if the user initiates several rounds of trial-and-error analyses, experimenting with different program and parameter combinations in order to obtain the highest quality results. Finally, unlike many other web-based tools that are not portable, the user can download and install ESTPiper on local computers. For example, advanced users may use the core ESTPiper code to process the EST data without having to navigate through the web interface, or they can integrate ESTPiper into their own customized pipeline .Our workbench is designed for biologists to perform and document computational analysis on EST data. Computational analyses in ESTPiper are documented for reproducibility. For example, the percent identity cutoff limits used by CAP3 program for assembly are recorded, which determines the resulting contigs. Therefore, ESTPiper provides the user with a complete, time-stamped description of ESTPiper's usage history . After data cleaning, ESTPiper returned 151,013 high-quality sequences. PolyA/T tails were further removed; the minimum length of continuous polyA/T was set to 9 bp, the maximum number of mismatches within the polyA/T region was 3, the searching range of polyA/T was limited to 50 bp from both ends of the sequence. We also configured ESTPiper to remove sequences with at least 30 bp continuous A/T or adaptors occurring in the middle of sequence reads to avoid potential chimerical clones. Furthermore, mitochondrial sequences and contaminated E. coli sequences were identified and removed based on BLAST similarity search . Finally, resulting sequences less than 100 bp were also removed. A total of 148,410 high-quality ESTs were therefore used in subsequent steps of our analysis.We applied ESTPiper to process and analyze a large set of de novo assembly using the CAP3 program and an assembly based on alignment to the Dappu v1.1 draft genome sequence assembly . First, by feeding the cleaned ESTs into the de novo CAP3 assembly program (with the parameters -p 95 -o 49 -t 10000), 23,470 contigs and 14,014 singletons were generated, and 26,265 unigene clusters were derived based on clone-pair constraint. Second, for genome-based assembly, ESTs were first aligned to the Daphnia genome using the BLAT program (with the parameter minIdentity = 95). If an EST sequence matched multiple genomic loci, only the best match was considered as the cognitive match. Out of 148,410 ESTs, 113,931 ESTs matched to the genome sequence. ESTs were clustered based on their overlapping matching positions on the genome. We required that two neighboring ESTs be considered part of the same cluster if they shared at least 40 bp minimum overlap. A total of 14,891 unigene sets were derived. For genes identified from each EST library, ESTPiper matched them to UniProt using BLASTX . The GO term associated with the top matches to the protein database were also created for different libraries. Statistic analysis of GO terms overrepresented in each library was performed using the entire EST collection as a reference. Finally, a 10,000 element Daphnia cDNA microarray (Generation-3) was produced with the oligonucleotide probes designed based on ESTPiper. The microarray has been successfully applied by the Daphnia research community to study Daphnia gene expression under different environmental stress conditions (data will be published elsewhere).We conducted both a Web-based tools are most convenient for biologists to effectively process large EST data sets. To supplement the existing tools, we have developed a comprehensive web-based EST analysis pipeline called ESTPiper that streamlines the numerous EST analysis components and offers unique features such as genome alignment and microarray probe design.. We recommend that users provide their email address when they upload their data. Then, once their submitted jobs are finished, emails will be automatically sent to the users with the instruction for retrieving their results. The software is also available from the web site for local installation. Currently, ESTPiper is installed on a virtual machine hosted on a Sun X4450 with four 2.4 GHz CPUs, each CPU having four cores for 16 total cores. The machine has 32 GB of memory. There are two 10 K RPM SAS system disks in a mirrored ZFS pool, and all project/app storage is done over NFS via dedicated gigabit Ethernet. At our Center, we can easily migrate ESTPiper among our virtual servers as resource requirements change.The ESTPiper program is freely accessible, using a web browser at Project name: ESTPiperProject home page: Operating systems: Local installation requires Linux/UNIX.Programming language: Perl, JavaScript, JAVALicense: The software is under the Apache license 2.0.ZT designed and implemented ESTPiper and its web server. JHC contributed to the system design and provided technical assistance with the software implementation. CH critically enhanced the web interface, on-line descriptions, and the probe design module. AS and CH improved the genome alignment module. QD and JC conceived the project and guided the development process. QD and ZT prepared the manuscript. All authors read and approved the final manuscript. |
Some breeds of sheep are highly seasonal in terms of reproductive capability, and these changes are regulated by photoperiod and melatonin secretion. These changes affect the reproductive performance of rams, impairing semen quality and modifying hormonal profiles. Also, the antioxidant defence systems seem to be modulated by melatonin secretion, and shows seasonal variations. The aim of this study was to investigate the presence of melatonin and testosterone in ram seminal plasma and their variations between the breeding and non-breeding seasons. In addition, we analyzed the possible correlations between these hormones and the antioxidant enzyme defence system activity.Seminal plasma from nine Rasa Aragonesa rams were collected for one year, and their levels of melatonin, testosterone, superoxide dismutase (SOD), glutathione reductase (GRD), glutathione peroxidase (GPX) and catalase (CAT) were measured.All samples presented measurable quantities of hormones and antioxidant enzymes. Both hormones showed monthly variations, with a decrease after the winter solstice and a rise after the summer solstice that reached the maximum levels in October-November, and a marked seasonal variation (P < 0.01) with higher levels in the breeding season. The yearly pattern of GRD and catalase was close to that of melatonin, and GRD showed a significant seasonal variation (P < 0.01) with a higher activity during the breeding season. Linear regression analysis between the studied hormones and antioxidant enzymes showed a significant correlation between melatonin and testosterone, GRD, SOD and catalase.These results show the presence of melatonin and testosterone in ram seminal plasma, and that both hormones have seasonal variations, and support the idea that seasonal variations of fertility in the ram involve interplay between melatonin and the antioxidant defence system. Melatonin plays a central role in fine-tuning circadian rhythms and seasRasa Aragonesa is a local Spanish genotype with a short seasonal anoestrous period (< 100 days) between May and July . In prevOxidative stress is defined as an imbalance between the cellular antioxidant defense systems and the production of reactive oxygen species (ROS) . The antTo further the understanding of the melatonin influence in ram semen, in this study we determined the presence of melatonin and testosterone in ram seminal plasma and investigated their variations between the breeding and non-breeding seasons. In addition, we analyzed the possible correlations between these hormones and the antioxidant enzyme defence system, comprising superoxide dismutase (SOD), glutathione reductase (GRD), glutathione peroxidase (GPX) and catalase (CAT).We determined the level of melatonin and testosterone, and the activity of the antioxidant enzyme defence system in ram seminal plasma throughout the year by weekly analysis. Correlations between the levels of both hormones and the activity of superoxide dismutase (SOD), glutathione reductase (GRD), glutathione peroxidase (GPX) and catalase (CAT) were also determined, as well as variations between breeding and non-breeding seasons.Semen was collected from nine Rasa Aragonesa rams maintained under uniform nutritional conditions at the Experimental Farm of the University of Zaragoza, Spain , in compliance with the requirements of the European Union for Scientific Procedure Establishments. All experimental procedures were performed under the supervision of the Ethics Committee of the University of Zaragoza. All the rams belonged to the National Association of Rasa Aragonesa Breeding (ANGRA) and were 2-4 years old. The sires were kept apart, and semen was collected every two days, in two successive matings each day. First and second ejaculates were pooled separately to obtain a uniform, good quality sperm sample suitable for representative studies of ram semen, according to previous report . Only fiSeminal plasma was extracted from pooled first ejaculates by centrifugation at 2.400 × g for 10 min in a microfuge at 4°C. The supernatant was centrifuged again at 2.400 × g for 10 min, and seminal plasma was recovered and, after filtering through a 0.22 μm Millipore membrane was kept at -20°C until analysed. Two seminal plasma samples obtained per week were pooled and analyzed.4H2 solution were added and absorbable was measured on a microtiter plate reader at 450 nm.Melatonin values in ram seminal plasma were measured by means of a commercial competitive immunoassay , following the manufacturer's instructions. Briefly, 100 μl of each sample, control and calibrator were loaded in duplicate in a microtiter plate coated with an anti-melatonin antibody, and incubated for 16-20 h at 2-8°C. After incubation, 50 μl of biotinylated melatonin were added to each well and incubated for 3 h at 2-8°C. After three washes, 100 μl of streptavidin conjugated to horseradish peroxidase (HRP) were loaded to the wells and incubated for a further 60 min in a plate rotator set at 600 rpm at 18-28°C. Wells were washed three times again, and 100 μL of tetramethylbenzidine substrate (TMB) were added to each well and incubated for 30 min on a plate rotator at 600 rpm and 18-28°C and protected from direct light. After incubation, 100 μl of 0.25 M SOTestosterone evaluation in ram seminal plasma was performed by means of a total testosterone commercial ELISA kit assay , following the manufacturer's instructions. Briefly, 50 μl of each sample, control and calibrator, along with 100 μl of testosterone labeled with horseradish peroxidase (HRP) were loaded in duplicate in a microtiter plate coated with an anti-testosterone specific antibody, and incubated for 1 h at room temperature. After incubation, wells were washed three times, and 100 μl of chromogenic substrate (TMB) were added to each well and incubated for 30 min at room temperature, protected from direct light. After incubation, 100 μl of 0.2 M HCl solution were added and absorbance was measured on a microtiter plate reader at 450 nm.Antioxidant enzymatic activity of four enzymes: superoxide dismutase (SOD), glutathione peroxidase (GPX), gluthatione reductase (GRD) and catalase was determined.SOD activity was measured by optimization of the method that we used previously . Enzymat2•¬The SOD activity was assessed as the competition between reaction c and b which is measured as a decrease of the rate of XTT reaction. The reaction mixture contained 40.5 mM sodium phosphate buffer pH 7.8; 0.15 mM xanthine; 0.15 mUI xanthine oxidase, 30 mM XTT and 20 μl of sample to complete a final volume of 1 ml. The reaction was initiated by the addition of xantine oxidase, and the absorbable change at 470 mm was monitored for 3 min with a Hitachi spectrophotometer (U-2000). One enzyme unit (IU) is defined as the amount of SOD capable of transforming 1.0 mmole/min of O2H), coupled to the recycling of GSSG back to GSH utilizing GRD and NADPH.GPX activity was measured by using a variation of the method previously used based on2H and 30 μl seminal plasma to complete a final volume of 1 ml. The absorbance change at 340 nm was monitored for 3 min with a Hitachi spectrophotometer (U-2000). One unit will cause the oxidation of 1.0 mole/min of NADPH.The reaction mixture contained 300 mM sodium phosphate buffer pH 7.2; EDTA 0.5 mM, 54 mUI of GRD; 85 μM NADPH; 2 mM GSH; 1.2 mM t-BuOGRD activity was measured,by using a variation of the method described by Goldberg and Spooner . Enzymat2O2 reduction to H2O and O2 in catalase presence.Catalase activity was measured by using a variation of the method described by Marti et al. . The enz2O2 and 30 μl seminal plasma to complete a final volume of 1 ml. The absorbance change at 240 nm was monitored for 30 sec with a Hitachi spectrophotometer (U-2000). One enzyme unit (IU) is defined as the amount of catalase capable of transforming 1.0 μmol/min of H2O2.The reaction mixture contained 50 mM sodium phosphate buffer (pH 7); 30 mM HMonthly and seasonal results are shown as mean ± S.E.M. of the number of samples assessed in each case. Distribution of the data was evaluated by the Kolmogorov-Smirnov test. Because melatonin data were not normally distributed, and had a log normal distribution, logarithm transformation of these data was carried out to perform statistical analysis.Differences between breeding (August-February) and non-breeding (March-July) seasons were compared by means of an analysis of variance (ANOVA) test, and correlations between assessed parameters were compared by means of Pearson's bivariated correlation test. When correlation between parameters was significant, linear regression test were carried out. All statistical analysis was performed using SPSS (v.15.0) software.All studied samples presented measurable quantities of melatonin, testosterone and antioxidant enzymes.Both hormones showed monthly variations, with a decrease after the winter solstice that reached the minimum in May (testosterone) or June and July (melatonin), and a rise in August that reached the maximum levels in October-November Fig. , with loThe yearly pattern of the four antioxidant studied enzymes is shown in Fig. Among the four antioxidant enzymes assessed, only GRD showed a significant seasonal variation P < 0.01) with a higher activity during the breeding season (Table with a hCorrelation analysis between the studied hormones and antioxidant enzymes showed a significant correlation between melatonin and testosterone, GRD, SOD and catalase. In addition, SOD showed a direct correlation with GRD and catalase, but not with testosterone or GPX Table . A graphThe results of this study show the presence of melatonin and testosterone in ram seminal plasma, both hormones with a seasonal variation, in the same way as occurs in blood serum throughout the year ,28. In oMelatonin is able to modulate the reproductive physiology in photoperiod-dependent seasonally breeding mammals -7. MelatSimilarly, testosterone levels also showed seasonal variation in ram seminal plasma, and they were significantly higher during the breeding season, which could influence fertility. Testosterone, produced by testes, is required for maturation of male germ cells and sperm production and quality . TestostSeasonal variation of testosterone in ram seminal plasma is slightly lower than that of melatonin. Given that breeds can differ in their fluctuations of gonadotropin and testosterone levels in response to changes in day length and melatonin secretion , the minOn the other hand, spermatozoa are very sensitive to oxidative stress effects, and their fertilizing capacity is impaired due to early apoptosis and DNA damage . To prot1/MT2 [In this study, we have found a seasonal variation of GRD in ram seminal plasma with significantly higher activity in the breeding season. The seasonal variation of GRD in ram seminal plasma found in this study, and the strong correlation between melatonin and GRD SOD and catalase suggest a seasonal regulation of these antioxidant enzymes by melatonin. The detection of melatonin receptor in rat epididymis suggests1/MT2 , increas1/MT2 . Additio1/MT2 , as this1/MT2 .In conclusion, this study demonstrates the presence of melatonin and testosterone in ram seminal plasma, and that both hormones have seasonal variations. The obtained results support the idea that melatonin is involved in the regulation of semen quality and the antioxidant enzyme activity that affect the reproductive performance of rams, and that seasonal variations of fertility in the ram involve an interplay between melatonin and the antioxidant defence system. Further investigations on this subject would be applicable to animal reproductive biology.The authors declare that they have no competing interests.JACP and AC designed the research, AC performed melatonin and testosterone assays and drafted the manuscript, IC and MEODAA performed antioxidant enzymes assays, RPP and TMB carried out data analysis and interpretation, and TMB, FF and JAA revised and approved the article. All authors read and approved the final manuscript. |
Copia- and Gypsy-like retrotransposons are the two main classes of retroelements shown to be ubiquitous in plant genomes. Ideally, the retrotransposons life cycle results in the synthesis of a messenger RNA and then self-encoded proteins to process retrotransposon mRNA in double stranded extra-chromosomal cDNA copies which may integrate in new chromosomal locations.Retrotransposons are heterogeneous sequences, widespread in eukaryotic genomes, which refer to the so-called mobile DNA. They resemble retroviruses, both in their structure and for their ability to transpose within the host genome, of which they make up a considerable portion. Copia and Gypsy retrotransposon transcripts and of new events of integration in unstressed plants of a sunflower (Helianthus annuus L.) selfed line. Results show that in sunflower retrotransposons transcription occurs in all analyzed organs . In one out of sixty-four individuals analyzed, retrotransposons transcription resulted in the integration of a new element into the genome.The RT-PCR and IRAP protocol were applied to detect the presence of These results indicate that the retrotransposon life cycle is firmly controlled at a post transcriptional level. A possible silencing mechanism is discussed. Oryza australiensis, the amplification of retrotransposons doubled the genome size [The mobile component of the genome is represented by sequences, called transposable elements (TEs), which are potentially able to change their chromosomal location (transposition) through different mechanisms. This feature has a cladistic significance and TEs are subdivided into two main classes accordingly to their mechanism of transposition, retrotransposons and DNA transposons (class II). Class I elements, which includes all REs, can transpose through a replicative mechanism which involves the transcription of an RNA intermediate by the enzyme machinery of the host cell, and subsequent retrotranscription to cDNA and integration into the host genome by the enzymes encoded by the retrotransposon RNA. Such a "copy and paste" mechanism has been largely successful during the evolution of eukaryotes in which class I elements represent the largest portion of higher plant genomes. In the case of ome size .Retrotransposons are divided into autonomous and non-autonomous elements, according to the presence of ORFs that encode RE enzymes. Non-autonomous elements do not carry enough coding capacity to allow them to transpose autonomously, nevertheless they are able to move using enzymes encoded by other elements .gag domain, which is committed towards the production of virus like particles, and the pol domain, whose encoded enzymes are used for processing RE-mRNA and obtaining a double stranded DNA to be integrated into the genome. The occurrence of long terminal repeats (LTRs) flanking the retrotransposon genome distinguishes REs into two main classes, namely LTR- and non-LTR-retrotransposons. LTRs carry promoter elements, polyadenilation signals and enhancers regulating the transcription of retroelements.Basically, the genome of autonomous REs is organized in two domains: the Gypsy and Copia LTR retrotransposons are two ubiquitous classes [pol. Gypsy and Copia elements resemble retroviruses in their structure due to the presence of LTRs and internal ORFs. LTR-retrotransposons lacking internal coding domains, such as TRIMs and LARiniature ) have alriticeae .Nicotiana and Tos17 in rice showed stress-induced (by tissue culture) transcription and transposition [Over the last two decades, some examples have correlated the emerging of RE activity in the genome with a stress mediated reaction: Tnt1 and Tto1 in position , while tLarge genome sequencing of grass plants showed that REs are responsible for extensive changes in genome structure and, surprisingly, dramatic differences were reported even among individuals belonging to the same species ,12. A reIt has been proposed that REs restructuring action plays a role in regulating gene expression ,15. It hThough the interplay between REs and host genome has allowed genome expansion and the evolution of the gene expression regulating network, the vast majority of REs seem to be inactivated by a large spectrum of mutations. Only few elements have been shown to transpose autonomously and data from EST libraries in grasses indicate that most are poorly transcribed -19. HoweSchizosaccharomyces pombe, a basal level of transcripts matching centromeric DNA repeats is the substrate for the production of small RNAs that maintain heterochromatin structure through histone methylation [Drosophila [Arabidopsis [The control of TEs activity is related to RNA interference, a process mediated by small RNAs which derive from a number of different precursors, determining chromatin specific methylation and condensation, and RNA degradation . In the hylation . A silenosophila and in Abidopsis .Arabidopsis, Gossypium species, Nicotiana, and Lotus japonicus. Recently, genome expansion related to the amplification of REs has been shown to occur in the evolution of three Helianthus hybrid species adapted to extreme environments [In plants, retrotransposon dynamics have mainly been investigated in grasses and other monocotyledons, and in dicotyledons such as ronments ,25.Helianthus annuus) has a medium-large sized genome and three Gypsy-like sequences resulted as being medium repeated, with a copy number per haploid genome ranging from 4,000 to 16,000 . These sequences were studied with respect to their RNA transcription.Sunflower repeated sequences were previously isolated from a omic DNA . Among tRNAseH and the Integrase gene of Copia and Gypsy elements, respectively. RT-PCR experiments were performed to assess the occurrence of RE transcripts in different organs such as root, leaf, flower (at three different stages) and embryo (at four different stages), collected from HCM line plants. For each organ and stage, amplified fragments of the expected length were obtained . Sequences belonging to the Copia-like element did not show sequence polymorphism or to other genera .Eight out of the nine Gypsy-like LTRs were isolated by two-step chromosome walking, following the method reported for sunflower Copia-like LTRs [Putative full-length ike LTRs .Gypsy LTRs (EMBL acc. numbers FM177929-FM177940) and 18 putative Copia LTR .Twelve putative FM177928) were ales Table , for whiGypsy (TATAAA) and in the Copia (TATATATA) LTRs. To analyze the structure of a putative RE promoter, isolated Copia and Gypsy LTRs were scanned for cis-elements against the PLACE database [cis-elements as Myb, Myc, and WRKY motifs were found. Cis-elements typical of constitutively expressed genes such as Dof-related elements [cis-elements can be observed in both strands of analyzed LTRs.CLUSTAL alignment clearly showed conserved putative TATA box promoter both in the database . In all elements and CACTelements were obselements , tissue-elements , were foCopia and Gypsy transcriptional activity leads to the integration of daughter copies in the genome of Helianthus annuus, the IRAP protocol [Taq DNA polymerase.To investigate whether protocol was applCopia and Gypsy elements. Since RE insertions are mutagenic and the development of plantlets might be aborted, new events of RE integration were surveyed in sunflower embryos from four inflorescences, one for each developmental stage. Sixty-four embryos were tested, using specific Copia- and Gypsy-LTR primers, respectively. Only a combination of LTR specific primers (FF C-LTR/C-LTR2), matching a Copia retroelement, produced a clear polymorphic band in a 14 day old embryo . The sequence was found to be delimited by the two primers; 3'-Copia LTR and 5'-Copia LTR ends were present, excluding unspecific primer annealing. The sequence between the two LTRs (665 bp long) was isolated in other HCM plants using primers designed on the inter-retrotransposon sequence and it showed 100% similarity with the same locus related to the polymorphic band. To assess whether Copia LTRs flanked this locus in plants of the HCM line, PCRs were performed with primers pointing outward from the genomic locus .The amplification of REs in the genome can have some functions for the host. For example, the occurrence in the LTR of putative promoter elements such as those observed in the sunflower could be used by the host to regulate the expression of nearby genes. Constitutively active LTR promoters could determine a housekeeping expression, while tissue-specific LTR promoters would drive the expression of genes in those tissues. An example of gene transcription related to the activity of adjacent retrotransposons was reported in wheat . In mousThe ubiquity of RE transcripts observed in sunflower tissues, and the fact that REs are actively transcribed in standard culture conditions, can support the idea that retrotransposons can be integrated into cell metabolism. For instance, a basal level of retrotransposons transcription would make available the "rough material", namely dsRNAs, that can trigger RE silencing via RNA-directed DNA methylation and chromatin remodeling or via aCopia-like elements, Tnt1, Tto1, and Tos17, present in a relatively low copy number per haploid genome .Previous analyses of sunflower REs revealed that they are highly methylated . The famRetrotransposon transcription was shown in all sunflower tissues analyzed in our experiments. RE activity is not apparently induced by environmental factors or by culture conditions. In one over 64 surveyed embryos a new RE insertion occurred, possibly determining a mutation.Copia and Gypsy RE families investigated, would be linked to post-transcriptional regulation of REs activity, probably through the degradation of target RE mRNAs.We can speculate that in the sunflower the rarity of insertion events, observed in our experiments despite the consistent transcriptional activity of the Helianthus annuus, grown in the field. The HCM line was developed at the Dept. of Crop Plant Biology of University of Pisa after 18 self-pollination cycles, starting from an open-pollinated cultivar, and it is a highly homozygous line, as indicated by phenotype uniformity. Self-pollination was obtained by covering inflorescences to prevent outcrossing. After sampling, tissues were ground in liquid nitrogen. DNA was extracted from embryos and leaves using a CTAB protocol [Roots, leaves, embryos, and flowers were collected from plants of the HCM line of protocol with minprotocol .A tuned RNA purification protocol was tailored to avoid genomic DNA contamination, i.e., DNA remnants invalidating RT-PCR analyses. Such a high level of accuracy is crucial especially when analyzing RE expression because of the high frequency of REs in the genomes.RNA was purified by treatment with DNAse I (Roche). The total amount of DNAse units was set according to the maximum amount of glycerol allowed in the reaction mixture, i.e. 25 μg total RNA, 10 × DNAse I incubation buffer 5 μl, RNAse-free recombinant DNAse I 100 units , DEPC water up to 50 μl. Samples were incubated for 1 h at 37°C. After DNAse treatment, RNA purification required a phenol-chloroform extraction and standard precipitation with 1/10 volume 3 M sodium acetate and 2 volumes of cold, 100% ethanol. Using this protocol any possible genomic DNA contamination was prevented [see Additional file For retrotranscription, total RNA (5 μg) was heated for 3 min at 70°C and retrotranscribed in a 20 μl volume reaction using 400 μM of each deoxynucleotide triphosphate, 0.25 μM poly(T) primer, 1×RT-Buffer, 1 mM DTT, 200 U SuperScript III Reverse Transcriptase (Life Technologies). The same quantity of RNA was processed as above but in the absence of the reverse transcriptase and used as a negative control in RT-PCR.2, 250 μM of each deoxynucleotide triphosphate, 1 μM of each retroelement-specific oligonucleotides (Table Taq DNA polymerase (Biodyne), 20 μl volume reaction. Thermocycling (30 cycles) was performed at 94°C for 30 s, 60°C for 30 s and 72°C for 80 s for G13 RE; at 94°C for 30 s, 55°C for 30 s and 72°C for 80 s for G22 RE; at 94°C for 30 s, 53°C for 30 s and 72°C for 80 s for G30 RE; and at 94°C for 30 s, 57°C for 30 s and 72°C for 30 s for C211 RE. PCR products were visualized on 2% agarose gel and EtBr-stained. Three products for each RE, amplified using RNA isolated from embryos at 28 days after pollination, were cloned in pGEM T-easy vector using manufacturer's instructions, and sequenced.PCRs were performed using 1/20 volume (1 μl) of retrotranscribed cDNA, 2.5 mM MgCles Table , 1 U TaqSequences were aligned using CLUSTAL W . Some adRelationships among LTR sequences were investigated by the neighbour-joining (NJ) method , using the PHYLIP program package Version 3.572 : after sGypsy LTRs a two-step PCR protocol was applied [Gypsy Integrase gene (GenBank Acc. Nr. AJ532592) DNA polymerase, 20 μl volume reaction. Thermocycling was performed at 94°C for 30 s, 60°C for 30 s and 72°C for 2 min, for 30 cycles. Products longer than 1,000 bp were cloned and sequenced as above. Clustal analyses were performed to address putative polypurine tract (PPT) whose location is usually a couple of nucleotides before the 3' LTR beginning. Due to the remarkable LTR sequence variability and the lack of large conserved sequence traits, at this stage the 3' boundaries of the 3' LTR within the sequenced clones could not be determined.To isolate full length applied . FirstlyGypsy-like 3' LTR, and coupled with a universal primer designed onto the primer binding site (PBS) related to the tRNAmet sequence pointing towards the 5' LTR . ThermoCopia and Gypsy LTR ends DNA polymerase, 20 μl volume reaction. Thermocycling was performed at 94°C for 30 s, 55°C for 30 s, and 72°C for 150 s. PCR products were visualized on 2% EtBr-stained agarose gel.Ten primers were designed on ds Table . Embryos2, 0.5 μM primers final concentration, 1 U Taq FirePol (Biodyne) DNA polymerase, 20 μl volume reaction. Thermocycling was performed at 94°C for 30 s, 60°C for 30 s, 72°C for 2 min. Primers (EMB 2F, EMB 2R, Table A polymorphic fragment was recovered from the gel, cloned in pGEM T-easy vector using the manufacturer's instructions, and sequenced. Specific primers (EMB 1F, EMB 1R, Table RE: retrotransposon; TE: transposable element; ORF: open reading frame; LTR: long terminal repeat; IRAP: inter retrotransposon amplified polymorphism.Helianthus projects and coordinated the study. All authors read and approved the final manuscript.MV, TG, LN and AC conceived and designed the study. MV performed sequence isolation and identification, expression and phylogenetic analyses, IRAP polymorphism detection. TG contributed to generate the data. MV and AC wrote the manuscript. LN and TG participated in the interpretation and discussion of results and contributed to the writing of the paper. AC is the principal investigator for the Checking DNA contamination in RT-PCR analysesThe file describes the experimental procedures performed to exclude that the results of expression analyses by RT-PCR are altered by possible genomic DNA contamination of cDNA.Click here for file |
The characteristic of invasive GAS infections has been thought to attribute to genetic changes in bacteria, however, no clear evidence has shown due to lack of an intriguingly study using serotype-matched isolates from clinical severe invasive GAS infections. In addition, rare outbreaks of invasive infections and their distinctive pathology in which infectious foci without neutrophil infiltration hypothesized us invasive GAS could evade host defense, especially neutrophil functions. Herein we report that a panel of serotype-matched GAS, which were clinically isolated from severe invasive but not from non-invaive infections, could abrogate functions of human polymorphnuclear neutrophils (PMN) in at least two independent ways; due to inducing necrosis to PMN by enhanced production of a pore-forming toxin streptolysin O (SLO) and due to impairment of PMN migration via digesting interleukin-8, a PMN attracting chemokine, by increased production of a serine protease ScpC. Expression of genes was upregulated by a loss of repressive function with the mutation of csrS gene in the all emm49 severe invasive GAS isolates. The csrS mutants from clinical severe invasive GAS isolates exhibited high mortality and disseminated infection with paucity of neutrophils, a characteristic pathology seen in human invasive GAS infection, in a mouse model. However, GAS which lack either SLO or ScpC exhibit much less mortality than the csrS-mutated parent invasive GAS isolate to the infected mice. These results suggest that the abilities of GAS to abrogate PMN functions can determine the onset and severity of invasive GAS infection.Group A Streptococcus pyogenes is one of the most common human pathogens. It causes a wide variety of infections ranging from uncomplicated pharyngitis and skin infections to severe and even life-threatening manifestations, such as necrotizing fasciitis (NF) and streptococcal toxic shock-like syndrome (STSS) emm1 genotype, among more than 100 emm genes encoding the serotype-determinant M protein, are the predominant cause of severe GAS infections in Japan emm genotypes, especially, emm49-genotype, have been isolated from patients of severe invasive GAS infections since 2000; however, these genotypes were not isolated before 1999 in Japan emm49 GAS isolated from invasive infections seems to acquire the novel or altered virulence factors by mutations, genomic additions, or deletions.The strains of Epidemiological and pathological findings, including sporadic incidents of severe invasive GAS infections emm49 clinical isolates from patients with or without severe invasive infection, and their gene-manipulated mutants. We now show a direct and previously unrecognized link between functional loss of a factor CsrS of two-component sensor/regulator system and escape from killing by PMN via inducing necrosis to them and digesting IL-8, a PMN-attracting chemokine. We further determined CsrS mutations in the severe invasive GAS was essential to control the expression of various virulence genes and contributed to the in vivo virulence and disease-specific pathophysiology in a mouse model. These data may participate in prediction of GAS potential for future invasive infection as well as risk assessment of patients by measuring PMN function.In the present study, we aimed to explore the crucial factors in the pathogenesis of severe invasive GAS infections in the context of PMN-GAS relationship, using a panel of emm49 GAS isolated from severe invasive infection might alter human PMN function, we performed phagocytosis assay in vitro. As non-opsonized GAS was resistant to the phagocytosis by PMN in vitro killing assay revealed that PMN killed non-invasive GAS, resulting in 15–42% of initial number of bacteria, but not invasive GAS (p = 0.019). The similar results were obtained when opsonized with either FCS or human serum regardless of complements immobilization (data not shown). These results were common among all PMN donors. These data indicated that clinically isolated severe invasive GAS were phagocytosed, but escaped from killing by human PMN.To examine whether p = 0.016) compared to that of control culture. Flow cytometry analysis suggested that although PMN was detected in the lower well consisted of IL-8 and severe invasive GAS, but most of them were dead as defined by propidium iodine staining (p = 0.016) demonstrin vitro migration assay system.PMN death was induced shortly after encounter with severe invasive GAS, and PMN were not in apoptotic death because of low frequency of cells positive for annexin V (data not shown), which was seen in the case of cytolysin-dependent cell injury slo) lost the killing activity for PMN (sagA) killed PMN, as efficiently as did parent strain, indicating that SLS is dispensable for killing of PMN mediated by invasive GAS. SLO and SLS double mutant GAS from NIH230 strain (NIH230slosagA) displayed the killing activity indistinguishable from that of NIH230slo, confirming the primarily role of SLO for GAS-mediated PMN killing. As shown in for PMN , therebyTo confirm that SLO activity is increased in invasive GAS strain, we measured SLO hemolytic activity of GAS strains used in this study. As shown in slo lost the killing activity for PMN, migration of PMN in response to IL-8 in a transwell system was not restored in the presence of this mutant degrades the CXC chemokines, such as human IL-8, Groα, murine KC and MIP-2 scpC) and analyzed the property in a PMN migration assay. The results showed that NIH230scpC neither digested IL-8, like 1566 strain, , slo and the scpC genes were expressed in the severe invasive GAS greater in extent than those in the non-invasive GAS. The expression of the other virulence-associated genes, such as IgG degrading protease of GAS, Mac-1-like protein (mac), nicotine adenine dinucleotide glycohydrolase (nga), polysaccharide capsule production (hasA), and C5a peptidase (scpA), was also upregulted in the severe invasive GAS, greater than that detected in the non-invasive GAS (speB), SLS (sagA), and mitogenic factor (speF) genes were downregulated in the severe invasive GAS, compared to that found in the non-invasive GAS . However, as shown in csrS genes of all clinically isolated severe invasive GAS had a deletion, a point mutation, or an insertion, thereby, resulting in the creation of translational stop codons or in a mutation in the presumed kinase domain (NIH200). In order to clarify the role of CsrS regarding expression of the virulence-associated genes and resistance to PMN killing, we introduced the intact csrS gene of the 1566 strain into the severe invasive GAS (p = 0.002 compared with invasive isolates +CsrS) (p = 0.00016 compared with invasive isolates +CsrS) , abrogats +CsrS) , and 6B,s +CsrS) , and 6C,csrS, in infections in vivo, we compared the virulence of GAS isolates using a mouse model which infected GAS intraperitoneally. The non-invasive 1566 strain displayed the LD50 value approximately 100-fold higher than that of the severe invasive NIH230 strain (csrS deletion (1566ΔcsrS) caused an increase in the LD50 value comparable to that of the NIH230 strain. Consistently, an introduction of the intact csrS gene into the NIH230 strain (NIH230::+csrS) reduced the LD50 value to the level observed in the non-invasive strain. These results indicate that csrS is an important virulence factor in the mouse model of lethal infections.In order to elucidate the role of 0 strain , whereas+csrSas well as the 1566 strain . Histopathologically, in the mice injected with the NIH230 strain, bacteria formed clusters in interstitial tissues in the kidneys and the lungs, accompanied congestion and no inflammatory cells at infectious foci (manuscript in preparation), suggesting the csrS mutation is more important in comparison with that of csrR in the clinical isolates regardless of emm genotypes. Furthermore, the expression of some human invasive disease-associated genes slo was enhanced in the csrS mutant emm49 severe invasive GAS was lower than that of non-invasive GAS without agitation or on tryptic soy agar supplemented with 5% sheep blood. Cultures were grown at 37°C in a 5% CO2 atmosphere. When required, antibiotics were added to the medium at the following final concentrations: erythromycin, 500 µg/mL for E. coli and 1 µg/mL for S. pyogenes; spectinomycin (Sp), 25 µg/mL for E. coli and S. pyogenes both. The growth of S. pyogenes was turbidimetrically monitored at 600 nm using MiniPhoto 518R .The Male 5–6-week-old outbred ddY and hairless mice were purchased from SLC and were maintained in a specific pathogen-free (SPF) condition. All animal experiments were performed according to the guidelines of the Ethics Review Committee of Animal Experiments of the National Institute of Infectious Diseases, Japan.PMN were taken from nine healthy volunteers which were composed of 25–52 years old, 7 males and 2 female, and were isolated from venous blood of them using in accordance with a protocol approved by the Institutional Review Board for Human Subjects, National Institute of Infectious Diseases.DNA amplifications by PCR, DNA restriction-endonuclease digestions, ligations, plasmid preparations, and agarose gel electrophoresis were performed according to standard techniques 2) competent E. coli cells were prepared and transformed according to a standard protocol S. pyogenes cells were prepared as described Calcium chloride was then selected by using spectinomycin-containing agar plates. Deficiency of the native slo gene was verified by PCR. Loss of SL hemoltitic activity of these mutants was confirmed by the standard SLS hemolysis assay and 5′-GGGAATTCTCTAATACACTATTTTACC-3′ (antisense). The PCR fragment was ligated into the plasmid pSF152 csrS was used for chromosomal integration into the mutated csrS gene of isolates from patients of severe invasive infections, as described previously r) were then selected by using spectinomycin (Sp)-containing agar plates. The integration of the csrS gene was confirmed by PCR.The S. pyogenes was grown in THY media at 37°C without aeration, and total RNA was extracted at OD600 of 0.75 by using the RNeasy Mini extraction kit (Qiagen). RT-PCR was performed by using a One Step RNA PCR Kit (AMV) according to the manufacturer's recommendation using the RT-PCR primer pairs shown in 50, We injected several dilutions of 0.5 mL of GAS isolate suspensions in phosphate-buffered saline (PBS) intraperitoneally into male 5–6-week-old ddY outbred mice . The exact numbers of the colony-forming units of the injected bacteria were determined by incubating adequate dilutions of each GAS sample on sheep blood agar plates. The data were analyzed for significance according to the Probit method to determine the LD50 values for a 7-day period. For a subcutaneous infection model, male hairless mice Hos:Hr-1 were injected 1×107 CFU in 100 µl suspension of GAS in PBS. Lesion area and body weight were measured daily, and analyzedTo determine LDFor histological analysis, the tissues from GAS-infected mice were fixed in 10% formalin/PBS. The paraffin-embedded sections were stained with hematoxylin and eosin .5 human PMN and 5×106 bacteria opsonized with human plasma and labeled with alexa 488 in a well of 24 well plates. After incubation for 60 min, PMN were harvested and stained with alexa-594 labeled anti-alexa 488 polyclonal Ab (Invitrogen) in order to distinguish non-phagocytosed but attached bacteria to PMN. The proportion of phagocytosed PMN were analyzed by FACS Calibur , For killing assay, PMN and opsonized bacteria in the same MOI as phagocytosis assay were incubated for 2 hours at 37°C, adding antibiotics at 60 min to eliminate non-phagocytosed bacteria. Corrected PMN were lysed in 0.1% saponin / PBS for 20 min on ice. Bacteria were washed with PBS and cultured on soy beans agar plate overnight, for counting the number of colonies.Phagocytosis and killing assay by PMN were performed as previously described with some modifications 5 PMN in RPMI medium containing 25 mM HEPES and 1% FCS were in Transwell inserts placed in 24-well plates containing 600 µl medium, or 100 nM IL-8 solution , which were incubated with or without 5×106 bacteria for 1 hour at 37°C in advance of the assay. After 1 hour incubation, cells in the lower wells were collected and 104 10 µm microsphere beads were added. Cells were stained with propidium iodine for flow cytometry to quantify viable PMN and were analyzed using FACSCalibur. In some experiments, cholesterol (Sigma), 25 µg/mL anti-SLO polyclonal Ab , or rabbit IgG was added in 24 well plates.Chemotaxis assay were performed as previously described with modification The amount of IL-8 in supernatant after incubation with bacteria was determined by Ready-to-Go human IL-8 ELISA kit according to manufacturers' protocol.The activity of SLO in supernatant is measured as previously described Overnight culture of various strains were frozen at −80°C, thawed, and centrifuged to obtain the supernatants. Serially diluted culture supernatants (0.1 ml) in PBS containing 250 µg/mL water-soluble cholesterol were incubated at room temperature for 10 min. A 0.1 ml aliquot of 5% (v/v) sheep erythrocyte was added and incubated for 1 h at 37°C. The mixture were subjected to brief centrifugation, and absorbance of the supernatants fluids was measured at 540 nm. To confirm that hemolysis was due to SLS, control reaction including culture supernatants to which trypan blue (Sigma), a specific SLS inhibitor, had been added to yield a final concentration of 13 µg/ml.Figure S1DNase activity is not involved in the virulence of emm49 severe invasive GAS isolates. a) To investigate the role of DNase in PMN survival, the viability of PMN that migrated in lower wells of transwell system was estimated as PMNs were applied into the upper well (5×105 cells) of a transwell system, and lower wells consisted of IL-8 in the presence or absence of DNase I , together with either non-invasive GAS (1566), or invasive GAS (NIH230). PMN migrated in lower wells were stained with propidium iodine and were analyzed using flow cytometry. b) Activity of DNase in emm49 GAS. 10 ng of Calf thymus DNA was incubated with or without culture supernatants from non-invasive, severe invasive, and CsrS-transduced severe invasive GAS for 15 min at 37°C. Activity to degrade calf thymus DNA was visualized by 1% agarose gel electrophoresis. Methods in vitro migration assay As shown 5×105 PMN in RPMI medium containing 25 mM HEPES and 1% FCS were in Transwell inserts placed in 24-well plates containing 600 µl medium, 100 nM IL-8 solution (Peprtec), 100 µg/mL deoxyribonuclease I which were incubated with or without 5×106 bacteria for 1 hour at 37°C in advance of the assay. After 1 hour incubation, cells in the lower wells were collected and 104 10 µm microsphere beads (Polysciences) were added. Cells were stained with propidium iodine (Sigma) for flow cytometry to quantify viable PMN and were analyzed using FACSCalibur (BD BioScience). DNase activity assays Supernatants were collected from overnight cultures of bacterial strains grown in THB. Calf thymus DNA (10 ng) was combined with bacterial supernatant in final volume of 50 ml buffer (300 mM Tris-HCl (pH 7.5), 3 mM CaCl2, 3 mM MgCl2) for 15 min at 37°C. To halt DNase activity, 10 ml of 0.5 M EDTA (pH 8.0) was added to the reaction. Visualization of DNA degrad tion was done in 1% agarose gel electrophoresis.(0.60 MB TIF)Click here for additional data file.Table S1Strains and plasmids used in this study(0.03 MB DOC)Click here for additional data file.Table S2Primers used for the construction of deletion mutants(0.03 MB DOC)Click here for additional data file.Table S3Primers used in RT-PCR(0.03 MB DOC)Click here for additional data file. |
PDCD4) has been found to be under-expressed in several cancers and associated with disease progression and metastasis. There are no current studies characterizing PDCD4 expression and its clinical relevance in Oral Squamous Cell Carcinoma (OSCC). Since nodal metastasis is a major prognostic factor in OSCC, we focused on determining whether PDCD4 under-expression was associated with patient nodal status and had functional relevance in OSCC invasion. We also examined PDCD4 regulation by microRNA 21 (miR-21) in OSCC.The tumor suppressor Programmed Cell Death 4 OSCCs, with significantly reduced mRNA levels in patients with nodal metastasis (p = 0.0027), and marginally associated with T3-T4 tumor stage (p = 0.054). PDCD4 protein expression was assessed, by immunohistochemistry (IHC), in 28/50 OSCCs and adjacent normal tissues; PDCD4 protein was absent/under-expressed in 25/28 (89%) OSCCs, and marginally associated with nodal metastasis (p = 0.059). A matrigel invasion assay showed that PDCD4 expression suppressed invasion, and siRNA-mediated PDCD4 loss was associated with increased invasive potential of oral carcinoma cells. Furthermore, we showed that miR-21 levels were increased in PDCD4-negative tumors, and that PDCD4 expression may be down-regulated in OSCC by direct binding of miR-21 to the 3'UTR PDCD4 mRNA.Our data show an association between the loss of PDCD4 expression, tumorigenesis and invasion in OSCC, and also identify a mechanism of PDCD4 down-regulation by microRNA-21 in oral carcinoma. PDCD4 association with nodal metastasis and invasion suggests that PDCD4 may be a clinically relevant biomarker with prognostic value in OSCC. Oral squamous cell carcinomas (OSCCs) are malignant oral cavity tumors that account for 24% of all head and neck cancers . The prePDCD4) has been strongly associated with the progression and metastasis of multiple human cancer types. PDCD4 was first identified as a transformation suppressor gene in a mouse keratinocyte (JB6 cells) model of tumor promotion, in which high PDCD4 levels rendered cells resistant to transformation by the tumor-promoter 12-O-tetradecanoyl-phorbol-13-acetate (TPA) [PDCD4 is known to play a role in apoptosis but its specific mechanism has yet to be determined. Recent studies indicate that PDCD4 may have important roles in transcription, translation, and signal transduction pathways . PDCD4 or types -10. PDCDg cancer , hepatocg cancer , colon cg cancer , pancreag cancer and esopg cancer . In epitinvasion . In coloinvasion , and itsPDCD4 is regulated by microRNA-21 (miR-21) [PDCD4 has been shown to be regulated by miR-21 in other cancers, such as colon carcinoma [microRNA (miR) target prediction databases suggest that miR-21) ,20. Rece ,20. Recarcinoma . Interesarcinoma . BindingPDCD4 levels were significantly decreased in OSCCs from node positive patients. We also demonstrated that PDCD4 is involved in invasion of oral carcinoma cells. Our data support a role for PDCD4 in OSCC invasion and metastasis. Further, we demonstrated that PDCD4 is regulated by miR-21 in OSCC. PDCD4 may have clinical utility for prediction, at the time of diagnosis, of which OSCCs may have a higher risk of neck nodal metastasis.Recent experimental evidence suggests that PDCD4 function may be different according to cell type , thus hiPDCD4 mRNA levels were decreased in 43/50 (86%) OSCCs, unchanged in six tumors and increased in one tumor compared to adjacent normal oral tissues . Lower PDCD4 mRNA levels were detected in OSCCs from patients with more advanced tumor stage , and were lower in tumors from patients with nodal metastasis and poorer DFS and poorer DFS . In the multivariate analysis, PDCD4 protein levels (as determined by IHC) were also associated with poorer DFS . Although decreased PDCD4 mRNA and/or protein levels were associated with survival and/or DFS, these data are based on a small cohort of 50 patients.Univariate analysis of survival and DFS showed that patients with lower ) Figure . Multivap = 0.059). PDCD4 mRNA and protein levels were correlated .Immunohistochemical analysis showed that PDCD4 was strongly expressed in the nuclei of normal oral squamous epithelia and it was used for all subsequent experiments [see Additional file vs. 24 ± 2%).The optimal amount of transfected PDCD4 or PCMV6 control plasmids were tested by measuring the toxicity of various amounts of plasmid in UT-SCC-24A. We found that both 200 ng and 500 ng of PDCD4 plasmid led to an increase in PDCD4 mRNA and protein compared to the control. A plasmid concentration of > 500 ng was toxic to the cells (< 60% cell viability after 72 hrs) [see Additional file Next, we determined the effect of over-expressing and silencing PDCD4 in UT-SCC-24A, 74A, and 87. Effective over-expression and knock-down of PDCD4 was confirmed by Western blot Figure . Post-trSince miR-21 is over-expressed and it has been shown to regulate PDCD4 in other cancers , we sougWe showed that transient transfection of both PDCD4 and PDCD4-UTRmut led to up-regulation of PDCD4 compared to control. Co-transfection of miR-21 and PDCD4 resulted in a significant decrease in PDCD4 protein expression; however when miR-21 was co-transfected with PDCD4-UTRmut, PDCD4 protein levels remained unchanged Figure . These rHerein, we identified PDCD4 under-expression at both the mRNA and protein levels in primary patient OSCCs and oral cancer cell lines. We showed that lower PDCD4 expression levels were significantly associated with regional disease , more advanced tumor stages, and poorer survival and disease-free survival of OSCC patients, suggesting that PDCD4 may have prognostic value in OSCC.PDCD4 expression was associated with disease progression. In addition, a consistent decrease in PDCD4 expression levels was associated with the steps from normal to borderline to malignant ovarian tissues, and PDCD4 over-expression in ovarian cancer cells resulted in malignant growth inhibition [PDCD4 has been identified as a suppressor of tumorigenesis with lost or reduced expression in cancers of epithelial origin, including the lung , breast hibition . In colohibition . In othehibition , and prohibition ,26. For hibition , shorterhibition , as wellhibition ,27 and lhibition .Despite all of these studies showing PDCD4 deregulation associated with important clinical parameters in different cancers, the regulatory mechanisms of PDCD4 are still not completely understood. Recent research indicates that PDCD4 play roles in transcription, translation of proteins important in neoplastic transformation, such as eukaryotic initiation factors (eIFs) , as wellIn our study, we showed that PDCD4 acted as a negative regulator of invasion in OSCC cell lines. Similar to our findings, PDCD4 suppressed the invasion and intravasation of colon cancer cells, implicating PDCD4 as regulator of invasion and metastasis . FurtherPDCD4. Several mechanisms of PDCD4 down-regulation were reported, such as hypermethylation of its 5' promoter region in glioma [Other mechanistic studies in colon cancer showed that PDCD4 knock-down activates β-catenin/Tcf-dependent transcription and acts as a promoter of tumor cell invasion . A recenn glioma , increasn glioma , and siln glioma .miR-21 has been shown to down-regulate PDCD4, leading to an increase in cell proliferation, invasion, metastasis, and neoplastic transformation of breast cancer lesions ,41. AddiConsidering that PDCD4 functions as a tumor suppressor gene and that it may have potential applications as a therapeutic target , understOur study showed significant PDCD4 under-expression/loss in malignant oral cavity tissues. Prominent loss of PDCD4 expression in metastatic OSCCs, correlated with poorer survival and poorer disease-free survival of OSCC patients suggests that PDCD4 may be a clinically relevant biomarker with prognostic value. PDCD4 loss may be one of the crucial steps required for invasion and metastasis of OSCC. In addition, our data also suggest that PDCD4 under-expression in OSCC may be regulated by miR-21.This work was performed with the approval of the University Health Network Research Ethics Board. All patients signed informed consent before sample collection and were untreated before surgery. Tissue samples were obtained at time of surgery from the Toronto General Hospital, Canada. Patients are representative of the typical OSCC population within North America . This stQPCR: QPCR analysis was performed in 50 primary patient OSCC samples. A subset of these patients (25/50) also had adjacent normal tissue (> 0.5 cm away from the tumor) collected. The detailed patient clinical data are described in Table 2 humidified incubator. A normal oral mucosa cell line was used as control. HOK cells were maintained in oral keratinocyte media, supplemented with 1% keratinocyte growth factor plus epithelial growth factor mixture (Invitrogen).Six OSCC cell lines , derived from primary patient samples, were supplied by Dr. Reidar Grénman, University of Turku, Finland . Cell liTotal RNA was extracted from patient samples and cell lines, using Trizol reagent , followed by purification using the Qiagen RNeasy kit and treatment with the DNase RNase-free set , all according to manufacturers' instructions. RNA was quantified using Nanodrop 1000 (Nanodrop); quality was assessed using the 2100 Bioanalyzer . The RNA samples used were all of sufficient quality for gene expression analysis.PDCD4 mRNA levels were examined in 50 OSCCs and 25 adjacent normal oral tissues, to verify whether PDCD4 was under-expressed in OSCCs and correlated with relevant clinicopathological data of patients. QPCR analysis was performed using the 7900 Sequence Detection System and the SYBR Green I fluorescent dye as previously described [GAPDH was used as the internal control gene. Primer sequences were: PDCD4 Forward: 5'-ggcctccaaggagtaagacc-3'; Reverse: 5'-aggggtctacatggcaactg-3' and GAPDH Forward: 5'-aagggaaggttgctggatagg-3'; Reverse: 5'-cacatccacctcctccacatc-3'. Reactions were performed in triplicate for each sample and primer set. Dissociation curves were run for all reactions to ensure primer specificity and lack of PCR artifact. PCR products of randomly selected reactions were run on 1.5% agarose gels and visualized under UV, to verify presence of the appropriate-sized amplicon. PDCD4 mRNA levels in OSCC were normalized against 25 adjacent normal oral samples. Data were analyzed using the Delta Delta Ct method [t method .Tumor samples from 28/50 OSCC patients were analyzed by IHC. H&E-stained sections were examined for each patient. OSCCs included adjacent normal tissue in the same tissue section, which was used as the normal control. Tissue sections (4 μm) were cut from FFPE blocks and IHC staining was performed using the Avidin-Biotin method . SectionPDCD4 expression was evaluated semi-quantitatively , considePDCD4 mRNA expression and clinicopathological data were performed using the Rank-Sum test. The Fisher's exact test was used to correlate PDCD4 protein expression and clinical data. PDCD4 protein expression was dichotomized as negative (under-expressed) for scores 1-4 and positive (no-change or over-expressed) for scores 5-7.Associations between 1-T2 vs. T3-T4, and for N category, tumors were grouped as node negative (N0) vs. node positive . Overall survival analysis was done using the Kaplan-Meier method. Survival was defined as the time between surgery date and death or last follow-up. Disease free survival (DFS) was defined as time between surgery date and recurrence or death or last follow-up. Statistical significance of differences between survival curves was assessed using Log-Rank test; Hazard Ratios (HR) and Confidence Intervals (CI) were calculated.For association with T category, tumors were grouped as Thttp://ophid.utoronto.ca/i2d, with an update for BioGrid, DIP, HPRD, IntAct, MINT PPI data obtained 1/2010) [http://ophid.utoronto.ca/navigator/[In order to determine functional relationships among the PDCD4 targets we mapped the 8 proteins , CDH1) to their corresponding SwissProt identifiers (SPIDs) [see Additional file 1/2010) . PPI datavigator/.E. coli cells were transformed with each plasmid and selectively expanded in ampicillin, using standard protocols. DNA was extracted using the Plasmid Midi-prep Kit (Qiagen) according to the manufacturer's protocol. DNA was quantified using Nanodrop 1000 (Nanodrop). In order to knock-down PDCD4 expression, we used a PDCD4 siRNA (50 μM) and control siRNA (50 μM) .We used a commercially available PDCD4 expression plasmid, PCMV6-XL4-PDCD4 (Origene) and a control plasmid, PCMV6-XL4 . The PDCD4 plasmid consisted of the 2,640 base pair PDCD4 cDNA sequence (RefSeq: NM_014456) inserted into the PCMV6 multi-cloning site. 5 cells/well) in DMEM containing 10% FBS, 1% Penicillin-Streptomycin and 1% L-Glutamine. Subsequently, cells were transiently transfected using previously described protocols [Cell lines were seeded in 6-well plates , which were successfully transfected with PDCD4, PDCD4 si-RNA or controls . Transwell invasion assay experiments were carried out as previously described . Cells tSamples were harvested from UT-SCC cell lines, total protein was extracted and protein concentration was determined using the Bradford Assay (Bio-Rad) as per manufacturer's instructions. Western blotting was performed using 25 μg of protein, according to standard procedures . ImmunodPDCD4 transfection did not affect cell viability, as verified by flow cytometry analysis using propidium iodide staining (data not shown).PDCD4 was a direct target of miR-21 in UT-SCC cell lines, or whether miR-21 was indirectly regulating PDCD4 by targeting another gene. For this, we first identified the sequence of potential miR-21 binding sites in the 3'UTR of PDCD4, using the online resource microRNA.org [PDCD4 with an alignment score of 157, based on the number of matching base pairs between the miR and its predicted binding site. Previous reports confirmed this potential miR-21 binding site at the 3'UTR of PDCD4 [Since miR-21 is predicted to target PDCD4 ,50,51, woRNA.org ,52. Accoof PDCD4 ,53.miR-21 levels were examined in the 28 patient OSCCs that had both PDCD4 mRNA and protein data available. PCR-based detection of mature miR-21 was performed using the TaqMan micro-RNA assays (Applied Biosystems). RT reactions were carried out using 100 ng total RNA by Multi-Scribe Reverse Transcriptase 50 units) in the presence of 1 mM dNTPs, 1× Reverse Transcription Buffer (Ambion) and RNase inhibitor (0.25 units) and miR-specific primers against the target sequences . miR-21 levels were normalized against RNU44 endogenous control miR , and cal0 units ittctaaggaattcccttttgtaagtgcc-3'; Reverse: 5'-ggcacttacaaaaggcccgggcttagaatattccacttaagaagaggttacttttctgtgtccctcc-3'. The PCR product was digested with the DpnI restriction enzyme, to remove any non-mutated DNA template. The digestion product was then transformed into competent DH5-alpha cells and plated onto ampicillin (50 ng/mL) coated agar plates; colonies were expanded and plasmid DNA was extracted using the Plasmid Mini-prep Kit (Qiagen). Sequencing analysis was performed and confirmed the presence of the PDCD4-UTRmut. PDCD4-UTRmut plasmid was then expanded in E. coli and plasmid DNA was extracted using the Plasmid Midi-prep Kit (Qiagen). 200 ng of PDCD4 or PDCD4-UTRmut plasmid were co-transfected with 50 pmol pre-miR-21 or scramble-miR (control) (Ambion). The pre-miR-21, anti-miR-21 and control miR (Ambion) were re-suspended in nuclease-free water to a concentration of 50 μM. Transfection experiments were performed in UT-SCC74A, as previously described [The full length PDCD4 sequence (Origene) was used as a template to introduce mutations at the miR-21 binding site (PDCD4-UTRmut). This assay used the QuikChange Lightning Site-Directed Mutagenesis Kit (Stratagene). Briefly, PCR was performed using PDCD4 as template and primers designed to introduce point mutations (bold); Forward: 5'-ggagggacagaaaagtaacctcttaagtggaataescribed . RNA andThe authors declare that they have no competing interests.PPR and MT performed most of the work and contributed equally to this manuscript. PPR, MT, MS and SKR designed the study. PPR and MT performed analysis of patient samples. PPR and MS drafted the manuscript. MT conducted all functional experiments and edited the manuscript. NKC and JM performed part of the PCR experiments. JM contributed with study design. IJ and MP performed bioinformatics and statistical analyses, respectively. BP-O performed histopathological analysis of samples and scored the immunohistochemistry data. RG, PG and JI collected samples and helped collect clinical data. SKR supervised the study, helped with manuscript writing and approved the final manuscript. All authors read and approved the final manuscript.Cell viability of UT-SCC-24A after transfection with 200 ng, 500 ng, 1000 ng or 2000 ng of either PDCD4 or PCMV6 control plasmid compared to mock-transfected.Click here for file(A) Representation of invasion of UT-SCC-24A transfected with either transfection reagent alone , 200 ng or 500 ng PCMV6 or PDCD4 plasmid; (B) Quantification of invasion. Data are plotted mean ± SE.Click here for fileClinical details of the 28 patients used for PDCD4 IHC analysis. These are a subset of patients shown in Table Click here for filePDCD4 network representation in XML file for NAViGaTOR, and annotation table.Click here for file |
The objectives were to investigate into the relationship between lipid profile including Apolipoprotein-A1 (Apo-A1) and Apolipoprotein-B (Apo-B) and smokers and to relate them with smoking pack years.A total of 274 active male smokers without any other illnesses and age matched male healthy control subjects (78) with similar socio-cultural background were assessed for clinical details, dietary habits, physical activities, smoking and alcohol consumption. Standard methods were adopted to check the lipid levels. The data were analyzed statistically.Their ages ranged from 40 to 59 years, systolic BP from 110 to 130 mmHg, and diastolic BP from 76 to 88 mmHg. All of them had similar pattern of diet . None was on any medication influences lipid level. Their physical activity was moderate. Number of pack years varied from 10 to 14 (mild), 15 to 19 (moderate) and 20 and above (heavy) among 69, 90 and 115 cases, whose mean ages were 43, 44 and 49 respectively. The mean (+SD) values in mg/dl of total cholesterol (TC), Triglyceride (TGL), Apo-B, low density lipoprotein (LDL) cholesterol, high density lipoprotein (HDL) cholesterol and Apo-A1 in mg/dl among mild/ moderate/ heavy smokers and control subjects were 198 (30.6)/ 224 (27.2)/ 240 (24.3) and 160 (20.4); 164(42.6)/ 199 (39.5)/ 223(41.7) and 124 (31.6); 119 (24.9)/ 121 (27)/ 127 (28.3) and 116 (21.4); 94 (19.7)/ 104 (21.8)/ 120 (20.5) and 82 (17.6); 42 (5.9)/ 39 (3.1)/ 35(4.4) and 48 (5.3); and 120 (17)/ 119 (21)/ 115 (25) and 126 (19), respectively. In smokers, there was a rise in TC, TGL, LDL, Apo-B and fall in HDL and Apo-A; these changes were significant (P < 0.05).Number of pack years was directly proportional to abnormal lipid profile. It is also concluded that changes in Apo-A1 and Apo-B were more significant when compared to HDL and LDL cholesterol among smokers. In the view of double risk for smokers efforts may be made to introduce smoking cessation program. Smoking is an escalating health problem especially in developing countries such as India. Cigarette smoking is a known risk factor for peripheral, coronary and cerebral atherosclerotic vascular diseases. Cigarette smoking leads to the uptake of many hazardous compounds and their metabolites extracted from burning tobacco. These substances may be electrophilic and react with biological molecules, and give rise to oxidative stress through the formation of reactive species or the initiation of lipid peroxidation chain reactions in the membranes. Plasma Previously published reports suggest their oxidatively modified low density lipoprotein (LDL) is taken up by macrophages to form foam cells in culture and aggravate the process of atherosclerosis. Also, tMiddle aged healthy males smoking cigarettes over 10 pack years and hailing from Chennai, capital of Tamil Nadu State of Southern India attending Master health checkup program (MHCP) formed the subjects of the study. Another group of non-smoking age matched male candidates attending MHCP were included as control subjects. The work was carried out after an approval from Institutional ethical committee and informed consent from each participant according to Helsinki Declaration Guidelines.State Government of Tamil Nadu has introduced MHCP in Government Medical College hospital and district head quarters hospitals wherein any interested or referred persons can ask for health check-up. Subjects are instructed to come in fasting for 12 hours. During checkup, qualified physician takes complete health history including health complaints, past, family and social histories, and physician does general and physical examination of body systems. Then, individuals are subjected to laboratory evaluation such as complete blood count, blood sugar, lipid profile, renal and liver function, and urine analysis including chest X-ray, ultra sonogram of abdomen and electrocardiogram for a nominal fee. If the individual is found to have any illness, he/she will be referred to respective specialty for management. Counseling and guidance will be provided to those who require life style modification.Since smoking is extremely rare among women in this area due to cultural reasons, women were not included. Individuals if found to have any associated co-morbid illness or taking regular medication including vitamin/mineral supplements/herbal/native medicines were excluded. Clinical history was elicited to rule out any acute injury or infectious episode and/or anti-microbial therapy over the last six weeks. Patients with family history of lipid disorders were not included.The socio-demographic and clinical data were collected. Dietary history and physical activity were elicited as per Indian Council of Medical Research.Smoking history was elicited in detail and smoking pack year was then calculated by using formula, {(Number of cigarettes smoked per day × Number of years smoked)/20}. In our study, smokers were classified into mild, moderate and heavy based on the number of pack years as 10 to 14, 15 to 19, and 20 and above, respectively.Blood was drawn from the subjects after 12 hours fasting with staple food for two days. Enzymatic method was used to estimate total cholesterol (TC) and triglycerides (TGL) using commercial kits. HDL cholesterol was determined by precipitation of phosphotungstic acid MgCl and LDL The data were tabulated and analyzed. Differences between mean values were evaluated by student 't' test. The statistical significance was assessed by using chi-square test .There were 274 smokers and 78 controls. Their ages ranged from 40 to 59 years. Their systolic blood pressure and diastolic blood pressure ranged from 110 to 130 and 76 to 88 mmHg, respectively. Most of them were vegetarians with occasional meat (varied from 3 to 5 times per month) and rice was their staple food. The subject groups consumed coffee or tea from 2 to 3 times per day. All subject groups had moderate physical activity of at least 30 minutes per day. Overall, there was no difference noticed among smokers and non-smokers with reference to diet, physical activity and life style except smoking. Among smokers the number of pack years varied from 10 to 14, 15 to 19, and 20 and above among 69, 90 and 115 cases, whose median ages were 43, 44 and 49 respectively. The mean values of TC, TGL, LDL, HDL, Apo-B and Apo-A1 for smokers and non-smokers (control subjects) are depicted in Table Previous studies have demonstrated a rise in TC, TGL, LDL and Apo-B, and a fall in HDL and Apo-A in smokers; and this association is dose dependant ,10,131414,15. ItSmoking is associated with coronary artery disease (CAD) and other vascular disorders, cancer, chronic obstructive pulmonary disease (COPD) etc., Several mechanisms were proposed to explain the deleterious effect of tobacco. For the occurrence of cardiovascular disease among smokers alteration in plasma lipid profile was implicated. In this context, the mechanisms for the altered lipid profile among smokers were recalled .(i) Nicotine stimulates the release of adrenaline from the adrenal cortex leading to increased serum concentration of free fatty acids (FFA)which further stimulates hepatic synthesis and secretion of cholesterol as well (ii) Smoking decreases estrogen levels and further leads to decreased HDL cholesterol concentration ,23. Also(iii) Smoking increases insulin resistance and thus, causes hyperinsulinemia. LDL, VLDL and TGL are elevated in hyperinsulinemic conditions due to decreased activity of lipoprotein lipase .Inconsistent observations were noticed for smoking mediated LDL change. Some suggested that the effect of smoking on LDL is mediated through reduction in lipoprotein lipase ,25 whichSmokers had significantly higher level of Apo-B ,35 and hAbnormalities in lipid profile are directly correlated with smoking and duration of smoking pack years in this study. Since apolipoprotein changes occur earlier than cholesterol level, it would be advisable to include apolipoprotein concentration in lipid panel. Further studies are warranted to establish the role of apolipoprotein concentration in patients on lipid lowering therapy as a guide for response to therapy and genomic factors in apolipoprotein synthesis. Cessation of smoking not only reverses lipid changes but also vascular diseases, especially CAD. Passive smokers are prone to get the same abnormality as demonstrated in literature and our on-going analysis. Hence, policy makers should amend a firm law to prohibit smoking in the public places, thereby decreasing the passive smokers in the community. Intense education program about adverse health events of smoking should be under taken through all means including audio-visual media to the public and to students through their curriculum.Strength of the study was rigid criteria adopted to select the subjects. Limitation being the study was confined to males of specific age group belonging to the same geographical area.The authors declare that they have no competing interestsRM carried out study design, study protocol, sample collection, statistical analysis, references collection and manuscript drafting. CR and PT took part in study design, study protocol, approval, revision of statistical work and manuscript. All authors read and approved the final manuscript. |
Colorectal cancer-specific and overall mortality according to quintiles of predicted 25(OH)D levels were assessed. Cox proportional hazards models were used to calculate hazard ratios (HRs) adjusted for other risk factors of survival.P trend=0.02) and overall mortality (P trend=0.002). Compared with levels in the lowest quintile, participants with predicted 25(OH)D levels in the highest quintile had an adjusted HR of 0.50 for cancer-specific mortality and 0.62 for overall mortality.Higher predicted 25(OH)D levels were associated with a significant reduction in colorectal cancer-specific (Higher predicted 25(OH)D levels after a diagnosis of colorectal cancer may be associated with improved survival. Further study of the vitamin D pathway in colorectal cancer is warranted. Binding of VDR by 1,25(OH)2D leads to differentiation and apoptosis (poptosis .P<0.0001) (The best indicator of vitamin D status is plasma 25(OH)D level, as it reflects not only total vitamin D intake but also cholecalciferol production in the skin from type B ultraviolet (UV-B) radiation and hydroxylation of all sources of cholecalciferol in the liver. Prospective studies have shown that higher baseline plasma levels of 25(OH)D are associated with a significant reduction in the risk of colorectal cancer D levels. This 25(OH)D score takes into account the combined influence of the major determinants of vitamin D status . In previous analyses, the score was correlated with plasma 25(OH)D levels and was significantly associated with the risk of developing colorectal cancer reported a diagnosis of colorectal cancer, we asked permission to obtain hospital records and pathology reports, and blinded study physicians reviewed and recorded information on tumour characteristics. For non-respondents, we searched the National Death Index to discover deaths and ascertain any diagnosis of colorectal cancer that contributed to death. We estimate that 96–97% of cases were identified through these methods .Individuals in this analysis were participants with pathologically confirmed colorectal adenocarcinoma diagnosed between 1986 and 2004.Participants in the study cohort were followed until death or 2006. Ascertainment of deaths included reporting by family or postal authorities, and names of persistent non-responders were searched in the National Death Index D for men in the highest decile of predicted 25(OH)D was 11 ng ml−1 higher than that of men in the lowest decile (1 ng ml−1=2.496 nmol l−1).Derivation of the 25(OH)D prediction score has been described previously . Race, gP trend<0.001), and the difference in the mean actual 25(OH)D level between extreme deciles was 10 ng ml−1, similar to the difference of 11 ng ml−1 in the initial dataset. Finally, in a separate analysis of 47 800 men, a statistically significant inverse association was observed between predicted 25(OH)D levels and the risk of developing colorectal cancer D score was calculated for an independent sample of 542 men in HPFS who also had available plasma 25(OH)D measurements (Predicted 25(OH)D levels were calculated for our study cohort using the regression coefficients in Prognostic factors known to influence cancer mortality were extracted from the medical record, including age, stage, grade of differentiation, tumour location, and year of diagnosis. In addition, BMI, physical activity, and total energy-adjusted calcium intake were taken from the questionnaire administered immediately before diagnosis. Race and season of diagnosis were also evaluated, but not found to be confounding variables, and were therefore excluded from the multivariable model. All analyses were adjusted for the cohort.P-values. To facilitate the display of our results, predicted 25(OH)D levels were defined in quintiles. Cox proportional hazards models were used to calculate hazard ratios (HRs) of death, adjusted for other risk factors for cancer survival. The HRs were calculated according to quintiles of predicted 25(OH)D levels, with the lowest quintile as the reference group. The proportionality of hazards assumption for the effect of predicted 25(OH)D level was satisfied by examining it as a time-dependent covariate in the Cox model.Death from colorectal cancer was the primary end point, and death from any cause was a secondary end point. The primary statistical analysis used the two-tailed linear test for trend with predicted 25(OH)D level as a continuous variable, consistent with earlier studies D levels were examined using Kaplan–Meier curves and the log-rank test . Tertile−1 of predicted 25(OH)D levels for cancer-specific and overall mortality were reported. Tests of interaction between predicted 25(OH)D levels and relevant covariates were assessed by entering in the model the cross product of predicted 25(OH)D level as a continuous variable with the covariate as a continuous or binary variable. All analyses used SAS software, version 9.1 .Subgroup analyses were performed, and adjusted HRs and 95% CIs for an increment of 10 ng ml−1 in NHS and 29.18 ng ml−1 in HPFS. This pattern is consistent with what we saw in our previous analysis of pre-diagnosis plasma 25(OH)D levels and colorectal cancer survival, in which circulating 25(OH)D concentrations were also slightly higher in men than in women: median plasma 25(OH)D level was 27.1 ng ml−1 in men and 23.9 and 25.7 ng ml−1 for two laboratory runs in women D levels across extreme deciles of predicted 25(OH)D in the original and validation cohorts.Among 1017 eligible participants, there were 283 deaths, 119 of which were due to colorectal cancer. The median time of follow-up of participants who were still alive was 116 months (range 41–238 months). The median predicted 25(OH)D level was 27.18 ng mlBaseline characteristics according to quintiles of post-diagnosis predicted 25(OH)D levels are shown in P trend=0.02) for cancer-specific mortality and 0.62 for overall mortality.Higher post-diagnosis predicted 25(OH)D levels were associated with a significant reduction in colorectal cancer-specific and overall mortality . This reP trend=0.04) for cancer-specific mortality and 0.62 for overall mortality, comparing extreme quintiles. Similarly, when we controlled for physical activity, we continued to observe a benefit for higher post-diagnosis predicted 25(OH)D levels, with an adjusted HR of 0.44 for cancer-specific mortality and 0.67 for overall mortality. When both BMI and physical activity were included in the model, the adjusted HR was 0.45 for cancer-specific mortality and 0.66 for overall mortality.We considered the possibility that the 25(OH)D score may be acting as a surrogate for the causal factor, such as BMI or physical activity, which are both in the prediction equation. We therefore repeated our analyses after adjusting for BMI and physical activity. When BMI was included, the significant relationship between post-diagnosis 25(OH)D score and cancer-specific and overall mortality did not change. The adjusted HR was 0.51 . Compared with those in the lowest quintile, patients in the highest quintile of vitamin D intake had an adjusted HR of 0.72 for overall mortality.Moreover, when both BMI and physical activity were included in our model, the remaining components of the post-diagnosis 25(OH)D score that were not ‘accounted for’ were region of residence, race, and dietary and supplemental vitamin D intake. We therefore explored the impact of each of these individual variables on mortality in our study cohort, and found that patients who reported higher total vitamin D intake showed a trend towards lower risk of death (P trend=0.008) for cancer-specific mortality and 0.56 for overall mortality, comparing extreme quintiles. Of note, the addition of race and season of diagnosis to the multivariable model also did not change the adjusted HRs for cancer-specific and overall mortality. When race was added to the model, the adjusted HR comparing extreme quintiles was 0.53 for cancer-specific mortality and 0.65 for overall mortality. When season of diagnosis was included, the adjusted HR was 0.49 for cancer-specific mortality and 0.63 for overall mortality.We also adjusted for calcium intake in our models and found a persistent significant association between post-diagnosis predicted 25(OH)D levels and survival. The adjusted HR was 0.44 for cancer-specific mortality and 0.63 for overall mortality.Given that lower levels of post-diagnosis predicted 25(OH)D could reflect the presence of occult cancer or other major illness, we excluded patients who died within 6 months of their post-diagnosis assessment. We continued to observe significant reductions in the risk of cancer-specific and overall mortality with increasing post-diagnosis 25(OH)D scores, with participants in the highest quintile having an adjusted HR of 0.50 . Higher pre-diagnosis 25(OH)D scores were found to be associated with a decrease in cancer-specific and overall mortality . When we adjusted for pre-diagnosis predicted 25(OH)D levels as well as other predictors of cancer survival in our model, higher post-diagnosis predicted 25(OH)D levels were still associated with a significant reduction in both cancer-specific (P trend=0.02) and overall (P trend=0.008) mortality, whereas the effect of pre-diagnosis predicted 25(OH)D level was no longer significant.In a separate analysis, pre-diagnosis 25(OH)D scores were calculated for colorectal cancer patients with available information (P interaction=0.06).We examined the influence of post-diagnosis 25(OH)D scores across the other predictors of cancer mortality . StratifAmong patients with colorectal cancer, higher post-diagnosis predicted 25(OH)D levels were associated with a significant reduction in cancer-specific and overall mortality. This relationship was evident even after excluding patients who died within 6 months of their post-diagnosis 25(OH)D assessment, and across different subgroups of patients.P<0.03) D levels are associated with a significant reduction in risk of colorectal cancer (We have previously shown that higher pre-diagnosis plasma levels of 25(OH)D are associated with a significant 48% reduction in overall mortality 2D We found that season of diagnosis may modify the effect of predicted 25(OH)D levels on overall mortality, with participants diagnosed in the winter or spring showing a slightly greater reduction in the risk of death. Perhaps the impact of higher vitamin D levels is greater in the winter and spring, when sunlight exposure is at a minimum. For example, a patient with colorectal cancer with a high post-diagnosis 25(OH)D score, despite decreased UV-B exposure in winter and spring, may have a survival advantage over a patient with a low score in these seasons.The strengths of our study include its prospective design, use of a validated prediction score, data on many potential confounders, and excellent follow-up rate. As participants were health professionals, the accuracy of self-reported data is likely to be high. To our knowledge, this study is the first to examine colorectal cancer survival by use of a comprehensive assessment of factors that determine 25(OH)D level. The similarity of our findings for survival based on one measurement of plasma 25(OH)D level and those based on our predictor score indicates that each may provide comparable information on long-term 25(OH)D level, the presumed factor of interest.The most apparent limitation of our approach is the possibility that our 25(OH)D score is acting as a surrogate for the causal factor, such as BMI or physical activity, through alternative mechanisms. Physical activity has previously been shown to be associated with improved outcomes in colorectal cancer patients . In contP trend=0.02) and overall mortality . Moreover, any impression in the 25(OH)D score among women in our study would bias results in that cohort tend towards the null.Although the 25(OH)D score had been developed and validated extensively in our cohort of men . Indeed,We also cannot completely exclude the possibility that lower levels of post-diagnosis predicted 25(OH)D reflect other occult predictors for poor prognosis. However, our findings remained unchanged after adjusting for potential risk factors of colorectal cancer mortality. To minimise bias in the post-diagnosis predicted 25(OH)D level by the presence of occult cancer or other major illness, we excluded patients who died within 6 months of their post-diagnosis vitamin D assessment, and continued to observe a positive impact of higher predicted 25(OH)D scores.In this cohort, data on treatment were limited. Approximately half of the participants had stage I or II disease, for which surgery alone is often the standard of care. In addition, although there have been changes in the chemotherapeutic treatment of colorectal cancer during the timeframe under study, we adjusted for year of diagnosis in our models. Furthermore, the fairly homogeneous socioeconomic and educational makeup of this cohort likely minimises any disparities in chemotherapy receipt D after a diagnosis of colorectal cancer may be associated with improved survival. Additional efforts to understand the mechanisms through which the vitamin D pathway influences colorectal carcinogenesis and cancer progression are warranted. |
Robot-assisted laparoscopy (RL) is used in a wide range of operative interventions, but the advantage of this technique over conventional laparoscopy (CL) remains unclear. Studies comparing RL and CL are scarce. The present study was performed to test the hypothesis that maiden users master surgical tasks quicker with the robot-assisted laparoscopy technique than with the conventional laparoscopy technique.20 subjects, with no prior surgical experience, performed three different surgical tasks in a standardized experimental setting, repeated four times with each of the RL and CL techniques. Speed and accuracy were measured. A cross-over technique was used to eliminate gender bias and the experience gained by carrying out the first part of the study.The task "tie a knot" was performed faster with the RL technique than with CL. Furthermore, shorter operating times were observed when changing from CL to RL. There were no time differences for the tasks of grabbing the needle and continuous suturing between the two operating techniques. Gender did not influence the results.The more advanced task of tying a knot was performed faster using the RL technique than with CL. Simpler surgical interventions were performed equally fast with either technique. Technical skills acquired during the use of CL were transferred to the RL technique. The lack of tactile feedback in RL seemed to matter. There were no differences between males and females. Conventional laparoscopic (CL) surgery may offer great advantages to patients but can be demanding for the surgeon because of several technical drawbacks. These limitations include 2-dimensional vision with less than optimal perception of depth, disturbance of the eye-hand-target axis, the fulcrum effect, rigid instruments with limited degrees of freedom and limited tactile feedback. These factors might attribute to the relatively long training period required before reaching a professional level ,2.® surgical system from Intuitive Surgical® has been available since 1998 and is still the only robotic surgical system available on the market approved for performing surgical interventions in humans. Several advantages with robot-assisted laparoscopy (RL) over CL have been identified: 3-dimensional visualization of the operative field with depth perception, additional degrees of freedom and downscaling of instrument movements, restoration of the eye-hand-target axis and enhanced stability, elimination of the fulcrum effect and improved ergonomics for the surgeon.The da VinciOne stated consequence of these features is that endoscopic surgical skills are more easily mastered and the learning curve is shortened -4. Some A definition of the learning curve can be the amount of practice, in terms of time or number of repetitions, needed to reach a certain level of proficiency for completing a specific task. Parameters used when analysing learning curves are time to complete the task, the number of errors made and actions required. Learning curves in daily practice are often defined by operating time, blood loss, morbidity and length of hospital stay . There iA power calculation, comparing two groups regarding proportions of the specific trait we wanted to study, was performed. At a given power of 80%, an alpha level of 0.05, and a proportion of 0.8 among cases, a sample of at least 12 cases and 12 control subjects is needed to meet a significant effect when the proportion among control subject is 0.2. A sample of 10 cases and 10 control subjects undergoing three repeated trials will be sufficient, although these repeated measures are mutually dependent.From a cohort of approximately 500 medical students at Lund University, volunteers were invited to participate in this project and from these, 20 subjects (10 men and 10 women), were randomly selected. The subjects were between 23 and 30 years old and had no prior practical experience of open surgery, CL or RL. There were no drop-outs or excluded participants.All the subjects were given the same standardized oral and written information by the trial instructor. The tasks the subjects were supposed to perform were also demonstrated once for each of the methods RL and CL before the trial started. One instructor and three evaluators, all working at the Department of Paediatric Surgery were used. The evaluators registered the subjects' performances in accordance with a predetermined template. The subjects were allowed to ask for guidance and the instructor gave them standardized advice along the way. The subjects were not allowed to observe or communicate with each other and were therefore isolated during the study.The primary and secondary end points were time and accuracy when performing the simulated surgical tasks using robotic and conventional laparoscopic instruments.® Surgical System from Intuitive Surgical®, a robotic needle holder, a robotic DeBakey® grasper, laparoscopic optics from KARL STORZ® 0° E-class 26003 AA, a laparoscopic needle holder 26173 KL and a laparoscopic grasper KARL STORZ® 33121, a Skin Pad in Jig® L & T 00131 from: http://www.limbsandthings.com and Vicryl® from Ethicon®, Polyglactin 910, 2-0 (3 Ph. Eur.), CP-1 36 mm 1/2 c 70 cm.Material and equipment used during the study were: the da Vinci® and tie a surgical knot. These tasks were done four times with each of RL and CL. The subjects were divided according to gender and half the males and half the females began with RL and CL, respectively. For each set, time and quality indicators (1-6 below) were recorded, giving us a total of 960 sets of data to analyze.The workstation was prepared in a standardized way and the participants were allowed to familiarize themselves with the instruments for two minutes before starting the trial. The thread was 20 cm long for both suturing and tying a knot. Each of the 20 students carried out three tasks, grab the needle in a correct way, place three continuous sutures over a rift in the Skin Pad in Jig1. Grab the needle - time in seconds2. Continuous suturing (3 stitches) - time in seconds3. Tie a knot (double) - time in seconds®? - yes/no4. Damage to the Skin Pad in Jig5. Dropped needle? - number of times/set6. Tearing of the thread? - number of times/set. [see Additional file th 2009 (Dnr 2009/59).Each subject's results from the RL and the CL, respectively, were recorded and mean values were calculated for the groups: RL first, CL first, RL last and CL last. The analysis was carried out using Wilcoxon's signed rank test for paired samples and the Mann-Whitney test of two independent samples before and after the cross-over. The transfer effect of difference in experience based on the RL users' prior CL experience and vice versa, was tested regarding the three surgical tasks using the Mann-Whitney test of two independent samples. Friedman's and Wilcoxon's signed rank test were used for analysis of tries of knot tying and suturing. Male and female participants were compared using the Mann-Whitney signed rank-test for paired samples. SPSS statistical software, version 15.0, was used for analysing the data. P < 0.05 was considered significant. This study was approved by the local regional ethical committee March 24® was equally common described by Reznick et al. is a validated tool widely used in the education literature. The OSATS is feasible, reliable and can be used for testing technical competence with high clinical relevance . Since wDropping the needle was more common in the RL group. Half of the subjects dropped the needle while performing CL and all but two while performing RL. Furthermore, the thread was only torn when using RL. Tactile feedback is not yet possible in RL, which is the most probable explanation for our findings. In spite of these differences, albeit significant, the performance when using RL was not slower in the task "continuous suturing" compared with CL. Without the dropping of the needle in the task "continuous suturing", RL might have been faster. Learning curves are also seen for a continuous suture for both RL and CL when comparing trials 1 and 4 Figure . The twoThe end points of our study, time and accuracy, may not be the best end points to measure. Length of pathway and economy of movement might be better predictors of learning curve and safe performance of laparoscopic surgery. A further possible limitation of our study is that error reduction, an important goal of training, was not measured. The study of Narazaki et al. suggests that both task completion time and distance travelled is shortened with training in novice users .The suggested advantage of faster laparoscopy in the RL group might not be relevant in clinical surgery since inexperienced users are not supposed to perform advanced laparoscopic surgery. Robotic surgeons today are often senior surgeons and already expert laparoscopists. However, the training to become an expert takes a lot of time and is costly, so learning curves are important also for the future education of young surgeons. If RL is proven easier to master with equal or better results than CL, robotic surgery could be an option for efficient surgical training. The many steps of a surgical intervention each have a learning curve and if learning curves are shorter for RL it may have some clinical relevance even at later stages of training.RL is still in its infancy but offers great opportunities for the future. Major improvements in the availability of tactile feedback and specifically designed instruments are necessary and expected soon. More research needs to be done to define the exact indications for RL to justify the increased costs and the increased time consumption involved, compared with CL.Whether or not these features with improved accuracy, dexterity and visualization enhance surgical performance remains unclear.In conclusion, we found support for our hypothesis that a surgical task, such as tying a knot, was performed faster using RL than with CL, while easier surgical tasks could be performed equally fast with either technique. The lack of tactile feedback in RL is a factor to consider at least for maiden users. Experience from one technique was transferred to the other. Our data do not support the suggestion that considerable CL experience is important for those starting to use RL. On the other hand, previous experience did matter in our study. No difference between the performances of male and female subjects was noted.When performing this work, there were no external influences or conflicts of interest. None of the authors or subjects received fees from the manufacturers of the material or the instruments used in the study reported here.The authors guarantee that the manuscript will not be published elsewhere in any language without the consent of the copyright owners, that the rights of third parties will not be violated, and that the publisher will not be held legally responsible if there should be any claims for compensation. This study complies with the current laws of the country in which it was performed. This work was performed in accordance with the rules of the ethical committee at our centre and the ethical standards laid down in the 1964 Declaration of Helsinki.MA designed the study, coordinated all steps of the study, collected and analyzed the data and wrote the paper. JL gathered all participants of the study, collected the data and took active part in writing of the paper. CCK participated in the design of the study, collected the data and took active part in writing of the paper. EA participated in the design of the study, collected and analyzed the data and took active part in writing of the paper. All authors read and approved the final manuscript.®The Skin Pad in Jig. The Skin Pad in Jig® as an *.jpg file, showing the needle, the placed running suture and the tied knot.Click here for fileThe tasks of this experimental study performed with robot-assisted laparoscopy. A short video showing the actual tasks in this experimental study performed with robot-assisted laparoscopy. Click here for file |
From the 1950s computer based renderings of molecules have been produced to aid researchers in their understanding of biomolecular structure and function. A major consideration for any molecular graphics software is the ability to visualise the three dimensional structure of the molecule. Traditionally, this was accomplished via stereoscopic pairs of images and later realised with three dimensional display technologies. Using a haptic feedback device in combination with molecular graphics has the potential to enhance three dimensional visualisation. Although haptic feedback devices have been used to feel the interaction forces during molecular docking they have not been used explicitly as an aid to visualisation.A haptic rendering application for biomolecular visualisation has been developed that allows the user to gain three-dimensional awareness of the shape of a biomolecule. By using a water molecule as the probe, modelled as an oxygen atom having hard-sphere interactions with the biomolecule, the process of exploration has the further benefit of being able to determine regions on the molecular surface that are accessible to the solvent. This gives insight into how awkward it is for a water molecule to gain access to or escape from channels and cavities, indicating possible entropic bottlenecks. In the case of liver alcohol dehydrogenase bound to the inhibitor SAD, it was found that there is a channel just wide enough for a single water molecule to pass through. Placing the probe coincident with crystallographic water molecules suggests that they are sometimes located within small pockets that provide a sterically stable environment irrespective of hydrogen bonding considerations.), one can explore the accessible surface of biomolecules using a three-dimensional input device to gain insights into the shape and water accessibility of the biomolecular surface that cannot be so easily attained using conventional molecular graphics software.By using the software, named HaptiMol ISAS (available from The sense of touch can be used to augment our visual sense to gain a deeper insight into the three dimensional shapes of complex objects. Biomolecules are examples of highly complex three dimensional objects which are often visualised using molecular graphics. Many software programs exist which attempt to convey the three dimensional form of structures utilising stereoscopic viewing methods and depth cues. However, the augmentation of our sense of sight with touch would be a useful aid in understanding the overall three dimensional shape of a biomolecule and in particular the fine surface details that cannot easily be seen whilst visualising the molecule as a whole. With what should one "touch" a biomolecule?Intuitively a sphere seems to be an obvious choice. Fortuitously, hard-sphere interactions between the biomolecule and a sphere of radius equal to an oxygen atom provides a reasonable model of solvent-solute interaction. Thus touching the biomolecular surface with a sphere the size of a water molecule one could also determine solvent-accessible regions of the biomolecule ,2. ModelIn the area of biomolecular research the probe is usually a small molecule, known to interact with the biomolecule, where the forces are due to electrostatic and van-der-Waals interactions. The application of haptics to "molecular docking" has quite a long history with the first such project, GROPE1, starting in 1967 at the University of Carolina . SimilarOur approach is quite different to previous applications of haptic rendering in the area of biomolecular simulation in that we aim to provide the user with a deeper appreciation of the complex three-dimensional shape of the molecule by combining a variety of graphical rendering techniques with haptic interactions. In the software a sphere, with a user-specified radius, is manipulated to interact with the chosen biomolecule. By using a probe sphere that is the same size as a water molecule, hard-sphere interactions with the biomolecule can be calculated to determine regions on the molecular surface that are accessible to water. In that sense our application could be called "Interactive Solvent-Accessible Surface" (ISAS).In this work molecules are represented as a space filling CPK model, with each atom defined as a separate sphere. In order to touch the biomolecular structure a haptic rendering algorithm must be created to compute forces as the user manipulates the Haptic Interface Point, HIP. The HIP is a single three dimensional coordinate defining the location of the end point of the haptic stylus within the virtual environment. A typical constraint-based single point haptic rendering algorithm involves approximating the surfaces of the objects in the virtual environment by polygonal meshes ,8. For tTo allow a probe sphere to be used with a user-specified radius the above single point algorithm need not be modified. Instead, the van der Waals radius of every atom is enlarged by the radius of the probe sphere. The single point haptic rendering algorithm then utilises the enlarged representation whilst the spherical probe and original molecule are displayed to the user. To achieve the interactive accessible surface simulation a probe sphere with a radius equal to the van der Waals radius of an oxygen atom can be created and centered at the location of the HIP. The force returned through the haptic device is designed to mimic the resulting hard sphere interactions between the probe and the contacting atoms on the biomolecule. The effect is to see and feel the water probe roll around over the hard surface of the biomolecule. In order to visually guide the user to regions on the biomolecular surface known to bind water molecules, crystallographic water molecules are rendered graphically but not haptically meaning they can be seen but not felt. Crystallographic water molecules are visualized as semi-opaque spheres through the use of alpha blending. These are referred to as "ghost water". To guide the user to specific residues or ligands the user can select from a variety of colours not contained within the CPK colour system and assign these to residues selected by residue number and chain identifier.. This approach works by visualising the region of the molecule which may be explored haptically as a cube, termed the "navigation cube". To explore areas of the molecule outside this cube, the user simply moves the probe sphere in the direction of a new location, as depicted in Figure To help the user orientate the molecule the backbone trace can be displayed , as depicted in Figure 1ADG) which is bound to SAD was used ethyl] methylphosphonothioate (VX) with PDB accession code selected . Figure Figure A haptic rendering application for biomolecular visualisation has been developed that allows one to gain three-dimensional awareness of the shape of a biomolecule. By using a water molecule as the probe, the process of exploration has the further benefit of being able to determine regions on the molecular surface that are accessible to the solvent. Aside from the simultaneous three-dimensional insight into the shape of the molecule, what other advantage would this method have over standard solvent-accessible surface area calculations? One obvious advantage is that one can easily appreciate the dimensions of a channel and the number of water molecules that would fit through it. Another advantage is that the accessibility of a channel or cavity can be appreciated. A cavity with an opening where the user has difficulty in maneuvering a water molecule could indicate an entropic bottleneck. In addition, placing the probe coincident with crystallographic water molecules gave the distinct impression that these are located within small pockets that provide a sterically stable environment for water molecules. None of this information would be directly attainable from standard solvent-accessible surface area calculations. It is clear that our approach has the limitation of not accurately modelling interactions and response due to flexibility that occurs when a water molecule approaches a biomolecule. Reduction of the probe radius could be used to model the effects of flexibility in a simple way. A better alternative would be to use the tool to compare accessilibility to channels and cavities in conformations generated from Molecular Dynamics simulations.Haptic rendering combined with molecular graphics allows the user to feel as well as see a complex three-dimensional object. In its application to biomolecular modelling it allows one to not only gain insight into the shape of a biomolecule, but by using a spherical probe equivalent in size to a water molecule, it also allows one to explore the solvent accessible surface interactively by rolling the probe over the molecule. Although many of the insights into cavity shape may be gained by purely graphical techniques, usage of the system has shown that it allows the user to assess the difficulty water molecules may have in accessing or escaping a cavity through the difficulty the user has in manoeuvring the probe through a constriction.This would not be easily appreciated through purely graphical techniques.Project Name: HaptiMol ISAS• Project Home Page: • Operating System(s): Windows 2000, XP, Vista 32bit, Vista 64bit• Programming Language: C++• Other Requirements: OpenGL version 2.0 or later is required for high quality rendering. However, if a lower version is detected the program will adjust the rendering algorithm accordingly. The software supports all Phantom Haptic Feedback Devices . OpenHaptics Software (Academic Edition) is available for free download.• License: Free• Any restrictions to use by non-academics: The current release is for non-commercial use only.• β-methylene-selenazole-4-2 carboxyamide-adenine dinucleotide; NAD: nicotinamide adenine dinucleotide.HIP: Haptic Interface Point; The virtual end point of the haptic device, this point is not visible to the user. SCP: Surface Contact Point; The point calculated in the surface tracking algorithm, this point is visible to the user. LADH: Horse Liver Alcohol Dehydrogenase; SAD: MBS and SDL designed and implemented the haptic rendering algorithms and software detailed in this paper. SH designed the requirements for the software taking into account the current limitations of software already available. SH selected the test cases, demonstrating the utility of the software, and coordinated user testing with other structural biologists. Each author drafted the part of the manuscript most directly related to them. All authors read and approved the final manuscript. |
Bacillus subtilis. Starting with a Finite State Projection (FSP) solution of the chemical master equation (CME), we develop efficient numerical tools for accurately computing competence probability. Additionally, we propose a new approach for the sensitivity analysis of stochastic events and utilize it to elucidate the robustness properties of the competence regulatory genetic circuit. We also propose and implement a numerical method to calculate the expected time it takes a cell to return from competence. Although this study is focused on an example of cell-differentiation in Bacillus subtilis, our approach can be applied to a wide range of stochastic phenomena in biological systems.Competence is a transiently differentiated state that certain bacterial cells reach when faced with a stressful environment. Entrance into competence can be attributed to the excitability of the dynamics governing the genetic circuit that regulates this cellular behavior. Like many biological behaviors, entrance into competence is a stochastic event. In this case cellular noise is responsible for driving the cell from a vegetative state into competence and back. In this work we present a novel numerical method for the analysis of stochastic biochemical events and use it to study the excitable dynamics responsible for competence in Bacillus subtilis, stress in the environment activates a sequence of chemical reactions that, driven by cellular noise, stochastically increases the level of ComK in some bacterial cells driving them from their original vegetative state into a competent state. Entrance into and exit from competence are stochastic switching events that the cell undergoes. In this work, we present a novel numerical method that allows the analysis of stochastic events in biological systems. We illustrate our method by computing the probability with which Bacillus subtilis enters in competence. We also present a method to analyze the sensitivity of stochastic events. We use this method to study the sensitivity of the probability of entrance in competence with respect to various gene expressions and degradation rates. We finally present a numerical method to calculate the expected time it takes a cell to return from competence. Although we studied the competence regulatory genetic circuit, our approach can be applied to a variety of stochastic events in biological systems.When exposed to stress, organisms react by taking actions that help them protect their DNA. ComK protein is a key regulator which activates hundreds of genes, including the genes encoding the DNA-uptake and recombination systems. In Competence is the ability of a cell, usually a bacterium, to bind and internalize transforming exogenous DNA. Under stressful environments, such as nutrient limitations, some cells enter competence while other cells commit irreversibly to sporulation. Entry in competence is a transient probabilistic event that facilitates copying of the exogenous DNA Auto-activation of the regulator ComK is responsible for the bistable response in competence development. Auto-activation of ComK, is essential and can be sufficient to generate a bistable expression pattern The contributions of this paper are threefold. First, it provides a new method to calculate exact probabilities of biological phenomena where transient behaviors such as competence, which is the topic we chose to study here, occur. Second, it shows how to calculate sensitivities of the probabilities of passing to the transient state with respect to the system's parameters. Third, it gives a methodology to calculate the expected time that it takes a cell to return from its transient state. All these methods can be used to analyze any biological system that has the characteristic of switching between two states, while staying for a while in the unstable state.In this paper we start by describing the chemical reactions and the deterministic model. We then generate the Chemical Master Equation (CME) of our proposed discrete stochastic model. The CME characterizes the evolution of the probability density of the different discrete states. We simulate it using the Stochastic Simulation Algorithm (SSA) and show how the solution can be approximated using the Finite State Projection method (FSP). We then conduct a sensitivity analysis studying the effect that the various system parameters have on the probability with which a cell enters in competence. This analysis shows the usefulness of our proposed numerical method in analyzing the roles of the different affinity, transcription and degradation rates, etc., in driving the cellular switching (between competence and vegetative states in this case). Finally, we analyze the roles of these parameters in determining the expected time a cell stays in competence.We introduce at the beginning the modeling techniques used to propose a set of equations that capture the behavior of interest. We then present our discrete stochastic Chemical Master Equation (CME) model, followed by the Stochastic Simulation Algorithm (SSA) used to approximate the solution of the CME. We proceed to present our Finite State Projection based method that makes it possible to analyze the CME exactly. We show how such a method can be tailored to answer many questions of biological interest.Competence is a physiological state that enables cells to bind and internalize transforming DNA. This state is accompanied by blockage of the essential cell's functions, and since this state is driven by the transcriptional factor ComK, it is no surprise that ComK synthesis is subject to a number of finely tuned regulatory circuits If one further assumes that the reactions of degradation of In their paper Süel et al. In order to compute the probability of entering into competence we use the CME to describe the stochastic chemical kinetics. Once we derive the CME, we simulate it using the Monte-Carlo based SSA. We then use the FSP method to obtain a finite dimensional solution to the infinite dimensional CME. In the CME, the state vectors indicate the number of molecules of each of the two species of interest: ComK and ComS. The CME describes the evolution of the probability that the number of molecules of each of the species has a given value. The dynamics of the evolution of the probability density vector are directly related to the chemical reactions. Starting from a number of molecules Getting the exact value for the solution to the CME is not generally an easy task. In this part we introduce the SSA that is normally used to simulate Eq. 9. The SSA is a Monte-Carlo based algorithm that generates sample paths for the underlying stochastic process. Gillespie introduced this algorithm in 1977 Initialization: Initialize the number of molecules in the system as well as the reaction rates.Reaction: Generate random numbers that will correspond to a choice of a reaction. The probability of a reaction being chosen is proportional to the number of molecules involved in it.Number of molecules: Update the number of molecules that were involved in the reaction.Time: Update the time by the reaction time and repeat.What we described above is a a basic summary of the algorithm, interested readers are referred to The CME derived in Eq. 9 describes the evolution of the probability density vector of the number of molecules. Using SSA to get an estimate of the probability of entering into competence is easy to implement. However, a large number of simulations is required for a reasonably accurate estimate to be obtained. Aside from being time consuming, the algorithm has the drawback of lacking an accurate bound on the estimation error. In addition, analyzing the effect that different parameters have on the probability with which a cell enters in competence, requires the repetition of a large number of SSA simulations while changing those parameters of interest. This is numerically very costly. An alternative method in dealing with the CME is to compute an analytical expression for the probability of being in each state. The FSP method introduced in A becomes a finite matrix, and In the finite model all the states outside the projection region are aggregated into one absorbing state: One advantage of having an analytical solution of the probability of competence is that we can use the solution to run a sensitivity analysis with respect to different model parameters. This makes it possible to shed light on the importance and roles that the different parts of the regulatory circuit play in reaching competence.We start this section by introducing the equations we used to compute the sensitivity for the probability with respect to all the parameters. We then compare answers obtained by this method to estimates of sensitivities that we obtained using a finite difference method.Recall that For comparison, we calculated the same terms computed above by using a finite difference method. The sensitivity of the probability of entering competence with respect to the various parameters is calculated according to the formula In summary, the sensitivity results presented in Method #1: We solve the double order system in Eq. 16. This results in more accurate answers but is more computationally expensive.Method #2: We use the solutions for the original system describing the evolution of the probabilities of the states presented in Eq. 15 in addition to the numerical approximation method presented in Eq. 17 with We study here the time it takes for a cell to return from a state of competence to its original vegetative state. We use once again the analytical solution of the CME to conduct this analysis. We use a similar concept to the one explained earlier, with the difference that in this case, we aggregate into an absorbing state the region of the state space that corresponds to the vegetative state, indicating that the cell returned from competence. We also assume that the cell starts from a state of competence and that it is allowed to return from that state, i.e., competent states are no longer absorbing in this case. Starting from competence corresponds to starting from a pair that falls anywhere in the region Having described the dynamics of the probability for return from competence in a similar manner to the description we had presented for the probability of entering in competence, we find the probability of returning from competence as a function of time by solving a set of differential equation just like we did earlier. We still need to deal with the infinite dimensions of the original model. For this purpose we add another absorbing state. This state is an aggregation of the region outside the finite state space that we consider, The system becomes:Now consider a partition of the interval We applied SSA to both the full model presented in Eq. 1–4, as well as to the reduced model presented in Eq. 7. We say that a cell entered in competence when the pair Chernoff inequality, the accuracy in this case is described as In Using the FSP based method as described in Eq. 15, we find that the probability of entering in competence at least once in 40 hours is Now that we presented the SSA, and FSP method, we first use the SSA algorithm to compare the reduced model in Eq. 5–6 to the full model in Eq. 1–4 both presented in We show next the insights our numerical methods allowed us to have about how the molecules involved in competence, affect the time a cell spends in this state. In We saw earlier that increasing We applied FSP to come up with an analytical solution, whereas other researchers always reverted to Monte-Carlo simulations, in their analysis. Finding an analytical solution made it possible for us to describe to a great extent the role of each of the molecules in driving cells into and out of competence. We discuss our results below.We start by addressing the roles of the different expression and degradation rates in a cell entering competence. Bacillus subtilis enters in competence. Our calculations also show that an increase in We now study the roles of the different molecules in the return from competence. Bacillus subtilis. We performed simulations of the model using Monte Carlo based SSA and verified that the reduced order model gave a valid approximation of the full model. We then applied the recently developed FSP method to the reduced model and computed the probability of competence, where competence was defined in terms of a trajectory leaving a pre-defined region of the state space. Having the analytical solution, we were able to conduct a sensitivity analysis of the probability with which a cell enters in competence as the model parameters vary. We were also able to compute interesting terms such as the expected time it takes for a cell to return from competence.In this paper we developed a discrete stochastic model for competence in This paper presented numerical methods that are applicable to many biological systems that exhibit a transient switching behavior. These methods were shown to be very useful in studying the genetic circuit regulating competence in a bacteria, and in answering questions about exact probabilities of stochastic events in this bistable biological behavior. They were also useful in studying sensitivities of these probabilities when expression rates, degradation rates, repression rates or activation rates of proteins were changed. Finally, the methods introduced in this paper showed how to calculate the expected time for return from transient states. Many other terms characterizing different transient physiological behaviors, such as the number of molecules that are most likely to enter in the transient states, and the return trajectories that are most likely to be taken can be computed using similar approaches to the one discussed here. Our approach should be easily extendible to analyze many biological system exhibiting a bistable switching behavior. |
Improved methods for indexing diffraction patterns from macromolecular crystals are presented. The novel procedures include a more robust way to verify the position of the incident X-ray beam on the detector, an algorithm to verify that the deduced lattice basis is consistent with the observations, and an alternative approach to identify the metric symmetry of the lattice. Improved methods for indexing diffraction patterns from macromolecular crystals are presented. The novel procedures include a more robust way to verify the position of the incident X-ray beam on the detector, an algorithm to verify that the deduced lattice basis is consistent with the observations, and an alternative approach to identify the metric symmetry of the lattice. These methods help to correct failures commonly experienced during indexing, and increase the overall success rate of the process. Rapid indexing, without the need for visual inspection, will play an important role as beamlines at synchrotron sources prepare for high-throughput automation. If control is fully automated, the data can be acquired in 1–2 min per sample.LABELIT (Lawrence Berkeley Laboratory Indexing Toolbox), a Python/C++ package capable of handling difficult indexing cases.Once acquired, images must be analyzed to determine if the diffraction pattern can be indexed. Indexing the crystal lattice and determining the likely Bravais symmetry permits the user to predict whether a given crystal can potentially yield a complete data set. This step must be completed in real time so that the user can select samples for further study. Presently there are several software packages available to assist with this , giving the number of observed projections in the jth interval. Peaks in this series suggest the locations of possible reciprocal-lattice planes perpendicular to t. To find out how well the observed reciprocal-space points are described by periodic planes, one can take the discrete Fourier transform F(k)| correspond to strong periodicities along t . In particular, the first and largest peak at k = l (not counting the peak at k = 0) is used to quantify the periodicity. After compiling a short list of t directions having the largest values of |F(l)|, each of these directions is refined with a fine grid search to maximize the |F(l)| value. Finally, directions that are collinear duplicates are rejected and the list is resorted, giving a set of ∼20 candidate directions {t}. Each candidate represents a possible unit-cell basis vector with real-space length The procedure of Steller al. 1997 is then 2.3.x of each observed Bragg reflection derived from the given X-ray beam position to infer a better estimate of the true beam position. As will be described in detail in §3.1Since the direct X-ray beam often cannot be directly observed on the diffraction image, its position must be determined independently. This raises the possibility of systematic error in one’s prior belief about the beam position. If the prior belief is inaccurate, this will be reflected in the calculated reciprocal-space coordinates f(j) may be recovered by the backwards Fourier transform F(k) exhibit Hermitian symmetry, F(k) = F(m − k)*. Assume now that a particular direction t 0 t} is a basis vector for the unit cell, and therefore exhibits strong periodic groupings when the reciprocal-space points are considered in projection . The essential information regarding this periodicity can be effectively modelled with the single Fourier coefficient F(l). By replacing the Fourier sum in equation (4)k = l, f(j) can be approximated with the simplified expression l is the polar angle in the conventional representation F(l) ≡ Recall that in general the frequency series b) closely correlate with the projections of observed reciprocal-lattice points in Fig. 2a). Since the true beam position coincides with a reciprocal-lattice plane at x = 0, it will fall on one of the crests. This implies that P(j) in equation (5)t 0 at interval j, given the prior belief about the beam center position.As expected, crests in the sinusoidal plot of equation (5)b), each of several crests could potentially correspond to the true beam. Moreover, even if a particular crest at interval j is singled out, an infinite number of possible beam positions in the laboratory frame would be associated with this interval. This situation is summarized in Fig. 3a), a contour map showing the probability that a given pair of laboratory coordinates is the true beam center. However, if three or more linearly independent directions t 0, t 1, t 2 t} are considered simultaneously, the possible laboratory coordinates of the true beam center can be constrained to a small set of points, as shown in Fig. 3b). This contour plot has been computed as the sum of Fig. 3a) and probability maps from two additional directions. For this example, the three directions t 0, t 1, t 2 were selected to be the primitive axes of the unit cell.The true beam center cannot be deduced from equation (5)t 0, t 1, t 2 will ultimately be chosen as basis vectors. Instead, probability fringes from all directions in the set {t} can be combined to help assure that the beam position is sufficiently overdetermined. An example of the resulting probability map is shown in Fig. 3c). As will be discussed in §3.1c) within a radius S centered on the prior-belief beam center. Within this search radius, the true beam position is taken to be the peak position of the largest cluster, where clusters are ranked by integrated area. In the example illustrated, the true beam position is at the center of the panel.In practice, one does not know which directions c) that if the search radius S is made too large, there is the potential of misidentifying one of the other red peaks (not the one in the center) as the true beam position. This ambiguity disappears if data are available from two images collected at rotational settings 90° apart. If probability fringes from two images are combined, an unambiguous true beam position may be obtained over a much larger search radius .Note in Fig. 3t} must be improved based on the new estimated beam position. When two images are used, it is sufficient simply to re-refine each existing t using the fine grid search mentioned in §2.2t directions are poorly determined at this point, and are unreliable when used for subsequent indexing steps. In this case, a completely new search for t directions is performed, with the new beam position as input.For use in the next section, the directions {2.4.t}, three unit directions and associated real-space lengths to produce the primitive one, T] must have integer coefficients and determinant M, but is otherwise not uniquely determined. We propose the following algorithm to enumerate the reflection conditions and the associated transformations [T].As noted in §2.3G 0 of all possible integer 3-tuples, with each tuple element having a magnitude up to the maximum expected modulus M; typically g = . Sort the list in order of increasing |g|, and omit g = .Step 1. Construct the list G 1, a copy of G 0. Remove all items in G 1 having i.e. G 1 are possible values for g in equation (9)M ≤ 5 and g values in combination with three prime moduli to give 111 formulae for reflection conditions.Step 2. Construct g, M] construct the matrix [T]. Begin by considering that every point on the reciprocal lattice obeys equation (9)T] (the coefficients giving the correct basis vector a*) pick the first item Mn. Tuple T]. For the second row of [T], select the first item Mn. Finally, the third row of [T] becomes the first item Mn. If the determinant of [T] is negative, the first and second rows are switched.Step 3. For each reflection condition [T]. In Fig. 4b), the correct basis set is immediately obtained from the matrix In order to decide whether a basis set is primitive, each of the 111 reflection conditions enumerated in Step 2 is separately considered. Since the sample size of candidate Bragg spots is at most 600, the computational loop through all conditions is quite rapid (∼7 ms on a 2.8 GHz Intel Xeon processor). Allowing for a generous percentage of outliers , if the remaining spot candidates fulfill equation (9)2.6.t} to choose from. Certain combinations of directions may be immediately ruled out since they lead to unit cells with nearly zero volume. Specifically, if V is the cell volume and a, b and c are the cell axis lengths, a cutoff requirement that V > abc/100 does not lead to a significant loss of generality. For the remaining candidate bases, primitiveness is imposed (§2.5a) the root-mean-squared difference between f and h, where f and h are as defined in §2.4b) the number of candidate Bragg spots entering into the calculation of (a) after overlaps and axial spots are removed; (c) the root-mean-squared difference between observed and predicted laboratory coordinates of the candidate Bragg spots (r.m.s.d.); and (d) the fraction of candidate Bragg spots correctly predicted by the basis choice. Measures (a)–(d) provide the raw comparisons needed to pick a single high-scoring basis for all further work, with measures (c) and (d) being most useful.The choice of basis vectors noted in equation (6)t} lead to similarly high scores, and give nearly identical unit-cell parameters. In such cases it is sufficient to try only a few combinations before making the final basis selection. With poor crystals it is often necessary to do an exhaustive search of possible basis vectors from {t} before choosing the best basis, or deciding that the diffraction pattern cannot be indexed. The actual method in the package represents an attempt to accommodate these two extremes, with the realisation that further fine-tuning may be beneficial. The implementation is presented as a high-level script in order to allow future changes or adaptations by the end user.The heuristic for choosing the basis was formulated empirically with the goal of producing a correct indexing solution in the least amount of computational time. With a well indexing crystal, many combinations of directions from {2.7.International Tables for Crystallography, Vol. A . Except where otherwise specified below, we adopted the minimum reduction presented in that work because it is fast and combines numerical stability with maximum portability.For subsequent symmetry determination, it is necessary to calculate the transformation to a reduced basis as discussed in §9.3 of the x and y coordinates of the direct beam, the next adds the crystal-to-detector distance, and the final round adds the nine components of the [A] matrix. First derivatives of the target function with respect to each parameter are calculated for the LBFGS minimization algorithm between the observed and predicted Bragg spot positions introduced in §2.6An estimate of the effective mosaic spread of the crystal is obtained separately. Diffraction patterns are calculated D = E = F = 0, and (iii) DEF ≤ 0. Equality tests such as (i) are evaluated within a tolerance parameter, set to 4% to accommodate normal levels of experimental uncertainty. For testing orthogonality conditions such as (ii) D = 0, similar reasoning implies that this expression should be considered true if the magnitude of the direction cosine between b and c is <0.04. It is more difficult to accommodate experimental uncertainty in evaluating condition (iii). If D = 0 or E = 0 or F = 0 (within 4% tolerance) then expression (iii) must be forced to be true even if DEF is numerically > 0. When necessary, it is possible to impose this condition by pre-multiplying two of the three basis vectors by −1. While these procedures are adequate for most cells, we were able to identify cases where infinitesimal uncertainties in the basis vectors caused the Bravais type to be misidentified to impose the metric conditions implied by the symmetry. Conjugate-gradient minimization is performed on the 12 parameters described above , where λ is the X-ray wavelength and D is the crystal-to-detector distance. Clearly, if Δm is of order L or higher, it will not be possible to index the diffraction pattern correctly.It is well known that indexing relies critically on knowing the true position L of the true beam center. In this experiment, a rectangular grid was superimposed onto this region, and each point r was separately treated as a prior-belief beam center, in a grid search for the true beam center m using the method outlined in §2.3r lay within the zone of convergence, the true beam position was sought within a radius S = 1.3|r − m|. Determination of the new putative beam position was followed by indexing, least-squares parameter refinement, and Bravais lattice selection as outlined above . With the Fourier coefficient method, this particular image can be reliably indexed with any Δm ≤ 0.6L . The results improve even more dramatically when Bragg spots are combined from two images with ϕ settings 90° apart . In this case, the correct solution is obtained whenever Δm ≤ 1.2L = 1.8 mm. Note that to produce this result from the analysis of two images, one must assume that the detector remains stationary throughout the experiment. This is generally true for modern charge couple device (CCD) detectors and stationary phosphor imaging plates, but not for earlier detectors such as film or manually exchangeable imaging plates.A typical set of results is shown in Fig. 5S = L. Since the reduced basis is not available a priori to calculate L, it is reasonable instead to use the candidate cell lengths {d} corresponding to each direction in the set {t}. The search radius is set to This simulation suggests that the beam position is likely to be discovered if Bragg spots are combined from two images and the search radius is set to x. Once this determination has been made, it is normally applicable to all images collected with a particular detector at a particular beamline.In the preceding discussion, it is understood that the prior-belief beam position is obtained from information tabulated in the image file header, created at the time the data are acquired. A well known issue is that this tabulated position may be expressed in eight possible coordinate systems, with various detector manufacturers having chosen among the different conventions |, and not by shortest real-space vector length d. Yet it is imperative that the chosen vectors have minimal real-space length to assure that they are not linear combinations of the true basis vectors, as described in §2.5et al. (1997f − h (§2.4a), in a small percentage of cases.Any procedure for deducing the lattice basis from experimental data must address the question of whether the resulting basis is primitive Fig. 4. Caution al. 1997, for exaTo compensate for this lack of adequate methods, macromolecular crystallography users have relied until now on interactive graphical indexing programs, which allow indexing by trial and error. If a basis set looks incorrect, program parameters such as the beam center and crystal-to-detector distance are slightly altered, which has the effect of producing a different basis choice. In the present context, however, we aim to index crystal lattices without the need for visual inspection of the result. The test presented in equation (9)3.3.a = b = 10, c = 30, as depicted in Fig. 6a), with the Niggli-reduced basis as indicated. Using this basis to determine the metric symmetry of the unit cell, it can be shown algebraically that the metric tensor [equation (12)A = B; D = E = F = A/2. Looking for these conditions in Table 9.3.1 of the International Tables for Crystallography will be selected as a candidate basis for the cell; in fact, it is equally likely that the vectors will be selected as shown in Fig. 6b), case (ii). Although this basis is not reduced, application of the Křivý & Gruber , and again the conditions are fulfilled for rhombohedral character #9.We now examine an instance in which correct identification of the primitive basis can nevertheless lead to improper identification of the lattice symmetry, when method A we can ask what will happen if vectors b or c are altered by small angular amounts. For either vector, a small perturbation does not alter the fact that the basis is in Niggli-reduced form. Method A , and consider perturbations of either b′ or c′ in the ab plane as shown in Fig. 6c). Here the situation is quite different: application of the Křivý-Gruber algorithm gives the Niggli-reduced basis when either b′ or c′ is rotated slightly counterclockwise, but a different Niggli-reduced basis when either is rotated clockwise. The alternate reduced basis satisfies different metric conditions, giving a monoclinic C-centered cell. Thus in case (ii), both experimental uncertainty and infinitesimally small theoretical perturbations can lead to misidentification of symmetry under method A.Now we include experimental uncertainty in the basis vectors. Again considering case (i), beginning with basis shows how well method A determines the symmetry when different grid points are assumed to be the beam center. The correct rhombohedral symmetry is deduced in fewer than half of the cases. Moreover, there is no zone of convergence for either the correct rhombohedral or the incorrect monoclinic symmetry; the symmetry determination oscillates in a chaotic manner as the imposed beam center moves across the image. Both symmetries can be deduced with input beam estimates within 0.1 mm of the true beam center. While Fig. 7a) shows the results of indexing one 0.8° oscillation image, similar results were obtained for joint indexing of two images collected 90° apart in ϕ (not shown). In contrast, method B produces the correct solution across most of the grid . These results support method B as a computationally tractable alternative that can unambiguously identify metric symmetry elements in the lattice. The method is thus well suited for inclusion in automatic systems.Fig. 74.While automated processing carries great potential benefit for the beamline user, it also places high demands for robustness upon its component algorithms and software. Problem areas that can be instantly recognized by the human experimentalist using a graphical interface may go unnoticed by an automated system, with potentially disastrous results for subsequent analysis steps. The methods presented above, if incorporated into the beamline control environment, will quickly produce reliable indexing and symmetry solutions immediately after the images have been acquired. A 2.8 GHz Intel Xeon processor typically requires 7 s to choose Bragg reflections from a pair of 10 Mbyte images, and 11 s for the remainder of the analysis.d) can yield a much more robust direct-beam position than a single image. It is also likely that the derived unit-cell dimensions are more accurate, since two images together sample reciprocal space more completely. With modern, scriptable beamline control software, it is typically easy to set up standard protocols to acquire these two images. One need only assume that the sample is rigidly affixed to the goniometer and is well centered in the beam. Thus it is important to exercise care when mounting and cryocooling the crystal.It is particularly striking how a pair of images . Therefore, the toolbox is expected to be generally applicable to all crystallographic experiments that use the oscillation method.We have successfully used 5.LABELIT is organized as a hybrid software package in which the high-level scripts directing the algorithm use the Python scripting language, while the numerically intensive calculations are executed by optimized compiled C++ code. LABELIT makes extensive use of code objects from our open-source Computational Crystallography Toolbox is used as a build facility. LABELIT can be installed on a number of computing platforms, and customized for various data collection environments by modifying the included example scripts. LABELIT will be available as a Web service at http://cci.lbl.gov/labelit, enabling general users to upload raw image data and retrieve the model parameters from the resulting indexing solutions. LABELIT will also be available for download to non-commercial users. |
It is important to demonstrate learning outcomes of simulation in technology based practices, such as in advanced health care. Although many studies show skills improvement and self-reported change to practice, there are few studies demonstrating patient outcome and societal efficiency.The objective of the study is to investigate if and why simulation can be effective and efficient in a hi-tech health care setting. This is important in order to decide whether and how to design simulation scenarios and outcome studies.Core theoretical insights in Science and Technology Studies (STS) are applied to analyze the field of simulation in hi-tech health care education. In particular, a process-oriented framework where technology is characterized by its devices, methods and its organizational setting is applied.The analysis shows how advanced simulation can address core characteristics of technology beyond the knowledge of technology's functions. Simulation's ability to address skilful device handling as well as purposive aspects of technology provides a potential for effective and efficient learning. However, as technology is also constituted by organizational aspects, such as technology status, disease status, and resource constraints, the success of simulation depends on whether these aspects can be integrated in the simulation setting as well. This represents a challenge for future development of simulation and for demonstrating its effectiveness and efficiency.Assessing the outcome of simulation in education in hi-tech health care settings is worthwhile if core characteristics of medical technology are addressed. This challenges the traditional technical versus non-technical divide in simulation, as organizational aspects appear to be part of technology's core characteristics. Another example is the French-American surgeon Alexis Carrel who was awarded the Nobel Prize in physiology and medicine in 1912 for his work on vascular suture and organ transplants. Carrel intensively practiced lace-making in order to develop and maintain his skills [The introduction of hi-tech equipment in medicine entails a need to train new skills and the continuous need to maintain a necessary competence level. Simulator training in medical education opens possibilities for training without the use of real patients, and simulator training has a long history in medicine. One example is the medical mannequin described by Hieronymus Fabricius ab Aquapendente 1533–1619) in 1582 [533–1619 However, it is not before modern times that simulators have come to have significant impact on health care education across professional boundaries and on all levels of teaching . It has There has been an increasing demand for documenting the outcome of teaching methods. As simulation typically is resource demanding, and due to the recent focus on evidence in health care, the need to document the effectiveness and efficiency (cost-effectiveness) of simulation has become pressing.Many studies show improvement of short term retention of knowledge and skills -9. HowevThere are many challenges with proving effectiveness and efficiency of educational measures, such as simulation, e.g. to decide on endpoints , to valiAll these challenges need careful attention in order to provide evidence of the effectiveness and efficiency of simulation. However, is it worth the effort? Does simulation have the potential for increasing the outcome of education and training? In the same manner as it is wise to confer with Einstein's theory of relativity before trying to travel faster than the speed of light, it is wise to investigate whether and why simulation has the potential of improving education in technology based health care before we start measuring its effectiveness and efficiency. Therefore the key issue in this article is to investigate if and why simulation can improve learning effectiveness and efficiency in complex hi-tech contexts in health care.There appear to be many good reasons why simulations can be effective and efficient, e.g. that simulation provides the opportunity to do practice situations that seldom occur in practice or that expose the patient to unacceptable hazard. Some of these reasons are theoretical, hypothetical, or argumentative, as there is little empirical evidence of their importance. Issenberg and colleagues have reviewed the literature on empirical studies on the outcome of simulation and have- Simulation facilitates feedback, which is important for learning.- Repetitive practice is a key feature involving the use of high-fidelity simulations in medical education.- Simulators can capture a wide variety of clinical conditions.- High-fidelity simulations provide a controlled environment where learners can make, detect and correct errors without adverse consequences.- Integration of simulation-based exercises into the standard medical school or postgraduate educational curriculum is an essential feature of their effective use.- There is a range of task difficulty levels in simulation-based medical education, which is important for effective learning.- Adaptability of high-fidelity simulations to multiple learning strategies is an important factor in educational effectiveness.- Simulations provide reproducible, standardized educational experiences where learners are active participants, not passive bystanders.- Simulation facilitates team work and interdisciplinary approaches.These studies highlight features that clearly are important in order to generate outcome in the use of simulators. However, they do not guarantee that simulation will be effective and efficient. On the contrary, they presuppose that simulation can be so. It is exactly this premise that is the issue of this article: can simulation be effective? Addressing this question will also lead to answers to the question of why and how simulation can be effective and efficient. Knowing why simulation can be effective can direct our efforts to increase its outcome.In order to investigate the preconditions for whether and why simulation can improve learning effectiveness and efficiency in complex hi-tech contexts in health care standard theories in Science and Technology Studies (STS) are applied. According to such theories, the norms of technology are established in practices by negotiations and social framings ,20. TechThe analytical framework from the Science and Technology Studies (STS) makes the method most compelling for hi-tech practices. This does not mean that simulation cannot be highly effective and efficient in less advanced (lo-tech) contexts. However, as the methodological and organizational aspects of technology may be less prominent in these contexts, the analysis in this article is restricted to hi-tech practices in health care.One reason why simulation can be effective and efficient in the education of hi-tech health care in general is that it has features that correspond well with core characteristics of technology. In other words, it is worthwhile to pursue evidence for the effectiveness of simulation in health care education because it addresses a broad spectrum of technology's core characteristics.Traditionally technology is conceived of as apparatus and devices, and learning technology application is to learn its functions and basic operation procedures. Teaching technology based health care practices in this manner may be called the "operator's manual approach", as its prototype is to be found in teaching by operator's manuals. According to this approach learning advanced skills is like learning the basic functions of a device and how to use it according to these functions in practice . It is wTo know the function of technologies, such as ventilators, monitoring devices, and anesthetics, as well as the skills to apply them in a wide variety of situations is crucial for safe, effective, and efficient use of technology in a health care setting, such as anesthesiology. However, technology is more than function, and knowledge of handling technology in health care settings is more than knowing what is written in the operator's manual. Imagine that we give a defibrillator to an employee in the health care system who is not trained in resuscitation, e.g. a physiotherapist, that we explained to him the defibrillator's function and gave him the operator's manual. Would the person then be a skilled user of a defibrillator? Most probably not! .What then if we showed the person when to use the defibrillator and how to use it; if we explained, taught, and practiced procedures for how to use the defibrillator? Would we not be much more willing to let the person handle our heart attack? The knowledge and skill provided would make the person more suited to use the technology and we would argue that he could be a competent technology user. The core feature of this approach is learning relevant procedures for practical use of technology according to specific purposes. Therefore the approach could be called "the methodology approach" or "the methodological approach." According to this approach, technology is addressed not only in terms of its apparatus and function, but also according to its implied method and the purpose of applying the technology.Simulation has a great potential of not only applying "the operators' manual approach", but also "the methodology approach" in teaching the handling of technology in health care.Hence, because simulation addresses a wider range of learning levels and aspects of technology, it has the potential of being effective and efficient in education of technology based activity in health care. Traditional teaching methods have ignored important aspects of technology use in health care when being dominated by the operator manual approach. As simulator training is well suited for addressing methodological aspects of technology as well, there are good reasons to develop and assess the outcome of simulation in education in hi-tech health care. The practical effectiveness and efficiency will depend on how well the above mentioned features are addressed. The point here is only that there is a general potential in simulation due to its ability to address a significant spectrum of technology's core characteristics.What does this analysis imply with regard to how the outcome of simulation can be improved (even further)? Let us return to our defibrillator example, but this time to introduce it to a yet undiscovered tribe in Amazonas.To the members of the tribe the item we bring is not a defibrillator. Even if we explain to them the function of the defibrillator, it will not be a defibrillator to them. What then if we teach them how to use the defibrillator and its purpose and methodology? If they learn in which situations they should attach the electrodes, how to behave and what to do in particular situations. Will it be technology to them? Maybe, but what if we leave them and come back after one year, the chances are small that the defibrillator is in use. Why? One reason is that ventricular fibrillation and electrical resuscitation are not accepted and integrated part of their health care context. Unlike the case with the physiotherapist, their health care is organized in a different manner, and their health reasoning and actions may be quite different.Hence, in order to improve the outcome of simulation even further, organizational aspects should be addressed. Technology's organizational aspects go beyond function and method , and incWhat are the organizational aspects? Although it may be easy to identify the function and methodological setting of technology, it can be difficult to pinpoint its organizational aspects. The reason is that the organizational aspects are greatly contextual, and part of the framework with which we understand and interpret health care. Nevertheless, many aspects appear to be common to most health care settings.First, most health care systems face challenges with cost containment and have limited resources. Personnel, time and equipment may be some of the most limited resources. Hence, if simulation does not address such limitations, the learning outcome may be great in the simulation setting, but the outcome in clinical practice may be low. Simulations should include complex and everyday situations .Second, there may be professional hierarchies in clinical practices which are not addressed in a simulation setting, e.g. if not all in the ordinary team are present, or they do not wear the ordinary status enhancing symbols (clothing). Even if skills in team working, communication and leadership are addressed in simulation , the outThird, both diseases and technologies vary in social status . The samThis is not the place to review all the organizational aspects of technology. The point here is that there may be structural constraints in the clinical setting which are not addressed in simulation, but which are part of the core characteristics of the technology applied in a training setting, and that are crucial for the practical outcome of simulation.Hence, there are many factors influencing the outcome of simulation . Some ofHow reasonable is the claim that the outcome of simulation will depend on whether simulation addresses core characteristics of technology? This has not been a hypothesis for empirical testing in this article. The article has only provided an analysis of the conceptual preconditions of outcome measurements. However, there are relevant counter arguments.First, the preconditions may in principle be impossible to meet in practical settings. Nevertheless, the arguments and examples provided indicate that they are reasonable and that they can be met in actual simulation contexts.Second, the analytical framework may be irrelevant. Other preconditions may be more important than addressing core characteristics of technology. It may certainly be the case that other preconditions are important as well. However, it is far from obvious that education in technology use in health care can be effective and efficient without addressing essential aspects of technology. It is not very likely that teaching car driving will be successful without addressing core characteristics of cars.Third, the analytical framework applied here may be flawed. Technology may not be characterized by devices, method and organization, as argued here. However, the conception of technology presented here corresponds well with standard definitions of technology, e.g., the seminal definition given by the congressional Office of Technology Assessment (OTA) which defined medical technology as "the drugs, devices, and medical and surgical procedures used in medical care, and the organizational and supportive systems within which such care is provided." and withknows (that), and the methodology approach covers both knows how and does. Furthermore, the educational approaches correspond to categories in traditional adult education theory. The operator's manual approach, the methodology approach and the organizational approach correspond to content driven, objective driven and process driven education [Correspondingly, it may be argued that the educational approaches presented here are idiosyncratic. Nevertheless, they correspond well with well with Miller's learners' levels : the opeducation . Hence, The point is not to say that the analysis or its corresponding model of technology are perfect, but more modestly that they indicate that simulation and its evaluation is worthwhile also from a theoretical point of view.This gives us good reasons to believe that simulation can be effective and efficient in the education of hi-tech health care, and that it is worthwhile to assess its outcome. This is due to simulation's ability to address core characteristics of the medical technology applied. Paying attention to the core characteristics also points to areas where simulation can be improved. Organizational aspects appear to be important in the application of technology, and can be crucial in order to obtain the desired outcome from simulation. More emphasis on this may be fruitful.Two other implications of this approach based on basic insights in science and technology studies are worth highlighting. First, simulation is a technology itself, and the same attention should be paid to the core characteristics of the technology we use in education, as we pay to the medical technology that we apply in the clinical setting. The simulator is not only a device, and it is not enough to pay attention to its methodology, but we need also to acknowledge the importance of its role in the organization of education.The second implication is that the traditional distinction between technical and non-technical skill may not be warranted. The analysis in this article indicates that non-technical issues are important even in the "technical skill domain". Or more precisely: the distinction between the technical and the non-technical aspects is artificial and not fruitful. The so-called non-technical skills are an essential part of technology, and this may be crucial to understand and teach technology use effectively.The author declares that they have no competing interests.Bjørn Hofmann is the only author of this paper and has designed the study, performed the analysis, drafted and revised the manuscript. He has read and approved the final manuscript.The pre-publication history for this paper can be accessed here: |
The classification of liver injuries is important for clinical practice, clinical research and quality assurance activities. The Organ Injury Scaling (OIS) Committee of the American Association for the Surgery ofTrauma proposed the OIS for liver trauma in 1989. The purpose ofthe present study was to apply this scaleto a cohort ofliver trauma patients managed at a single Canadian trauma centre from January 1987 to June1992.170 study patients were identified and reviewed. The mean age was 30, with 69% male and a mean ISSof 33.90% had a blunt mechanism ofinjury. The 170 patients were categorized into the 60IS grades ofliverinjury. The number of units of blood transfused, the magnitude of the operative treatment required, theliver-related complications and the liver-related mortality correlated well with the OIS grade. The OISgrade was unable to predict the need for laparotomy or the length of stay in hospital. We conclude that theOIS is a useful, practical and important tool for the categorization of liver injuries, and it may prove to bethe universally accepted classification scheme in liver trauma. |
Anopheles gambiae sensu lato species complex comprises seven sibling species of mosquitoes that are morphologically indistinguishable. Rapid identification of the two main species which vector malaria, Anopheles arabiensis and An. gambiae sensu stricto, from the non-vector species Anopheles quadriannulatus is often required as part of vector control programmes. Currently the most widely used method for species identification is a multiplex PCR protocol that targets species specific differences in ribosomal DNA sequences. While this assay has proved to be reasonably robust in many studies, additional steps are required post-PCR making it time consuming. Recently, a high-throughput assay based on TaqMan single nucleotide polymorphism genotyping that detects and discriminates An. gambiae s.s and An. arabiensis has been reported.The An. arabiensis and An. gambiae s.s.) and the non-vector An. quadriannulatus after it was found that the existing TaqMan assay incorrectly identified An. quadriannulatus, An. merus and An. melas as An. gambiae s.s. The performance of this new TaqMan assay was compared against the existing TaqMan assay and the standard PCR method in a blind species identification trial of over 450 samples using field collected specimens from a total of 13 countries in Sub-Saharan Africa.A new TaqMan assay was developed that distinguishes between the main malaria vectors (The standard PCR method was found to be specific with a low number of incorrect scores (<1%), however when compared to the TaqMan assays it showed a significantly higher number of failed reactions (15%). Both the new vector-specific TaqMan assay and the exisiting TaqMan showed a very low number of incorrectly identified samples (0 and 0.54%) and failed reactions (1.25% and 2.96%). In tests of analytical sensitivity the new TaqMan assay showed a very low detection threshold and can consequently be used on a single leg from a fresh or silica-dried mosquito without the need to first extract DNA.An. gambiae species complex from the non-vector sibling species. The method is based on TaqMan SNP genotyping and can be used to screen single legs from dried specimens. In regions where An. merus/melas/bwambae, vectors with restricted distributions, are not present it can be used alone to discriminate vector from non-vector or in combination with the Walker TaqMan assay to distinguish An. arabiensis and An. gambiae s.s.This study describes a rapid and sensitive assay that very effectively identifies the two main malaria vectors of the Anopheles gambiae sensu lato (s.l.) species complex contains the most important mosquito vectors of malaria in sub-Saharan Africa. It comprises seven morphologically indistinguishable sibling species up to four of which may be sympatric [Anopheles gambiae sensu stricto (s.s.) and Anopheles arabiensis. Of the remaining members Anopheles quadriannulatus species A, which is widespread in southern Africa, and Anopheles quadriannulatus species B, found in Ethiopia, are considered to be zoophilic non-malaria vectors [Anopheles melas and Anopheles merus are both salt water breeding and consequently only important vectors in costal regions [Anopheles bwambae is restricted to a region close to the Buranga hot springs in Uganda [The ympatric -4. The p vectors ,5. Anoph regions ,7. The fn Uganda .et al is a multiplex PCR method using species specific primers to amplify products which are of a diagnostic size when visualized by agarose gel electrophoresis. Several modifications or additions to the original method, or similar methods based on the same rDNA sequences have also been reported [The marked differences in the vectorial efficiency of the species within the complex mean that rapid identification of species is vital for focussed effort in malaria control programmes. To this end a large number of methods have been developed for identification including cross-mating techniques , polytenreported ,14-17. AAn. gambiae s.s. and An. arabiensis has been described [An. gambiae s.s. and An. arabiensis from western Kenya and was found to have a specificity and sensitivity comparable to standard PCR. However, this assay was not tested using An. gambiae s.s. or An. arabiensis from other regions in Africa, nor was it tested for its ability to distinguish these two species from the non-vector An. quadriannulatus. The current study describes an extensive blind trial of field collected mosquitoes from a range of sites across sub-Saharan Africa comparing the Walker TaqMan SNP genotyping and standard PCR methods with a newly developed TaqMan assay which distinguishes between the principal vector and non-vector species of the complex.Recently, a high-throughput method for identification of the principal vectors in the complex escribed . The metAn. gambiae s.s, An. arabiensis, An. quadriannulatus species A, An. melas and An. merus. Samples of the Ethiopian An. quadriannulatus species B and An. bwambae were not tested in this study because of their more limited distribution.For the initial optimization of each assay, field-caught mosquito specimens from Burkina Faso, Ghana, Kenya, Cameroon and Malawi were used in addition to samples obtained from two laboratory colonies, Kisumu and RSP. These samples included several samples of each of An. gambiae s.s., 173 An. arabiensis, 66 An. quadriannulatus, and 21 samples of An. melas and An. merus, the remaining samples were either undetermined or negative controls. This information was withheld from the persons who carried out the testing of each assay to ensure no bias occurred in the scoring of results. For all samples DNA was extracted from single mosquitoes using either the Livak or Ballinger Crabtree methods [et al. [Anopheles gambiae complex was included in the trial. For this, DNA preparations were diluted to 20 ng/ul . The samples were then serially diluted down to a 1 in 1 × 06 dilution.The blind species identification trials were performed using five 96 well test plates containing 466 samples. Samples were field collected from Cameroon, Ghana, Kenya, South Africa, Malawi, Sao Tome, La Reunion, Tanzania, Sudan, Angola, Burkina Faso, Gabon, and Mozambique. These samples had been initially identified to species at the time of collection using the standard PCR method and included 169 methods ,20; DNAzStandard PCR was carried out as described previously .An. gambiae s.s. from An. arabiensis has been described previously [et al are not given in the original manuscript but were obtained from Edward Walker . These were modified slightly and were as follows: PCR reactions (25 μl) contained 1 μl of genomic DNA, 12.5 μl of SensiMix DNA kit (Quantace), 900 nM of each primer and 200 nM of each probe. Samples were run on a Rotor-Gene 6000™ (Corbett Research) using the temperature cycling conditions of: 10 minutes at 95°C followed by 40 cycles of 95°C for 20 seconds and 60°C for 45 seconds. The increase in VIC and FAM fluorescence was monitored in real time by acquiring each cycle on the yellow (530 nm excitation and 555 nm emission) and green channel (470 nm excitation and 510 emission) of the Rotor-Gene respectively.The design of a TaqMan assay to distinguish eviously . The PCRAn. arabiensis and An. gambiae s.s. from the non-vector An. quadriannulatus was designed after it was found the Walker TaqMan assay incorrectly identified An. quadriannulatus, An. merus and An. melas as An. gambiae s.s. An alternative region within the rRNA gene at the 5' end of the intergenic spacer (bases 475 to 487) was selected where the nucleotide sequence in An. gambiae s.s. and An. arabiensis is GCTCGTCTTGGTC. In An. quadriannulatus, An. melas and An. merus the same region of sequence shows a SNP (GCGCGTCTTGGTC). Flanking this SNP was an area of conserved sequence between the species which allowed for the design of forward, comF (5'-GCTTGGTGGTTTGTCCG-3'), and reverse, comR (5'-CTGTGTCGACGTGGTCCC-3'), primers. Antisense minor groove binding (MGB) probes (Applied Biosystems) that bind over the SNP site were designed using the Primer Express™ Software Version 2.0. The probe AG/AA (5'-GACCAAGACGAGC-3') was labelled with 6-FAM at the 5' end for the detection of An. gambiae s.s. and An arabiensis and the probe AQ/AM (5'-GACCAAGACGCGC-3') was labelled with VIC for detection of An. quadriannulatus, An. melas and An. merus. Each probe also carried a 3' nonfluorescent quencher and a minor groove binder at the 3' end. The minor groove binder provides more accurate allelic discrimination by increasing the TM between matched and mis-matched probes [An. gambiae s.s. and An. arabiensis and a second group containing An. quadriannulatus, An melas and An. merus. Samples that had scored as 'vectors' were then further identified to species using the Walker TaqMan assay.A novel TaqMan assay that would distinguish the main malaria vectors d probes . This nePCR reactions (25 μl) contained 1 μl of genomic DNA, 12.5 μl of SensiMix DNA kit (Quantace), 800 nM of each primer and 200 nM of each probe. Samples were run on a Rotor-Gene 6000™ (Corbett Research) using the temperature cycling conditions of: 10 minutes at 95°C followed by 45 cycles of 95°C for 15 seconds, 50°C for 20 seconds and 72°C for 20 seconds. The increase in VIC and FAM fluorescence was monitored in real time by acquiring each cycle on the yellow (530 nm excitation and 555 nm emission) and green channel (470 nm excitation and 510 emission) of the Rotor-Gene respectively. PCR reactions were also carried out using whole mosquitoes or single legs instead of genomic DNA, in this case the leg or body was simply placed in the PCR tube and covered with the PCR mastermix.et al was found to effectively identify control templates of known species. As reported previously, agarose gel electrophoresis of PCR products did show the presence of non-specific bands in some species . The analytical sensitivity of the PCR method was examined using a dilution series of DNA of each of the five species, both as part of the blind trial and also subsequently with dilutions of two additional DNA templates of each species to check for variation between templates. Sensitivity varied slightly depending on species but in general the limit of detection was between a 1 in 100 to a 1 in 200 dilution representing 0.1–0.2 ngs of DNA in PCR except for An. quadriannulatus where the sensitivity was reduced to a 1 in 10 dilution or 2 ng of DNA in PCR.After minimal optimization the multiplex PCR method designed by Scott s Figure and in ss Figure is the set al for detection of An. gambiae s.s. and An. arabiensis was initially optimized using control templates of known species. This showed that the assay successfully identifies the two target species as expected. However, when the assay was tested with other species in the complex it was found that An. quadriannulatus, An. melas and An. merus are also detected by the VIC labelled probe, designed to detect An. gambiae s.s., leading to incorrect scoring of these species . The results using this reduced number of 371 . In both instances these incorrect identifications were specimens scored as An. gambiae s.s./An. arabiensis hybrids, this low error rate (ca. 1%) in mistakenly identifying species hybrids was also reported by Walker et al. The analytical sensitivity of the PCR method was examined in a dilution series of DNA of each of An. gambiae s.s. and An. arabiensis as part of the blind trial and also subsequently with dilutions of two additional DNA templates. The limit of detection for each species was between 1 in 1600 and 1 in 10 000 dilution representing 2–12.5 picograms of DNA in PCR for An. gambiae s.s. and between a 1 in 100 and 1 in 400 dilution 50–200 picograms of DNA in PCR for An. arabiensis.The TaqMan assay designed by Walker An. gambiae s.s. and An. arabiensis, and the second probe, labelled with VIC, will detect An. quadriannulatus, An. melas and An. merus. Thus, a substantial increase in FAM fluorescence during PCR indicates an An. gambiae s.s. or An. arabiensis specimen while a substantial increase in VIC fluorescence indicates an An. quadriannulatus, An. melas or An. merus specimen , however, when compared to the TaqMan assays it showed a significantly higher rate of failed reactions (15% compared to 1.25% and 2.96%). This was noticed to occur more frequently using DNA templates that had been extracted by the STE buffer protocol which, in the authors' experience, is quick to carry out but yields DNA that is of lower quality and more likely to degrade with time or multiple freeze-thawing. The chief disadvantage of this method is the requirement for the post-PCR processing of samples by agarose gel electrophoresis. This is time consuming, restricts throughput, requires the use of the safety hazard ethidium bromide, and variation in the quality of the agarose gels can lead to difficulties in interpreting results.An. gambiae s.s. and An. arabiensis was trialled [An. melas, An. merus and the non-vector species An. quadriannulatus were all incorrectly identified as An. gambiae s.s. Closer examination of the 5' intergenic spacer region of rDNA to which the probes bind reveals that while An. gambiae s.s. and An. arabiensis differ at seven positions An. melas and An. merus differ from An. gambiae s.s. at only two positions and An. quadriannulatus at only one which may explain the non-specific amplification exhibited. If this method was able to accurately identify An. gambiae s.s. and An. arabiensis from the other members of the complex one additional potential disadvantage of the assay design is that an An. gambiae s.s. or An. arabiensis specimen that failed in the PCR reaction might be incorrectly scored as An. melas/An. merus/An. quadriannulatus as these would also score as 'no templates/fails'.The TaqMan method, in contrast to standard PCR, does not require post-PCR processing due to the real-time detection of the specific binding of fluorescently labelled probes during PCR. This 'closed-tube' approach makes the method high-throughput and simple to carry out. Initially, a recently developed TaqMan method that identifies the two main mosquito vector species of the complex trialled . During An. gambiae s.s. and An. arabiensis as one group and An. quadriannulatus, An. melas or An. merus as a second group. The rationale behind this design is that although An. melas and An. merus have been shown to be malaria vectors their distribution is limited to coastal regions as a consequence of their requirement for brackish water to breed. In contrast, An. quadriannulatus species A which is a non-vector species is widespread in southern Africa and is sympatric in many areas with An. gambiae s.s. and An. arabiensis. Therefore, there is a considerable need in many vector control programs to rapidly distinguish between the two main vector species and the non-vector species. The new TaqMan addresses this requirement and has application as a vector/non-vector identification test for large parts of sub-Saharan Africa. An alternative application for this assay is to distinguish An. melas from An. gambiae s.s./An. arabiensis where they are sympatric such as regions along the west coast of Africa. This is viable as the former does not occur sympatrically with An. merus or An. quadriannulatus [An. quadriannulatus has been found to occur sympatrically with An. merus [An. bwambae which was not tested due to its rarity) are detected by one of the two fluorescently labelled probes. Used alone the new TaqMan assay will not distinguish between An. gambiae s.s. and An. arabiensis which may be significant for certain studies, such as those examining the spread of resistance genes in mosquito populations. However if the identification of An. gambiae s.s. from An. arabiensis is required, then the two TaqMan assays described here can be used sequentially. In this case the new TaqMan is run first having the advantage that it can be used on a single leg from a silica-dried mosquito without the need to first extract DNA. Samples that are scored as An. gambiae s.s./An. arabiensis can then be further identified to species using the Walker TaqMan. This approach was used in the blind species identification trial and proved to be successful, taking less time to genotype all samples than the standard PCR method. It may be possible in future to increase throughput and reduce consumable costs by combining the two TaqMan assays so that An. gambiae s.s, An. arabiensis and An. quadriannulatus can be detected in a single tube using probes labelled with fluorophores with distinct emission and excitation spectra. An additional advantage of the TaqMan assays seen in the species identification trial was the very low rate of incorrectly identified samples (0 and 0.54%) and failed reactions (1.25% and 2.96%) which again increases throughput over the standard PCR as it alleviates the need to spend time repeating reactions.The TaqMan assay developed in this study is designed to distinguish between the main malaria vectors nnulatus . It shoun. merus . In contAnopheles gambiae species complex the TaqMan assays were higher throughput, more sensitive and less prone to failure of amplification than standard PCR.In a trial of two TaqMan assays with standard PCR for the identification of members of the CB designed the study, developed the new TaqMan assay, optimized the standard PCR method and the previously described TaqMan method and drafted the manuscript. CSW and MJD collected mosquito specimens, extracted DNA and helped draft the manuscript. MSW helped design the study, prepared the plates of mosquito DNAs and helped draft the manuscript. LMF helped design the study and helped draft the manuscript. All authors read and approved the final manuscript. |
Penetrating neck injuries account for 5-10% of trauma cases and are potentially life threatening. We report a case of cut- throat zone II neck injury in a 45-year-old male extending up to posterior pharyngeal wall and exposing the underlying cervical vertebra. Tracheostomy was done and wound repair was started from the posterior aspect in layers using 3-0 Vicryl. Intraoperatively, a conscious decision was taken for a feeding jejunostomy for postoperative feeding, which was likely to be prolonged, in view of sensory-nerve damage along the transected pharynx. Prolonged use of Nasogastric tube for postoperative feeding was thus avoided and the discomfort, risk of aspiration and foreign body at injury site eliminated. One week postoperative, the patient experienced severe bouts of coughing and restlessness on oral intake; during this period enteral nutrition was maintained through feeding jejunostomy. At the time of discharge at 1 month, the patient was accepting normal diet orally and was detubated and vocalizing normally. We conclude that postoperative nutrition is an important area to be considered for deep neck wound with nerve injuries due to delayed tolerance to oral feeding till the regeneration of sensory nerves. A feeding jejunostomy or feeding gastrostomy performed simultaneously in such patients with nerve injuries is far superior over nasogastric-tube feeding when prolonged postoperative feeding is expected. Penetrating neck injuries which accounts for 5-10% of all trauma cases are potentially dangerous and require emergency treatment. The location of the injury can predict risk and management. Anatomically, the neck can be divided into three major zones for surgery. vascularA 45-year-old male was brought to the casualty 8 hours following an alleged history of cut throat injury. On examination, the patient was in shock and was immediately resuscitated and the blood pressure stabilized at 100/60 mmHg. Local examination of the neck revealed an open deep wound, cut through thyrohyoid membrane. There was profuse frothy salivary discharge from the site and blood oozing from the wound site with no visible arterial bleeding site or surgical emphysema. The wound site was cleared of secretions and airway kept patent. There were no other visible external injuries or neurological deficit. Following this the patient was planned for emergency wound exploration under general anesthesia, and blood grouping and cross-matching done simultaneously along with Hemoglobin and electrolytes. Roentogram was done while in the process of shifting the patient to OT, and chest X-ray was normal with X-ray of soft tissue neck showing the wound area as a transverse air shadow in the AP view and below the hyoid bone in the lateral view . In the Neck injuries pose a great challenge because multiple vital structures are vulnerable to injuries in the small, confined unprotected area. This patient had a zone-2 region injury, which is the most frequently involved 60-75%) site for neck injuries. In zone-2, isolated venous and pharyngoesophageal injuries are the most common structures missed clinically during preoperative evaluation. Use of both rigid and flexible esophagoscopy can be complimentary to overcome these problems.% site fo The pref7For deep neck injuries, it is very important to keep in mind the sensory nerve injuries of pharynx when injuries extend deep into it. In such cases, postoperative nutrition is very important as early oral feeding is not tolerated till the regeneration of nerves, which usually takes about 4-6 weeks. A feeding jejunostomy/gastrostomy done by conventional or endoscopic technique simultaneously helps in maintaining adequate nutrition during the period of nerve regeneration, unlike the nasogastric tube which itself acts as a foreign body locally with its associated complications. |
Giant cell tumors (GCTs) of bone are aggressive benign tumors. Wide resection is reserved for a small subset of patients with biologically more aggressive, recurrent, and extensive tumors. Wide resection and mobile joint reconstruction are preferable for treating tumors around the knee. In certain situations, resection arthrodesis or an amputation is suggested. In this prospective study we report the outcome of 8 patients of aggressive GCT of lower end of femur treated with resection arthrodesis.et al.Eight patients with mean age of 37.25 years (range 30–45 years) with Campanacci Grade III (Enneking stage III) giant cell tumors at the distal femur were treated with wide resection and arthrodesis using dual free fibular graft and locked intramedullary nail from January 2003 to January 2008. There were four males and four females patients. The mean follow-up was 48.75 months (range 30–60 months). The functional evaluation was done using the standard system of musculoskeletal tumor society with its modification developed by Enneking At the final follow up the functional score ranged from 20 to 27 out of total score of 30. Graft union was achieved in all cases in a duration mean of 14.5 months (range 12-20 months).One case required secondary bone graft due to delayed union, and one case had superficial wound infection which healed on systemic antibiotics. At final followup, all the patients were disease free.Wide resection and arthrodesis in aggressive GCTs of the distal femur with involvement of all muscle compartments is a good treatment option. Resection arthrodesis offers a biological reconstruction alternative to amputation in a special group of patients when extensive resection precludes mobile joint reconstruction. Giant cell tumor (GCT) is a benign aggressive tumor of bone.34The available surgical options range from curettage to wide resection with suitable reconstruction.6The ideal reconstruction of the defect created after en block resection of the tumor is still a subject of debate. Endoprosthetic replacement incurs a high cost, requires adequate motor reconstruction and repeated surgeries. Massive allografts are widely used in many centers. However, it requires substantial time and money, and for a variety of reasons, it is not available in many countries.8In this prospective case series, we report the outcome in eight patients with aggressive GCT of the lower end of femur, treated with wide resection and arthrodesis of the knee, and report the radiological and functional outcome at a mean follow-up of 4 years.This prospective study included eight patients with aggressive giant cell tumor of the distal femur, who were operated between January 2003 and May 2005. All participating surgeons used the same technique of wide resection and reconstruction. There were four male and four female patients. Ages ranged from 30 to 45 years (mean of 37.25 years). The mean follow-up was 48.75 months . One casAll patients underwent staging studies that included plain radiography, computed tomography (CT), magnetic resonance imaging (MRI), and chest CT. The aim of these studies was to determine the extent of the soft tissue component, its relation with the neurovascular bundle, breach of the articular surface, the intramedullary extent of the disease, and planning a precise resection length.Campanacci's staging system for giant cell tumor of boneIf the clinical presentation and the imaging studies were compatible with diagnosis of a classic benign giant cell tumor of bone, the biopsy (frozen section) and surgery were performed during the same session (six cases). In case of atypical clinical or radiologic presentation, either CT-guided core needle (one case) or open incisional biopsy was performed, and surgery was delayed until histopathologic evaluation had been completed (one case).A long medial incision that begins in the mid-thigh, crossing the knee joint along the medial parapatellar area and distal to the tibial tubercle, extending gently posterior to the inferior border of the pes muscles was made. The biopsy site was included, with a 1-cm margin in all directions. Fasciocutaneous flaps were developed. The popliteal space was approached by detaching or retracting the medial hamstrings. The superficial femoral artery was identified within the sartorial canal. The length of the resection was measured from the medial joint line to the correct area on the femur and then marked. All the remaining soft tissue at the level of transection was cleared. The tumor was resected with all involved muscles. Extraarticular resection was done in all cases followed by knee preparation for fusion. The resulting defect ranged from 14 to 17 cm with a mean of 15.87 . ReconstIn case 2, the patient presented with intramedullary nail used for fixation of undiagnosed pathological fracture. The nail had to be removed through a separate proximal lateral incision, and the entire medulla was irrigated with phenol .et al (1997) for assessment of graft union both proximally and distally which require unequivocal radiographic evidence of bone healing of graft and osteotomy sites including uninterrupted external bony borders between the fibular graft and the recipient bone, obscured or absent osteotomy lines at both junctions, and clinical resumption of normal function and weight –bearing without discomfort.Postoperatively, the patients were examined every week for the first month for the detection of early complications as infection and then monthly for the first year for early detection of any local or systemic recurrence and progression of graft incorporation. We used the system of Hsu At the end of the follow-up, all patients were alive and were free from any signs of local or systemic recurrence. The functional evaluation was performed using a modified system of the Musculoskeletal Tumor Society.et al.Radiological union of the reimplanted segment proximally and distally was assessed according to the method proposed by Hsu Giant cell tumor is an infrequent and unpredictable lesion.21215The principal treatment modality of this locally aggressive benign tumor is surgery.166The defects resulting from tumor resection can be reconstructed using various approaches.23Several methods of resection arthrodesis were described. Yadav advocates the use dual fibular graft to bridge the intercalary defect after en bloc resection.et al described limb reconstruction with the callus distraction method in seven cases of tumors of the distal femur. The defect after tumor resection ranged from 8 to 20 cm.et al described the use of the Ilizarov technique for management of subarticular defects after en bloc resection or curettage and phenol cauterization in GCT of the proximal tibia in five patients. The mean length of bone defect was 5.7 cm, and the mean duration of external fixation was 233 days. The advantages of this method include the lack of graft rejection, the reattachment of ligaments and tendon to the bone, the prevention of articular collapse, early movement of the knee, and ankle joint and early weight-bearing. Disadvantages include the long duration of external fixator application, pin tract infection, wire breakage, and frustration of patients due to the long duration of treatment.26Kapukaya In our prospective clinical study, eight patients with Campanacci grade III giant cell tumor of the distal femur were treated using resection arthrodesis by dual nonvascularized fibular graft and knee fusion nail. At a mean follow-up of 4 years, all the patients were alive and free from any signs of local or systemic recurrence, with the graft united proximally and distally in all patients. Similar rates of union (100%) following resection arthrodesis of the knee in various tumors have been reported by other workers.et al,Direct comparison of the results of resection arthrodesis with endoprosthetic reconstruction in our series is not appropriate due to the differences in the disease processes and indications. However, all our patients achieved good functional results, which is comparable to that of endoprosthetic patients (78.3%). This result confirms the study conducted by Harris Wide resection is indicated in aggressive GCT of the distal femur with extensive soft tissue involvement. Resection of all involved muscle compartments is essential to obtain proper safety margin. This will make motor reconstruction of mobile endoprosthesis impossible, and consequently, arthrodesis will be a viable option. Arthrodesis can be achieved by the use of fibular grafts and intramedullary knee fusion nail with good to excellent results. An immovable knee in good alignment and functional position is considered to be an appropriate sacrifice to achieve a stable, pain-free limb. |
The assessment of personality disorders (PD) is costly and time-consuming. There is a need for a brief screen for personality disorders that can be used in routine clinical settings and epidemiological surveys. Aims: To test the validity of the Standardised Assessment of Personality: Abbreviated Scale (SAPAS) as a screen for PD in a clinical sample of substance abusers.Convergent validity of the SAPAS with both categorical and dimensional representations of personality disorders was estimated.In this sample, the SAPAS correlated well with dimensional representations of cluster A and C personality disorders, even after controlling for ADHD symptoms, anxiety/depression symptoms and recent substance use. The SAPAS was also significantly associated with total number of PD criteria, although correlation with categorical measures of PD was weak.The SAPAS is an valid brief screen for PD as assessed dimensionally. Personality pathology is common among substance dependent patients . SubstanThe Structured Assessment of Personality Abbreviated Scale (SAPAS) is an eight-item screening interview for personality disorder . Its purIn a previous study of a Danish population, it was found that the SAPAS correlated with staff-ratings of externalizing behaviour and global assessment of functioning in a methadone maintenance clinic . HoweverThere is an ongoing debate regarding the independence of axis II disorders from axis I disorders . As axisIn addition, it is unclear how well the SAPAS measures the full range of personality pathology. The DSM-IV lists 10 different personality disorders (plus 3 appendix disorders for further study) , and theThe aim of the present study was to examine the convergent validity of the SAPAS with structured interviews from both a categorical and a dimensional perspective, using a different sample than those in the original study.Specifically, we wanted to study the following questions:• Is the SAPAS associated with dimensional scores representing personality disorder in general, defined as the total number of axis II criteria met?• Is this association robust across individual disorders, and the three clusters of the DSM-IV?• Is this association robust after controlling for gender, age, current symptoms of anxiety and depression, symptoms of attention-deficit hyperactivity disorder, and recent substance use?We set out to examine the concurrent validity of a mini-interview for personality disorder Structured Assessment of personality - Abbreviated Scale . In ordeSubjects were approached by their caseworkers, and informed that they had the option to be assessed for personality disorders and other psychopathology as part of an ongoing study. Those who agreed were referred to a research technician, who explained the rationale of the study.Subjects gave consent to participate in the study no earlier than 24 hours after being informed of the purpose of the study by the research technician. The subjects were told that the data collected for the study would be used for research purposes, and at the same time be used for their treatment. After assessment, subjects were first given an individual feedback about the results of the assessment, and then, if they expressed their interest in this, this feedback was passed on to their caseworker. Subjects were also informed that without their consent, no information from the interviews would be passed on to any third party.The interviews were conducted on two different days. On the first day, the SAPAS, and all of the non-personality related instruments were administered, and on the second interview day, the AUDADIS, the PRISM and the NPI-16 were administered (see below for instrument descriptions).The sample was 85% male, and the mean age was 32.5 (range: 19 to 54). Among the respondents, 74% had used alcohol in the last 30 days before interview, 66% had used cannabis, 9% amphetamine, 30% cocaine, 11% heroin or other opiates, and 6% benzodiazepines. All patients in the sample scored 3 or more on the Severity of Dependence scale, indicating substance dependence. The mean score for the Kessler 6 was 10.8 (range: 0 to 21), indicating elevated scores on depression and anxiety. The mean score for the ADD scale was 19.7 (range 2 to 34), where scores above 23 indicate likely ADD. The mean for the hyperactivity scale was 17.0 (range: 7 to 34) where scores above 23 indicate likely hyperactivity disorder.The Structured Assessment of Personality Abbreviated Scale (SAPAS) is an eight-item screening interview for personality disorder . Each itThe Kessler 6 (K6) is a 6-item interview. Each question starts with the expression "How often in the past month did you feel ..." and offers specific symptoms such as "restless or fidgety," "nervous," and "so depressed that nothing could cheer you up?" The 5 possible responses range from "none of the time" to "all of the time" and are scored from 1 to 5; the items are summed to obtain a total score. The K6 has been found to correlate substantially with both the Comprehensive International Diagnostic Interview-Short Form and the World Health Organization Disability Assessment Schedule . InternaThe Adult ADHD Self-Report Scale (ASRS) is an 18The Psychiatric Research Interview for Substance and Mental Disorders (PRISM) interview is a semi-structured interview assessing a range of disorders that are commonly co-morbid with substance use disorders. Each item is assessed by asking a question, and when positive answers are given, follow-up questions are asked to assess the severity and persistence of a symptom. Each item is scored as 1 (absent), 2 (sub-threshold) or 3 . The PRISM has demonstrated validity for antisocial and borderline personality disorder (e.g ). In theThe Alcohol Use Disorder and Associated Disabilities interview Schedule-IV (AUDADIS-IV) is a fully structured interview covering a range of disorders, including personality disorders. At the time of this study, only the proportions of the interview that covered avoidant, dependent, obsessive-compulsive, paranoid, schizoid, histrionic and antisocial personality disorder were published. The AUDADIS has demonstrated validity and reliability , althougThe Narcissistic Personality Inventory-16 (NPI-16) is an abFor the patients n = 54) who completed both the SAPAS and the full personality disorder assessment, we estimated the agreement between the SAPAS with the cut-off of 3 or more based on the original article who comp.We conducted a series of linear regressions to assess the association between the SAPAS and number of personality disorder criteria controlling for various confounders, one for each cluster, and one for total number of personality disorder criteria. In each regression, the dependent variable was symptom count for personality disorders . The covariates were age, gender, and severity of anxiety or depression symptomatology as measured by the Kessler 6 interview, and severity of attention deficit problems and hyperactivity as measured by the ADHD Self-Report Scale.In terms of number of criteria, we used the sums of the PRISM borderline and antisocial and AUDADIS histrionic personality for cluster B pathology, the sum of avoidant, dependent and obsessive-compulsive personality disorder criteria for cluster C pathology, and the sum of paranoid and schizoid personality disorder criteria for cluster A pathology.The NPI is not a diagnostic instrument per se, and while it has been shown to predict important indicators of narcissistic pathology, we did not include the NPI as a part of cluster B pathology in the analyses.Danish IBRs do not evaluate studies that do not involve invasive procedures or the manipulation of pharmacotherapy or diet. Dr. Peter Ege, senior consultant of social medicine in the City of Copenhagen, did an informal review of the ethical implications of the study.Among the 54 patients in the sample, the most common personality disorders were antisocial , paranoid , borderline , and histrionic personality disorder.Of the 54 patients who could be included in this analysis, 35 (65%) scored 3 or more on the SAPAS, and 49 (91%) received a diagnosis of at least one personality disorder based on either the PRISM or the AUDADIS interview . The agreement was statistically significant although was weak.The correlations between the SAPAS and the criteria count for each personality disorder and by cluster are summarized in table Correlations between the SAPAS and antisocial, histrionic and obsessive-compulsive personality disorder were non-significant and low. Also shown in table After controlling for gender, age and symptoms of anxiety and depression as measured by the Kessler 6 interview , and hypAs a dimensional measure of the construct of personality disorder, the SAPAS possesses several attractive properties: it correlates highly with the number of interview-based criteria for personality disorder, and this correlation remains significant even after controlling for gender, age, symptoms of anxiety and depression, attention-deficit hyperactivity disorder symptoms, and recent substance use. The associations between the SAPAS and cluster A and C disorders were also robust across all confounders tested.However, it also has important limitations: the SAPAS does not cover the full range of personality disorders equally well. It does not correlate highly with antisocial, histrionic and obsessive-compulsive personality disorder, and with trait narcissism.Some other correlates of personality disorder severity deserve comment. These other correlates of personality disorder criteria varied by cluster. Cluster A criteria (paranoid and schizoid) showed an independent association with attention disorder type symptoms. Previous research has shown an elevated risk of all types of personality disorder across types of personality disorders .The current study also has important limitations. The focus on borderline and antisocial pathology meant that we chose an instrument that is different from the instrument used for the other disorders, the AUDADIS.Hyperactivity type symptoms were significantly associated with cluster B disorders. Borderline and antisocial personality disorders are both believed to share a number of features with the full ADHD syndrome, and in particular with the hyperactivity part of ADHD . ProspecSome limitations must be acknowledged. This study is limited to substance abusers seeking outpatient treatment. However, given existing evidence from psychiatric patients and methadone maintenance treatment, the present study adds to our confidence in the validity of the instrument. The sample size is also a limitation of the present study. However, given the focus on convergent validity, weak to moderate correlations that are not robust to the influence of covariates is unacceptable.In summary, we found the SAPAS was an acceptable screen for the odd/eccentric and anxious/fearful dimensions of PD, although it performed less satisfactorily for the domain of dramatic/impulsive personality disturbance. It is likely that a dimensional classification system for personality disorder will be introduced in DSM-V and in tThe authors declare that they have no competing interests.MH organized the study. Both authors planned the current report, MH conducted the statistical analyses, and drafted the manuscript. PM reviewed the manuscript, and both authors revised the manuscript several times in conjunction.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-244X/10/10/prepub |
We also review and discuss the available literature.Bevacizumab is currently approved in association with first- and second-line 5-fluorouracil–based chemotherapy regimens for patients with metastatic colorectal cancer. Few data about the usefulness of bevacizumab in third-line settings are available. We describe a patient refractory to The tumour was invading the right iliac fossa up to the superficial abdominal wall. This patient underwent extensive right hemicolectomy with partial abdominal wall resection on June 21. Pathology studies revealed a 7×8-cm infiltrative grade pet)–computed tomography (ct) and contrast-enhanced ct imaging in September 2005 in advance of chemotherapy showed a 15-mm hypermetabolic subcutaneous mass in the right axillary region and multiple metastatic lymph nodes and peritoneal implants. The patient received 12 cycles of folfiri, given every 2 weeks from October 2005 to March 2006. A combined pet–ct imaging study in april 2006 showed reduced metabolic activity, but stable disease according to the response Evaluation Criteria in Solid Tumors (recist) guidelines cea rapidly rose over the subsequent weeks, and pet–ct imaging in June 2006 demonstrated disease progression with 2 new intra-abdominal lesions, 1 along the psoas muscle and 1 along the right hepatic artery. Second-line chemotherapy with 8 cycles of folfox6 was given every 2 weeks from June to September 2006. Serum cea declined slightly after the first 3 cycles and then rose again under chemotherapy . A control pet–ct study in October 2006 demonstrated further disease progression of the right psoas muscle mass up to 4 cm.After a significant delay because of postoperative recovery and wound healing, combined positron-emission tomography in September and December 2007 for right groin and flank pain and reduced functional capacity.folfiri, without significant clinical improvement. He then received 10 cycles of bevacizumab (5 mg/kg) every 2 weeks in addition to folfiri. Post-treatment evaluation showed near-normal functional capacity. The pain had resolved, and the patient was no longer taking analgesics. Serum cea dropped markedly to 24 μg/l, and new pet–ct imaging showed diminished metabolic activity and reduced sizes of most of the lymph nodes and metastatic implants, qualifying for a partial response according to recist criteria , progression-free survival (pfs), and overall survival (os). A similar scenario is happening with targeted agents that are already showing benefits and promising results.Currently, seven chemotherapy drugs have been approved for patients with mcrc. Most clinical trials so far have evaluated bevacizumab in the first- and second-line settings, and data concerning its efficacy in third-line settings are scarce. The U.S. National Cancer Institute’s Treatment referral Center Trial by Chen et al. reported low rrs for third-line therapies using bevacizumab rr was 4%, but an independent review evaluated the rate at 1%. The pfs was 3.5 months, and the os was 9 months. Another trial presented by Emmanouilides et al. concluded that bevacizumab could result in disease stabilization and clinical benefit in a proportion of heavily pretreated patients, with a median time to progression of 16 weeks crc are still unclear and must be assessed in randomized studies.Bevacizumab was the first targeted agent to be approved for routine use in met al. reported on the efficacy and feasibility of bevacizumab-containing third-line chemotherapy in a patient with mcrc that had progressed under folfox and folfiri chemotherapy regimens crc patients pretreated with folfiri and folfox and receiving salvage bevacizumab plus either folfiri or folfox demonstrated a rr of 9.5%. The median pfs and os were 5.3 months and 9.5 months respectively In June 2008, Shitara folfiri chemotherapy, and despite further tumour progression under folfox and capecitabine chemotherapy, he presented spectacular clinical improvement, reduction of tumour markers, and partial response on ct scan under bevacizumab–folfiri third-line chemotherapy. All these data underline the potential role of bevacizumab-containing chemotherapy beyond second-line treatment, especially for patients who did not receive bevacizumab-containing first- or second-line chemotherapy. In such patients, the utility of bevacizumab-containing third-line therapy should be considered.Our data accords with the three latter reports. Our patient initially presented stable disease and then rapid tumour progression after first-line |
Previous research has shown that academic physicians conflicted by funding from the pharmaceutical industry have corrupted evidence based medicine and helped enlarge the market for drugs. Physicians made pharmaceutical-friendly statements, engaged in disease mongering, and signed biased review articles ghost-authored by corporate employees. This paper tested the hypothesis that bias affects review articles regarding rimonabant, an anti-obesity drug that blocks the central cannabinoid receptor.A MEDLINE search was performed for rimonabant review articles, limited to articles authored by USA physicians who served as consultants for the company that manufactures rimonabant. Extracted articles were examined for industry-friendly bias, identified by three methods: analysis with a validated instrument for monitoring bias in continuing medical education (CME); analysis for bias defined as statements that ran contrary to external evidence; and a tally of misrepresentations about the endocannabinoid system. Eight review articles were identified, but only three disclosed authors' financial conflicts of interest, despite easily accessible information to the contrary. The Takhar CME bias instrument demonstrated statistically significant bias in all the review articles. Biased statements that were nearly identical reappeared in the articles, including disease mongering, exaggerating rimonabant's efficacy and safety, lack of criticisms regarding rimonabant clinical trials, and speculations about surrogate markers stated as facts. Distinctive and identical misrepresentations regarding the endocannabinoid system also reappeared in articles by different authors.The findings are characteristic of bias that arises from financial conflicts of interest, and suggestive of ghostwriting by a common author. Resolutions for this scenario are proposed. In 1998, the number of overweight and obese individuals in the USA swelled instantaneously by 37 million, when a NIH task force redefined overweight as a body mass index (BMI) ≥25 kg/mdisease mongering, which includes the promotion of new diseases, the expansion of illness boundaries, the medicalization of normal physiology, and the expansion of markets for disease treatments In 2004, researchers from the Centers for Disease Control (CDC) reported that obesity caused 400,000 deaths in the year 2000 1) receptor, an integral part of the endocannabinoid system (ECS) 1 in a feed-forward dysfunction 1 antagonist would suppress appetite. However, endocannabinoids do more than modulate appetite. The ECS plays important roles in neurogenesis, neurodegenerative diseases, mood disorders, pain perception, gut function, immunity, and inflammation on marketing alone in 2004. This was substantially greater than US$31.5 billion expended on domestic pharmaceutical research Two new anti-obesity drugs, rimonabant and taranabant (Merck), work by a new mechanism: blockade of the cannabinoid 1 (CBFour rimonabant-in-obesity (RIO) RCTs, all funded and conducted by Sanofi-Aventis, have been published, although 25 RCTs of rimonabant for the treatment of obesity and diabetes are completed or underway STRADIVARIUS study, which measured rimonabant's effects upon coronary artery atheroma volume secondary nonvalidated surrogate endpoints, such as normalized total atheroma volume One taranabant clinical trial has been published in the peer-reviewed literature In addition to RCTs and meta-analyses, clinicians base rational EBM decisions upon CME presented by fellow physicians. Clinicians must participate in CME to fulfill licensure requirements, making them a “captured audience” for corporate-sponsored messages. Pharmaceutical corporations routinely seed CME with review articles that promote their products, thereby further unraveling EBM In the past few years, several CME review articles of rimonabant have been published. Some authors of the review articles also served on the NIH obesity task force, the NAASO board, and coauthored RIO publications. One rimonabant review article was presumably ghostwritten because the authors were listed as “editors,” without identifying a primary author, and a Sanofi-Aventis copyright appeared in small print on the back cover of the supplement Review articles were identified through a MEDLINE search using the keywords endocannabinoid AND obesity AND rimonabant, limited to articles published prior to 2007 (when the FDA reviewed rimonabant). To be included in the analysis, a review article had to meet the following criteria:ample information (≥2 paragraphs) describing the ECS system and obesity;ample information (≥1 paragraph) describing obesity and rimonabant;authored by a USA physician who received financial support from Sanofi-Aventis.Because the study aimed to uncover identical bias by different authors, only one article by each author was analyzed; the earliest published article was analyzed and subsequent publications were excluded. Evidence of real or potential conflicts of interest was obtained by searching Google using each physician's name combined with Sanofi-Aventis. Biases and misrepresentations were measured by three methods:Review articles were analyzed with a validated instrument for monitoring bias in CME The “RIO bias tally” searched articles for biased statements or inappropriate omissions that originally appeared in the RIO publications see , graded Articles were scanned for recurrent themes and for identical misrepresentations about the ECS written by different authors.no conflict of interest,” despite easily accessible information to the contrary—searches with Google revealed all the authors served as consultants, or on speaker bureaus, or received other financial support from Sanofi-Aventis.Eight review articles were identified that met inclusion criteria r = 0.50, p = 0.11).The Takhar CME bias instrument demonstrated bias in all the review articles , with meRecurrent visual and textual themes emerged from the eight review articles. Graphics from Sanofi-Aventis promotional materials The hypothalamus was named first1 expression in the brain in descriptions of CB. Three of eight articles shared this misrepresentation 1 expression is relatively low in the hypothalamus. In human brain, the rank order of CB1 receptor density is: substantia nigra>globus pallidus>hippocampus>cerebral cortex>putamen>caudate>cerebellum>amygdala>thalamus = hypothalamus 1 expression.Adipose tissue was listed amongst tissues with dense CB Six of eight articles stated this 1 expression is relatively low or undetectable in adipose and adipocyte-rich tissue such as bone marrow 1 expression actually decreases in obese research participants 1 expression.Hepatic tissue was listed amongst tissues with dense CB Five of eight articles stated this 1 expression is sufficiently low that some independent studies failed to identify CB1 in liver at all 1 in fibrotic liver cells; hepatic CB1 expression in humans may be limited to cirrhotic or other pathological conditions All the authors of rimonabant review articles held academic positions, many at prestigious institutions. They typified “medical opinion leaders” sought by pharmaceutical corporations to sign ghostwritten articles http://spore.swmed.edu/dejavu/) using the keyword “rimonabant” revealed seven pairs of duplicate publications (including one review article identified herein). The cases of suspected plagiarism repeatedly engaged in disease mongering, which expands the market for those who sell disease remedies. Disease mongering and “supersizing” of rimonabant's indications have been criticized 1 antagonist that treats “extreme laziness” The RIO bias tally identified ten nearly-identical industry-friendly statements or inappropriate omissions in articles written by different authors . These sRationally choosing the best medication, like other sorts of clinical decision-making, has increasingly relied upon EBM. Thus whoever generates EBM, by funding RCTs, meta-analyses, and CME, may bias clinical decision-making regarding pharmaceuticals Financial conflicts of interest also bias clinical practice guidelines and FDA decisions. An analysis of 44 clinical guidelines revealed 87% of panelists received financial support from pharmaceutical companies, yet only two of the guidelines disclosed panelists' financial conflicts In summary, financial conflicts permeate the system and are by no means limited to corporations referenced in this article, such as Merck, Parke-Davis, Pfizer, Sanofi-Aventis, and Wyeth-Ayerst. On balance, pharmaceutical corporations do good work and aid in humanitarian efforts. For example Sanofi-Aventis provides artemisinin at cost to malaria-endemic countries chronic conditions such as obesity and drug or alcohol dependence, cannabinoid receptor blockade could serve in the treatment of acute endocannabinoid dysregulation, such as hepatic cirrhosis, hemorrhagic or endotoxic shock, cardiac reperfusion injury, and doxorubicin-induced cardiotoxicity While this paper was under review, Merck halted taranabant RCTs, and Sanofi-Aventis removed rimonabant from the European market. The FDA rejected rimonabant after data submitted by Sanofi-Aventis revealed adverse effects in RIO trials that went unreported in RIO publications |
There are limited data regarding the hypoxia pathway in familial breast cancers. We therefore performed a study of hypoxic factors in BRCA1, BRCA2 and BRCAX breast cancers.α, PHD1, PHD2, PHD3, VEGF and FIH was carried out in 125 breast carcinomas. These were correlated with clinicopathological parameters and the intrinsic breast cancer phenotypes.Immunoperoxidase staining for HIF-1α (P=0.008) and negativity for PHD3 (P=0.037). HIF-1α positivity (P=0.001), PHD3 negativity (P=0.037) and nuclear FIH negativity (P=0.011) was associated with basal phenotype. HIF-1α expression correlated with high tumour grade (P=0.009), negative oestrogen receptor (ER) status (P=0.001) and the absence of lymph node metastasis (P=0.028). Nuclear FIH expression and PHD3 correlated with positive ER expression . BRCA1 cancers with positive HIF-1α or cytoplasmic FIH had a significantly shorter relapse-free survival .BRCA1 tumours correlated with positivity for HIF-1α or its downstream targets.The aggressive nature of BRCA1 and basal-type tumours may be partly explained by an enhanced hypoxic drive and hypoxia driven ER degradation because of suppressed PHD and aberrantly located FIH expression. This may have important implications, as these tumours may respond to compounds directed against HIF-1 This allows for the recognition of HIF-1α by the tumour suppressor von Hippel-Lindau protein, which targets HIF-1α for degradation suggesting overexpression of HIF-1α present in a higher frequency in BRCA1-related cancers than sporadic cancers correlate expression with conventional clinicopathological parameters, (3) investigate expression in familial breast cancers stratified by intrinsic breast cancer phenotypes and (4) explore their role in patient survival.In sporadic breast cancer, previous studies have shown that HIF-1www.kconfab.org/index.shtml). The BRCAX breast cancers are defined by familial breast cancer in families without a known BRCA1 and BRCA2 pathogenic mutation. General inclusion criteria for the BRCAX subgroup were families with breast cancer meeting kConFab category 1 and 1B eligibility criteria and with a breast cancer pathology report held by kConFab.Tumour tissue microarray cores (1 mm cores) with fourfold redundancy for 147 familial invasive breast cancers were collected from the kConFab biorepository. For the purposes of this study, classification of BRCA1 and BRCA2 mutations and sequence variants was according to designations listed for research purposes on the kConFab website 5/6 and/or EGFR negative or positive), basal , HER2 and null/negative .These were compared with a cohort of 186 sporadic cancers collected from the John Radcliffe Hospital, Oxford, UK, which was characterised in a previous study . All patPatients less than 50 years of age with node positive, ER-negative tumours or tumours larger than 3 cm received adjuvant chemotherapy. Patients with hormone responsive tumours who were more than 50 years of age received 5 years of endocrine therapy. Patients were followed up for a median period of 64 months. During this time, 38 patients relapsed and 31 died (the recorded deaths were breast cancer related otherwise were censored).μm thick intervals, dewaxed, placed through graded alcohol and placed into water. Antigen retrieval was performed in PT Link using low pH for PHD1, PHD2 and PHD3 and high pH for HIF-1α, EnVision FLEX Target Retrieval Solution (Dako) for 20 min at 100°C. VEGF required antigen retrieval in pH 8 buffer (20 mM Tris/1 mM EDTA/10 mM sodium citrate) for 2 min in a pressure cooker. Endogenous peroxidase was blocked with EnVision FLEX Peroxidase-Blocking Reagent (Dako) before incubating the sections with respective monoclonal antibodies. PHD1 (112), PHD2 (366G/76), PHD3 (EG188e) and FIH (162c) antibodies were kindly donated by Professor Kevin Gatter, the Nuffield Department, Clinical Laboratory Sciences, John Radcliffe Hospital, α were purchased from NeoMarkers and BD Transduction Laboratories . Antibodies were used at the following concentrations: Neat supernatant for overnight at room temperature for PHD1, PHD2 and PHD3, 1 : 50 for 30 min at room temperature for FIH, 1 : 200 for 30 min at room temperature for VEGF and 1 : 50 overnight at 4°C for HIF-1α. Antigen–antibody complex was detected using Envision FLEX system . All the slides were counterstained with hematoxylin subsequently; they were dehydrated, cleared and mounted for the assessment.TMA sections were cut from each block at 4 α was scored only according to the presence (1+) or absence (0) of nuclear expression. For FIH, and all PHDs (both nuclear and cytoplasmic) and VEGF (cytoplasmic only), the intensity was scored as follows: 0, negative; 1, weak; 2, moderate and 3, strong staining. Using a previous defined cutoff which separates the cohort into approximately two groups of equal numbers and cancer-related death as the end points and compared using a log-rank test. Binary logistic regression was used for multivariate analyses and the Cox proportional hazard regression model was used to identify independent prognostic factors for disease-free and overall survival. Analyses were performed with SPSS 16.0 . A two-tailed P-value test was used in all analyses and a P-value of less than 0.05 was considered statistically significant.Comparisons were made using either the one-way ANOVA, log rank or α showed predominantly nuclear expression in tumour cells, whereas PHDs and FIH showed both nuclear and cytoplasmic staining as previously reported compared with BRCA2 and BRCAX associated tumours (P=0.008) (P=0.037) tumours, but there was no significant difference in expression of cytoplasmic PHD1 and PHD2 within the familial breast cancer groups (P=0.062). VEGF, nuclear PHDs and cytoplasmic FIH showed no significant difference between the familial groups (P>0.05).When stratified by BRCA mutation status, HIF-1P=0.008) . Cytoplactively) . BRCA1 tP=0.037) (P=0.011) compared with luminal phenotype (P=0.001) (P>0.05).When familial tumours were stratified by intrinsic phenotypes based on P=0.037) . SimilarP=0.011) . In contP=0.001) . Other hP<0.001). In contrast both nuclear and cytoplasmic FIH expression were significantly correlated with sporadic compared with familial cancers (both P<0.001). There was no significant difference in HIF-1α, cytoplasmic PHD1 and nuclear PHD1-3 expression between familial and sporadic cancers (both P>0.05).The expression of cytoplasmic PHD2 , cytoplasmic PHD3 and VEGF was significantly associated with familial breast cancers as a combined group compared with sporadic cancers , cytoplasmic PHD3 , VEGF ) , negative oestrogen receptor-α (ER) status (P=0.001) and the absence of lymph node metastasis (P=0.028) .HIF-1P=0.028) . On multP=0.029) and lower tumour grade (P=0.036) . Nuclear FIH also correlated with positive ER (P=0.024).Cytoplasmic FIH expression correlated with positive ER (P=0.036) . The corP=0.008), whereas cytoplasmic PHD3 correlated with tumour size (P=0.037) and ER expression (P=0.035). Cytoplasmic PHD2, nuclear PHD1-3 and VEGF did not show any significant association with any of the clinicopathological parameters.Cytoplasmic PHD1 correlated with tumour size .When familial cancers were assessed as a combined group, there was no significant correlation in relapse-free or overall survival with hypoxia factors HIF-1P=0.007) (P=0.026) (P>0.05). BRCA1 tumours with HIF-1α expression was associated with a shorter relapse-free (P=0.049) (P=0.764). There was a trend for cytoplasmic PHD1-positive tumours with BRCAX mutation to be associated with a shorter relapse-free survival, although this did not reach statistical significance (P=0.058). For BRCA2 tumours there was no significant correlation present between survival and expression of hypoxia-induced factors (P>0.05).However, when BRCA1 cancers were assessed as a separate group, cytoplasmic FIH correlated with shorter relapse-free (P=0.007) and overP=0.026) . No suchP=0.049) but not α, PHD1, PHD2, PHD3, VEGF and FIH in a series of familial breast cancers stratified by BRCA status and intrinsic phenotypes.Hypoxia is the result of an imbalance between oxygen delivery and oxygen consumption resulting in the reduction of oxygen tension below the normal level for a specific tissue . Centralα in the neoplastic cells of BRCA1-related breast cancer and basal-like cancers of tumours being positive. This is in accordance with 90% positivity in a small series of 30 patients with BRCA1 mutation . FIH inhibits HIF-1α activity by hydroxylating the asparagine residue 803, thereby preventing HIF-1α from interacting with co-factor p300 (α activity.In the present study, the intracellular location of FIH appears to have an important role in HIF-1α or its downstream targets (α activity by re-enforcing FIH-mediated inhibition of p300 recruitment.Our findings suggest the aggressive nature of BRCA1, basal-type tumours may be partly explained by an enhanced hypoxic drive and hypoxia-driven ER degradation, due to suppressed PHD and aberrantly located FIH expression. This may have important treatment implications, as these aggressive tumours may respond to compounds directed against HIF-1 targets . Of part |
In addition to smoking, genetic predisposition is believed to play a major role in the pathogenesis of chronic obstructive pulmonary disease (COPD). Genetic association studies of new candidate genes in COPD may lead to improved understanding of the pathogenesis of the disease. in microsomal epoxide hydrolase (EPHX1) and three SNPs in peroxisome proliferator-activated receptor gamma (PPARG), a new candidate gene, were genotyped in a case-control study (272 COPD patients and 301 controls subjects) in Hungary. Allele frequencies and genotype distributions were compared between the two cohorts and trend test was also used to evaluate association between SNPs and COPD. To estimate the strength of association, odds ratios (OR) (with 95% CI) were calculated and potential confounding variables were tested in logistic regression analysis. Association between haplotypes and COPD outcome was also assessed.Two proposed casual single nucleotide polymorphisms (SNP) EPHX1 phenotypes was significantly different between the COPD and the control group (P = 0.041), OR for the slow activity phenotype was 1.639 in our study. In logistic regression analysis adjusted for both variants, also age and pack-year, the rare allele of His447His of PPARG showed significant association with COPD outcome . In haplotype analysis the GC haplotype of PPARG conferred reduced risk for COPD.The distribution of imputed EPHX1 were associated with increased risk of COPD. The minor His447His allele of PPARG significantly increased; and the haplotype containing the minor Pro12Ala and the major His447His polymorphisms of PPARG decreased the risk of COPD.The "slow" activity-associated genotypes of Chronic obstructive pulmonary disease (COPD) is an increasing and serious public health problem representing the fourth leading cause of death globally. COPD is a complex human disease, associated with persistent airway inflammation, protease-anti-protease imbalance, oxidative stress, chronic obstructive bronchitis and emphysema, resulting in progressive airflow limitation that is not substantially reversed by bronchodilators. Importantly, it is a smoking-related disorder and cigarette smoking is the major environmental risk factor for development of COPD. However, the fact that only a subset of smokers 15-20%) develops clinically significant symptoms suggests that genetic predisposition also plays role in the development of COPD in our case control study , rs3856806 (His447His) and rs1800571 (Pro113Gln)) in PPARG gene, but the rs1800571 locus was left out from the analysis because it was homozygous for the major C allele in all individuals. The other two SNPs were in HWE and showed linkage disequilibrium, the extent of LD between rs10801282 and rs3856806 was found to be D' = 0.673, although the pair showed lower LD with respect to their correlation coefficient (r2 = 0.42).We have genotyped three exonic SNPs . The minor Ala allele of the Pro12Ala variant had an OR of 0.679, suggesting a protective effect, however it did not reach significance . The strength of association was also assessed, for this haplotype . This finding suggests a protective effect for the GC (12Ala/447His) haplotype of the PPARG gene for COPD outcome , the homozygous minor Thr113His variant showed only a borderline association with the COPD phenotype (P = 0.095), however the level of association was further reduced when the model was adjusted for age, sex and pack-years.In our study of individual SNPs in There is complete linkage equilibrium between Tyr113His and His139Arg SNPs and no statistical significance was found in haplotype frequency distribution and their association with COPD phenotype.EPHX1 is involved in the detoxification of epoxide intermediates in tobacco smoke, the rate of conversion of these highly reactive compounds could affect an individual's ability to cope with the toxic effect of cigarette smoke [EPHX1 activity in patient and control groups [EPHX1 activity. Interestingly the control group showed an excess of very slow phenotypes, but its frequency was low in both groups. In our analysis the slow activity variant of EPHX1 enzyme was associated with a significantly increased the risk for COPD. This result provides additional support to the notion that EPHX1 is likely to be involved in COPD pathogenesis.Since te smoke . We havel groups ,26. The PPARG agonists suggest the use of PPARG ligands in COPD therapy [PPARG gene polymorphisms with the development of asthma has been reported [PPARG gene association existed between the presence of certain PPARG gene polymorphisms and COPD outcome. Using IHC staining and RT-QPCR measurements, we have confirmed PPARG mRNA and protein expression in lung tissues and particular in AM [PPARG has a role in the development in COPD.Previous studies about the potent anti-inflammatory properties of the therapy ,30,31 anreported . These lar in AM . AlthougPPARG - rs1801282, rs3856806 and rs1800571 - the rs1800571 was excluded since all individuals carried an identical homozygous genotype [Among the three SNPs we have genotyped in genotype . Our singenotype ,35. Any A modest pair-wise LD was found between rs1801282 and rs3856806. Since the use of SNP-based haplotypes in genetic association studies may offer a more powerful approach than the use of individual SNPs, a haplotype analysis was also performed. A significant difference was found in the frequency of GC haplotype between the control and COPD groups and the association of this haplotype to COPD outcome was also determined. The GC haplotype confers a significant lower risk for COPD, pointing to a potential functional protective effect of this haplotype.PPARG protein to peroxisome proliferator response element was found to be associated with lower body mass index, improved insulin sensitivity, decreased risk of type 2 diabetes [Interestingly the minor allele of Pro12Ala polymorphism that lowers the binding affinity of diabetes ,37 and rdiabetes . Higher diabetes ,40.PPARG gene should be investigated in order to clarify the association of PPARG and individual susceptibility to the development of COPD.We are aware of the fact that significant results could prove to be false positives, and a clear limitation of our study is the relatively low sample size. The study has other limitations such as that population stratification should be investigated in these kinds of studies and we did not analyze a second cohort to replicate our results. Possible gene-gene and gene-environment interactions pose a difficulty for genetic analysis of COPD association studies, too. Further studies using larger populations are needed and other variants in the EPHX1 polymorphisms and phenotypes imputed from exon 3 and exon 4 genotype data in COPD outcome in a Hungarian population.In summary, our study provided support for the suggested causative role of PPARG gene polymorphisms in a case-control COPD study and characterized the association between individual SNPs and haplotypes in PPARG and susceptibility to COPD. Although the GC haplotype has a modest protective effect, it might point toward the potential importance of common alleles with weak effect in heterogeneous diseases, like COPD. The documentation of PPARG haplotype association with COPD identifies this important gene as a target of further investigation for the pathogenesis of COPD and as a potential target of therapy.We have carried out the first investigation of COPD: chronic obstructive pulmonary disease; EPHX1: microsomal epoxide hydrolase; FEV1: forced expiratory volume in one second; FVC: forced vital capacity; PPARG: peroxisome proliferator-activated receptor gammaLN has no conflicts of interests (COIs) to disclose. AP has no COIs to disclose. SP has no COIs to disclose. ECs has no COIs to disclose. BS has no COIs to disclose. BD has no COIs to disclose. IS has no COIs to disclose. IK is director of Pfizer and holder of Pfizer stock. LT has no COIs to disclose.LN is an International Scholar of HHMI and holds a Wellcome Trust Senior Research Fellowship in Biomedical Sciences, he planned and directed the study. AP performed data analyses and prepared the manuscript. SP performed the genotyping measurements and RT-QPCR analyses and prepared figures and tables. ECs organized patient recruitment and sample collection. BS organized sample preparation. BD performed IHC staining. IS performed data analyses. IK and LT participated in the planning and the design of the study and helped prepare the manuscript.All authors have read and approved the final version of the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2350/11/152/prepubTable S1. Characteristics of tested SNP. Characteristics, NCBI reference numbers and ABI assays code of examined single nucleotide polymorphisms.Click here for file |
CLOCK) gene encodes protein regulation circadian rhythm and also plays some roles in neural transmitter systems including the dopamine system. Several lines of evidence implicate a relationship between attention-deficit hyperactivity disorder (ADHD), circadian rythmicity and sleeping disturbances. A recent study has reported that a polymorphism (rs1801260) at the 3'-untranslated region of the CLOCK gene is associated with adult ADHD.The circadian locomotor output cycles kaput (To investigate the association between the polymorphism (rs1801260) in ADHD, two samples of ADHD probands from the United Kingdom (n = 180) and Taiwan (n = 212) were genotyped and analysed using within-family transmission disequilibrium test (TDT). Bonferroni correction procedures were used to just for multiple comparisons.P = 0.010). There was also evidence of preferential transmission of the T allele of the rs1801260 polymorphism in combined samples from the Taiwan and UK (P = 0.008).We found evidence of increased transmission of the T allele of the rs1801260 polymorphism in Taiwanese samples (CLOCK in susceptibility to ADHD.This study provides evidence for the possible involvement of Attention-deficit hyperactivity disorder (ADHD) is a common and heritable childhood behavioural disorder characterised by developmentally inappropriate levels of hyperactivity, impulsivity and inattentiveness. ADHD is a very complex disease. Polymorphic variants in several genes involved in regulation of dopamine and related neurotransmitter pathways are reported to be associated with ADHD . Some liVarious types of sleep disorders have been associated with ADHD -14. In aCLOCK gene was reported to be associated with evening preference and delayed sleep timing in a Japanese population and it suggests that this polymorphism may influence a human behavioural pattern and possibly lead to altered daytime brain performance [A polymorphism (rs1801260) of formance . Howeverformance .CLOCK was shown to regulate dopamine neural transmission and the CLOCK mutant mouse showed a pronounced elevation of locomotor activity [In mice study, activity . Abnormaactivity -26.CLOCK gene is located on the long arm of chromosome 4q12 . CLOCK protein is involved in the transcriptional regulation of many circadian output genes and in the core circadian clock [CLOCK locus significantly affects the regulation of transcription [The an clock ,28. Up tcription ,28.CLOCK gene and psychiatric disorders [CLOCK gene and adult ADHD with German background [Recently several groups did genetic association study between a polymorphism (rs1801260) at the 3'-untranslated region (3'-UTR) of the isorders -33. Howeckground .To provide further clarification of the reported association, in this study we examine the role of this polymorphism in two clinical ADHD samples from the UK and Taiwan.For the UK sample, DNA was collected from 180 DSM-IV ADHD combined subtype probands, from both parents for 116 of the ADHD probands and from the mother alone for 64 of the probands. Ninety-six percent of the sample was male subjects. Cases were recruited from child behaviour clinics in South-East England and referred for assessment if they were thought by experienced clinicians to have a diagnosis of the combined subtype of ADHD under DSM-IV criteria, with no significant Axis I co-morbidity apart from oppositional defiant disorder (ODD) (5.5%) and conduct disorder (CD) (15.5%). Intelligence quotient (IQ) was assessed in the majority of the subjects using the Wechsler Intelligence Scale for Children-Third Edition (WISC-III), but for those under 6 years, the Wechsler Preschool and Primary Scale of Intelligence (WPPSI) was applied.Exclusion criteria included IQ less than 70, neurological disorders or brain damage and autism. Only those individuals fulfilling the recruitment criteria after completion of research assessments were included in the study. The age range was 5-15 years at the time of assessment . Parents were interviewed with a modified version of the Child and Adolescent Psychiatric Assessment (CAPA) . InformaThe Taiwanese sample consisted of 212 children with ADHD diagnosed between the ages of 5-15 years . Both parents were available for 114 families, only the mother for 59 families and only the father for 39 families. ADHD cases were ascertained from the Child Psychiatric Clinics in the Chang Gung Memorial Hospital in Taipei area, Taiwan. A diagnosis of ADHD was made according to DSM-IV criteria following completion of a standard maternal interview and compThe rs1801260 polymorphism was genotyped using the method of PCR and enzyme restriction. Genomic DNA was amplified by using the following primers: 5'-TCCAGCAGTTTCATGAGATGC-3'and 5'-GAGGTCATTTCATAGCTGAGC-3'. The reaction was formed according to the protocol described in the study . The PCRhttp://www.mrc-bsu.cam.ac.uk/personal/frank/software/unphased/. The Bonferroni correction was applied for multiple tests and P < 0.025 was considered to show a statistically significant difference.Family genotype data were analysed using the transmission disequilibrium test (TDT) implemented in UNPHASED program (TDTPHASE) . http://Population frequencies for the SNP (rs1801260) were estimated from parental genotypes. For the UK and the Taiwanese sample the T-allele frequency of the polymorphism are 73% and 87%, respectively; the C-allele frequencies are 27% and 13%, respectively. Allele frequencies of the SNP did not show any significant deviation from those expected according to Hardy-Weinberg equilibrium in either population.2 = 6.701, P = 0.010, OR = 2.06). No significant association was found between this polymorphism and ADHD in the UK sample , while combining the two datasets together the T allele of rs1801260 SNP was significantly over-transmitted to affected probands . Even after correcting P-values using the Bonferroni method for multiple tests a significant association was still found between the T allele and ADHD.TDT analysis Table showed tCLOCK gene (rs1801260) in two independent samples of ADHD probands from UK and Taiwan. We found a significant over-transmission of the T allele of rs1801260 SNP to ADHD cases in Taiwanese population. No association was observed between this polymorphism and ADHD in the UK sample. We did however find evidence for increased transmission of the T allele of rs1801260 in the Taiwanese and UK samples pooled together (P = 0.008).In this study, we set out to investigate a previously reported finding of association between a single nucleotide polymorphism in the 3'-UTR region of the CLOCK mRNA 3'-UTR region. As for function, this polymorphism was speculated to affect mRNA [CLOCK and schizophrenia and mood disorders in the Japanese population. There was also no association found between rs1801260 SNP and schizophrenia and mood disorders [P = 0.001) between each of the adult ADHD assessment and the rs1801260 polymorphism with at least one T-mutation being the risk allele in a Caucasians of western European origin and German background. Our data suggests that the T-allele of rs1801260 polymorphism may be a risk allele in the development of ADHD and linked or contributing to a causative polymorphism for ADHD in Taiwanese population.In summary, the rs1801260 polymorphism has been detected at position 3111 in the ect mRNA . The rs1ect mRNA . This fiect mRNA ,40. The ect mRNA ,31,32. Hect mRNA . Recent isorders . To our isorders . Our stuisorders , who fouCLOCK gene and susceptibility to the disorder. Our findings support the notion that genetic variation in the 3'-UTR region of CLOCK gene might be a risk factor in the development of ADHD, particularly in the Taiwanese sample studied. Due to the small sample sizes in our study and only one published data on rs1801260 polymorphism investigated in ADHD, further association studies are needed to confirm or refute the finding. Since the 3'-UTR of CLOCK gene may contain sequences that regulate translation efficiency, mRNA stability, and polyadenylation signals, the rs1801260 polymorphism may be associated with other functional polymorphisms in 3'-UTR regions, which act as regulatory domains of the gene, and may influence the circadian rhythms [In conclusion, in this study we used family-based ADHD data in the UK and Taiwanese population to test for an association between rs1801260 SNP at the 3'-untranslated region of rhythms ,40. TherThe authors declare that they have no competing interests.XX selected the SNP, performed genotyping, genetic analysis and drafted the manuscript. GB revised the manuscript. CKC, YSH and YYW provided the Taiwanese DNA samples and clinical data. CKC also revised the manuscript. PA supervised the study and revised the paper. All authors contributed to the final critical revision of the manuscript. |
The ionic units are linked into a two-dimensional network parallel to (In the title centrosymmetric compound, C N-heterocyclic carbenes and their transition metal complexes, see: Bourissou et al. Å b = 10.6692 (12) Å c = 13.1553 (15) Å β = 112.725 (2)°V = 1485.3 (3) Å3 Z = 2 Kα radiationMo −1 μ = 2.15 mmT = 298 K 0.24 × 0.22 × 0.22 mm Bruker SMART CCD area-detector diffractometerSADABS; Sheldrick, 1996T min = 0.627, T max = 0.650Absorption correction: multi-scan (8914 measured reflections2603 independent reflectionsI > 2σ(I)1989 reflections with R int = 0.035 R[F 2 > 2σ(F 2)] = 0.044 wR(F 2) = 0.102 S = 1.07 2603 reflections163 parametersH-atom parameters constrainedmax = 0.81 e Å−3 Δρmin = −0.27 e Å−3 Δρ SMART used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809038379/ci2907sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809038379/ci2907Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Hox genes define regional identities along the anterior–posterior axis in many animals. In a number of species, Hox genes are clustered in the genome, and the relative order of genes corresponds with position of expression in the body. Previous Hox gene studies in lophotrochozoans have reported expression for only a subset of the Hox gene complement and/or lack detailed genomic organization information, limiting interpretations of spatial and temporal colinearity in this diverse animal clade. We studied expression and genomic organization of the single Hox gene complement in the segmented polychaete annelid Capitella sp. I. Total genome searches identified 11 Hox genes in Capitella, representing 11 distinct paralog groups thought to represent the ancestral lophotrochozoan complement. At least 8 of the 11 Capitella Hox genes are genomically linked in a single cluster, have the same transcriptional orientation, and lack interspersed non-Hox genes. Studying their expression by situ hybridization, we find that the 11 Capitella Hox genes generally exhibit spatial and temporal colinearity. With the exception of CapI-Post1, Capitella Hox genes are all expressed in broad ectodermal domains during larval development, consistent with providing positional information along the anterior–posterior axis. The anterior genes CapI-lab, CapI-pb, and CapI-Hox3 initiate expression prior to the appearance of segments, while more posterior genes appear at or soon after segments appear. Many of the Capitella Hox genes have either an anterior or posterior expression boundary coinciding with the thoracic–abdomen transition, a major body tagma boundary. Following metamorphosis, several expression patterns change, including appearance of distinct posterior boundaries and restriction to the central nervous system. Capitella Hox genes have maintained a clustered organization, are expressed in the canonical anterior–posterior order found in other metazoans, and exhibit spatial and temporal colinearity, reflecting Hox gene characteristics that likely existed in the protostome–deuterostome ancestor. Hox genes have represented one of the major paradigms of developmental biology for nearly three decades .Hox genes have been isolated from all major clades of bilaterians and cnidarians that have been studied. The species-specific repertoire, genomic organization, presence or absence of clusters and, in the case of vertebrates, numbers of clusters, and their deployment have formed the basis of models of animal body plan evolution and diversification Hox genes in the protostome/deuterostome ancestor. In a recent review Hox gene clusters in flies and mice quickly led to the assumption that all other animals have such clusters, yet direct demonstration of genomic linkage among Hox genes is far more limited than is generally appreciated. In addition, in animals whose genomes contain a Hox gene cluster, there is significant variation in the level of organization of the cluster. In vertebrates, Hox genes within a cluster share the same transcriptional orientation, and non-Hox genes are not interspersed among them DrosophilaHox cluster of sea urchins Hox genes are present in both transcriptional orientations, and the Drosophila ANT-C complex also has non-Hox genes present within the cluster. Other deuterostomes such as the larvacean Oikopleura dioica do not have clustered Hox genes Hox genes even within deuterostomes.Hox genes in lophotrochozoans. Although gene fragments have been recovered from a wide range of lophotrochozoans such as nemerteans, molluscs, flatworms, and annelids (including echiurans), expression data for Hox genes has been reported for many fewer species. Such expression studies include the polychaete annelids Chaetopterus variegatesPlatynereis dumerilii, and Nereis virensHelobdella robusta, Helobdella triseralisHirudo medicinalisEuprymna scolopesHaliotis asininaDugesiaHox gene complement within a single species has not been determined. Genomic organization data is even more limited. In the platyhelminth parasite Schistosoma mansoni, fluorescent in situ hybridization analysis of four Hox genes shows localization to two different chromosomes, supporting the conclusion that S. mansoni does not have a single Hox cluster Lineus sanguineus, preliminary analysis shows hybridization of two Hox genes to the same fragment of genomic DNA by southerm blot analysis Hox genes in lophotrochozoans Hox genes has not yet been reported. The lack of genomic organization and expression data within a single lophotrochozoan species has seriously limited analysis of gene order and determination of spatial or temporal colinearity.Far less is known about Capitella sp. I is a segmented polychaete annelid with a variable number of adult body segments. This semi-direct developer generates 13 segments during larval life. Following a short nonfeeding pelagic phase, animals undergo metamorphosis, which is accompanied by body elongation and loss of the ciliated prototroch, telotroch, and neurotroch. Capitella sp. I juveniles immediately commence feeding and continue to add segments by posterior addition. The adult body plan has distinct thoracic and abdominal regions, although within each region, segments appear morphologically similar. The gradual formation of more than a dozen segments during larval development in a several-day period, the simple induction of metamorphosis, and the addition of segments from a posterior growth zone during juvenile life enabled us to study temporal and spatial Hox gene expression at multiple life history stages and during two different modes of segmentation not possible in some other polychaete models.Hox cluster and expression patterns for these Hox genes from the polychaete annelid Capitella sp. I during larval and juvenile stages. We address the following questions: (1) Do the Capitella sp. I Hox genes exhibit spatial and temporal colinearity? (2) Are expression patterns observed consistent with possible roles in establishing positional identity? (3) Is there a correlation between Hox gene expression with morphological features or boundaries ? (4) Are Hox genes involved in patterning of the segments added by a localized posterior growth zone during adult life? (5) Are there commonalities in Hox gene expression among annelids? (6) Are features of Hox gene expression in annelids conserved with other metazoans?In this study, we present detailed genomic linkage data of the first lophotrochozoan Capitella sp. I was maintained using culture methods developed by Capitella were collected as previously described.A colony of Hox gene orthologs were isolated from either genomic DNA (gDNA) or an excised lambda ZAPII library generated from mixed embryonic and larval stages of Capitella sp. I, and several degenerate primer sets corresponding to the conserved homeodomain were used in degenerate PCR amplifications. 117-bp fragments of the central class Hox genes CapI-Dfd, CapI-Scr, CapI-lox5, CapI-lox4, and CapI-lox2 were amplified with the primers ELEKEF (5′-GARYTNGARAARGARTT-3′) and WFQNRR (5′-CKNCKRTTYTGRAACCA-3′). A 141-bp fragment of CapI-lb was recovered using the primers NFTNKQLT (5′-AAYTTYACHAAYAARCARYTSAC-3′) and WFQNRR, and CapI-Hox3 (155 bp) with KLARTAYT (5′-AAGCTTGCCMGNACNGCNTAYAC-3′) and WFQNRR. CapI-pb (108 bp) was recovered by semi-nested PCR with the primers ARTAYT (5′-GCNMGNACNGCNTAYAC-3′) and WFQNRR, followed by ARTAYT and IAASLD (5′-TCSARNGARGCRGCDATC-3′) with 1∶100 diluted product of the first round as template for a second PCR reaction. 159-bp fragments of CapI-Post1 and CapI-Post2 were isolated using the primers RKKRKPY (5′-MGIAARAARMGIAARCCNTA-3′) and WFQNRR.Fragments of Hox gene was obtained using gene specific primers (sequences available upon request) in RACE (rapid amplification of cDNA ends) reactions in combination with either mixed embryonic/larval cDNA library as a template or RACE using the SmartRACE Kit (BD Biosciences). Fragments were conceptually spliced together and submitted to GenBank as composite transcripts with the following accession numbers: CapI-lab, EU196537; CapI-pb, EU196538; CapI-Hox3, EU196539; CapI-Dfd, EU196540; CapI-Scr, EU196541; CapI-lox5, EU196542; CapI-Antp, EU196547; CapI-lox4, EU196543; CapI-lox2, EU196544; CapI-Post2, EU196545; and CapI-Post1, EU196546. Predicted open reading frames (ORFs) were identified using MacVector. All degenerate and RACE fragments were cloned into the pGEM-Teasy vector (Promega) and sequenced at the University of Hawaii sequencing facility or Macrogen Inc. (South Korea).Additional sequence for each Capitella sp. I genome was searched using nucleotide sequences of Hox genes isolated by degenerate PCR. Spidey (http://www.ncbi.nlm.nih.gov/spidey) was used to compare genomic and previously isolated cDNA sequences to determine transcription units of Capitella sp. I Hox genes. Lengths given for introns and exons are based on these comparisons. Additional exons or introns might not have been identified due to incomplete RACE products. Scaffold data were analyzed by Genscan, a gene prediction algorithm (http://genome.dkfz-heidelberg.de/cgi-bin/GENSCAN/genscan.cgi), and predicted ORFs were compared with sequences in GenBank by blastp and tblastn (http://www.ncbi.nlm.nih.gov/BLAST).The Capitella sp. I Hox sequences were made via BLASTX searches of the GenBank database from the National Center for Biotechnology Informaiton (NCBI). An amino acid alignment of the 60–amino acid (AA) homeodomain and 12 AAs directly flanking the 3′ end of the homeodomain was generated, and includes representative sequences from acoels and nemertodermatid flatworms , chaetognaths, an ecdysozoan (Tribolium castaneum [beetle]), lophotrochozoans (Nereis virens and Capitella sp. I [annelid] and Euprymna scolopes [mollusk]), and a deuterostome . Additional lophotrochozoan paralog group 7 (PG7) sequences included are from the brachiopod Lingula anatine and the nemertean Lineus sanguineus. Bayesian phylogenetic analyses were conducted with MrBayes 3.1.2 Hox genes were assigned to paralog groups using the same methodology as Kourakis et al. Capitella Hox genes cluster with representative orthologous genes from other taxa. For example, CapI-lab clusters with chaetognath, arthropod, annelid, cephalochordate, mollusc, and acoel Hox1/lab genes with 100% posterior probability, all belonging to PG1. Alignment is presented in Putative orthology assignments of 2/filtered sea water (FSW) for 15 min prior to fixation in 3.7% formaldehyde in FSW at 4°C overnight. All stages were washed in phosphate-buffered saline (PBS) 3 times, dehydrated, and stored in methanol at −20°C. The whole mount in situ hybridization protocol has been published previously CapI-lb, 1,023-bp 5′ RACE fragment for CapI-pb, 1,337-bp 5′ RACE fragment for CapI-Hox3, 709-bp 5′ RACE fragment for CapI-Dfd, 1,116-bp 5′ RACE fragment for CapI-Scr, 947-bp 5′ RACE fragment for CapI-lox5, 662-bp 5′ RACE fragment for CapI-Antp, 889-bp 5′ RACE fragment for CapI-lox2, 1,090-bp 5′ RACE-fragment for CapI-Post2, and a 585-bp 5′ RACE fragment, a 532-bp 3′ RACE fragment, and an 883-bp combined fragment were tested for CapI-Post1 (wells containing CapI-Post1 probes were extensively overstained). Specimens were analyzed using differential interference contrast (DIC) optics on a Zeiss Axioskop Plus microscope, and digital photomicrographs were captured with a Nikon Coolpix 4500 digital camera (4.0 megapixel). The detailed protocol is available upon request.Stages 2–4 embryos were permeabilized by treatment with 0.5 M sucrose/0.125 M sodium citrate for 3 min, and larvae and juveniles were relaxed in 1∶1 0.37 Mol/l MgClHox genes from Capitella sp. I, a mixed-stage embryonic and larval library was screened by PCR using degenerate primers designed to conserved regions of previously isolated lophotrochozoan Hox genes for specific Hox classes. Fragments of 10 Hox genes were recovered. Additional sequence was retrieved by RACE using gene-specific primers and by BLAST searches of genomic trace files. An eleventh Capitella sp. I Hox gene, CapI-Antp, was identified by a directed search of the Capitella sp. I genome (Joint Genome Institute [JGI]). Lengths of recovered fragments, predicted ORFs, GenBank accession numbers, paralogy groups, and protein ID numbers from the annotated Capitella sp. I genome project (JGI) are shown in To isolate Capitella sp. I genome possesses definitive members of all four classes of Hox genes proposed to be present in the bilaterian ancestor Hox genes can be classified both by phylogenetic analyses and also the presence of diagnostic AA motifs found within and flanking the highly conserved 60-AA homeodomain Hox gene complement in Capitella as is found in other lophotrochozoans , a single PG3 gene (Hox3/zen), six central class genes and two posterior genes (PG9-14: Post1/Post2/AbdB). Capitella sp. I has a definitive Antp/PG7 gene, which clusters with other lophotrochozoan, ecdysozoan, and deuterostome central class genes, including the ecdysozoan Tribolium antp gene , a brachiopod (Lingula Antp), and a nemertean (Lineus Hox7); ecdysozoan Antp genes; a chaeotgnath Hox gene (Flaccisagitta Hox7); and possibly deuterostome Hox6 and Hox7 genes.The molluscs . At leasntp gene . NotablyCapitella sp. I Hox genes are located on three contigs: CapI-lab, CapI-pb, CapI-Hox3, CapI-Dfd, CapI-Scr, CapI-lox5, CapI-Antp, and CapI-lox4 are all on scaffold 70 and span 243 kbp and 23.4 kb 3′ of CapI-lox2 (from CapI-lox2 to the end of the scaffold) is consistent with a larger Hox cluster in the genome, although we do not currently have direct evidence of linkage between these two scaffolds. If scaffolds 70 and 292 are linked, the cluster would span at least 345 kb. CapI-Post1 is on scaffold 33, and predicted non-Hox genes were identified in proximity to both 5′ and 3′ of this transcription unit, suggesting that the Post1-ortholog is not part of the Capitella Hox cluster. 243 kbp . CapI-loCapI-lab is located at the 3′ end of the Hox cluster . The first two are separated by a large intron of 7.7 kb, and the small second intron (513 bp) is located within the homeobox. CapI-Hox3 is located 7.6 kb 5′ of CapI-pb. This 27.8-kb transcription unit contains three introns separating four exons of 385, 46, 563, and 2,070 bp. CapI-Dfd has a small transcription unit of 1.5 kb, with two exons of 395 and 651 bp, separated by a 439-bp intron, and is located 33.3 kb 5′ of CapI-Hox3. The 6.2-kb transcription unit of CapI-Scr is 31.4 kb upstream of CapI-Dfd and consists of two exons of 612 and 876 bp, separated by a 4.7-kb intron. The CapI-lox5 transcript is composed of two exons and a single intron of 2 kb, located 9.4 kb 5′ of CapI-Scr. CapI-Antp is located about 17.2 kb 5′ of CapI-lox5. The transcription unit of CapI-Antp contains two exons of 640 and 841 bp separated by a 6-kb intron. The transcription unit of CapI-lox4 is 4.5 kb and contains a single intron of 3.2 kb separating two exons of 520 and 756 bp. CapI-lox4 is located 90.4 kb 5′ of CapI-lox5. On scaffold 70, the 5.5-kb CapI-lox2 transcript contains a single intron of 3.8 kb separating two exons of 1,169 and 599 bp. CapI-Post2 is located 11.4 kb 5′ of CapI-lox2 and has four exons and three introns . cluster . Its 6-kCapitella sp. I has been described previously Capitella sp. I has a nonfeeding larva, and adult gut morphogenesis occurs during late larval stages, resulting in a distinct pharynx, esophagus, midgut, and hindgut Capitella larvae are competent to undergo metamorphosis, triggered by stimuli in the sediment. During metamorphosis, the body loses its trochal bands, elongates, initiates feeding, and becomes limited to a benthic lifestyle. Like other polychaetes, Capitella is capable of generating new segments at multiple life history stages, and juveniles continue to grow by posterior addition of segments. The body has a distinct thoracic region of nine segments and an abdominal region of comparatively thinner segments with approximately 55 segments in mature adults.Development of Hox genes was analyzed by whole mount in situ hybridization from early larval stages (stage 4) to 3 d following metamorphosis. Specificity of the probes was confirmed by processing control larvae and juveniles without probe or with sense probes. No staining was observed in these controls (not shown).Temporal and spatial expression of all CapI-lab transcript is expressed in a number of distinct tissues. Weak expression is initially detectable at stage 4 in bilateral anterio–medial domains within the presumptive segmental tissue. This expression appears prior to segmentation (unpublished data). At stage 5, CapI-lab is expressed in two discrete areas: a pair of closely positioned patches in the dorsal wall of the stomodeum, and continued expression in the segmental tissue in the region of the VNC . At stage 5, it becomes apparent that this expression is in the subesophageal ganglion . The same pattern persists into stage 5, and includes expression in a large ventro–lateral ectodermal domain spanning all but the most anterior segment . At stage 6, weak expression of CapI-lox2 is detectable in the ventro–lateral ectoderm of the abdominal segments .CapI-Post2 expression is initiated at the same time as CapI-lox2 (stage 5), although at higher levels. Expression is in bilateral ectodermal bands of the two abdominal segments present at this stage (A1 and A2), confined to the ventro–lateral region of these segments, and absent from the ventral midline to T8. CapI-Dfd shows expression from the posterior side of T2 (second ganglion) to T8. CapI-Hox3 is prominently expressed in the posterior growth zone, and is also detectable in T2 through T8 (weaker in T2 and T3). The anterior central class genes CapI-Scr and CapI-lox5 are expressed in segments T3 to T8 and T4 to T8, respectively. CapI-Antp expression is in segments T5 to T9, and CapI-lox4 is expressed in T7 to T9 and the anterior abdominal segments, A1 to A3. The expression patterns of CapI-lox2 and CapI-Post2 appear identical; VNC expression is observed in all abdominal segments. Newly formed ganglia exhibit the strongest expression of CapI-lox2 and CapI-Post2. CapI-Post1 expression is not detectable in juveniles. The juvenile expression patterns contrast with larval patterns for CapI-lab, CapI-pb, CapI-Hox3, CapI-Dfd, CapI-lox5, and CapI-Antp, which are initially broadly expressed and share the same posterior boundary (the posterior growth zone). At late larval stages (stages 8/9), these patterns have been refined, and in most cases they predict juvenile anterior and posterior expression boundaries.In contrast to the broad ectodermal patterns expressed during larval development, the VNC , with a segments . In juveCapI-lab, CapI-pb, and CapI-Hox3 are expressed outside the VNC. Esophageal CapI-lab expression is limited to the posterior portion of the esophagus. These CapI-lab–expressing cells have a neural-like morphology, and are likely a subset of the stomatogastric nervous system or sensory cells connecting to the esophagus. The segmental epidermal stripe pattern of CapI-pb observed in late larval stages persists into juvenile stages, albeit at lower levels, with the most discrete stripes in T5 to T7. There is also expression in the prepygidial epidermis. CapI-Hox3 is expressed prominently in the mesoderm of the posterior growth zone, and is the only CapI-Hox gene expressed in the posterior growth zone of juveniles.In juveniles, only Hox genes form a class of highly conserved genes that play key roles in body plan regionalization. In addition, in a number of cases for which genomic information is available, Hox genes appear in clusters, presumably reflecting their evolutionary origin by tandem duplication. Although there are several studies of Hox genes for various annelids , spanning 21.6 kb. Only CapI-Post1 is not clustered with any other Capitella Hox genes. Therefore, we cannot directly demonstrate the presence of a single intact cluster containing all Capitella Hox genes. If additional evidence demonstrates genome linkage between the two contigs containing multiple Hox genes, this cluster would span at least 345 kb, larger than vertebrate Hox clusters (70 kb to 180 kb) Hox clusters , and CapI-pb and CapI-Hox3 are larger . In contrast, Drosophila Hox genes range from 6–70 kb, and Antp is 103 kb HoxA-cluster ranging from 2.25 kb to 3 kb, with the exception of HoxA3 (20.8 kb).The size of Capitella sp. I Parahox genes, whose expression we previously described CapI-Xlox and CapI-Cdx (transcription unit size of 7 kb and 6.35 kb. respectively) are located approximately 33 kb apart on the same contig (scaffold 444), whereas CapI-Gsx is on a separate contig (scaffold 760). In contrast to Capitella Hox genes, CapI-Xlox and CapI-Cdx have opposite transcriptional orientations. In addition, there is at least one predicted gene between them, and several genes flank CapI-Xlox and CapI-Cdx. None of the Parahox genes are linked to any contigs containing Hox genes. In vertebrates, the homeodomain-containing genes eve and mox are linked to the Hox genes, a genomic organization known as the extended Hox cluster Capitella sp. I orthologs of eve and mox are not linked to any of the Capitella Hox genes .We also examined the genomic organization of the Capitella sp. I Hox genes, including 6 central class members, advances our understanding of protostome Hox cluster evolution. It has been suggested that the ancestral protostome Hox cluster contained between 8 and 11 genes Hox cluster is strongly supported, the evolution of the other central and posterior class Hox genes is less clear. The identification of a definitive PG7 gene (CapI-Antp) that clusters with several other lophotrochozoan genes, ecdysozoan Antp, and a chaetognath PG7 gene (Fen Hox7), and its genomic position between Lox5 and Lox4 in the Capitella Hox cluster, strongly suggests that a single PG7 class gene was present in the ancestral protostome cluster. The hypothesis that ecdysozoan ftz and lophotrochozoan Lox5 genes are PG6 orthologs, and not the result of clade-specific duplication events Lox4/Lox2/Ubx/AbdA). Lox4/Lox2 genes do not form a monophyletic clade in our analyses, although Ubx/AbdA genes do, suggesting that Lox4 and Lox2 as well as Ubx and AbdA arose by separate duplication events in lophotrochozoans and ecdysozoans, respectively Hox genes appear to be especially labile , a single Hox3 gene, 5 to 6 central class genes , and 1 to 2 posterior genes. It is noteworthy that the same 11 Hox genes have also been reported for the polychaete annelid N. virensHox genes of Capitella sp. I that are arranged into 1 to 2 “organized clusters” CapI-Post1) share the same transcriptional orientation, lack non-Hox genes interspersed among them, and appear to approximate the prototypical and ancestral organization of the protostome-deuterostome Hox cluster.Our identification and analyses of 11 Capitella sp. I Hox genes display unique expression patterns, and their expression is initiated within a narrow time frame during larval development, which can be clearly distinguished into four temporal classes the segmental portion of the body. The anterior-most Hox gene expression boundary is that of CapI-pb, whose anterior boundary is immediately posterior to the mouth. In both larval and juvenile stages, anterior boundaries of adjacent Hox genes are staggered (Hox expression boundary (either anterior or posterior boundary). In the abdomen, only A1 has a unique Hox boundary. CapI-pb expression is distinct from the contiguous ectodermal expression domains of other Hox genes; it has a stripe pattern in all segments, suggesting involvement a process other than anterior-posterior patterning. None of the Capitella sp. I Hox genes is expressed in the unsegmented posterior terminus, in contrast with pygidial expression of several Hox genes in Nereis and PlatynereisHox gene expression in a lophotrochozoan, and are consistent with an ancestral role for Hox genes in patterning the antero-posterior axis of the epidermis and central nervous system. The presence of spatial and temporal colinearity in all three bilaterian superclades indicates these features were likely present in the protostome–deuterostome ancestor.During larval development, taggered and 15, Capitella sp. I: the anterior boundary of CapI-pb is displaced anterior to that of CapI-lb, CapI-Hox3, and CapI-lab have the same anterior expression boundary, and CapI-lox2 and CapI-Post2 share the same anterior and posterior boundaries. Both CapI-pb and CapI-Hox3 also exhibit noncanonical Hox gene expression (see below). The anterior shift of the Hox2/pb expression boundary relative to that of Hox1/lab is widely found across taxa, including vertebrate examples such as mouse and zebrafish Chaetopterus and Platynereis. Therefore, this shift may represent a general feature rather than an exception pb relative to lab, and Drosophila pb is displaced caudally Hox1 and Hox3 orthologs also share an anterior expression boundary in Nereis virens and the spider Cupiennius saleiHox2/pb and Hox3 orthologs have not been isolated, and we were unable to identify them in searches of the Helobdella genome (http://genome.jgi-psf.org/Helro1/Helro1.home.html). Since there is a gap of only a single segment between the anterior boundaries of He-Lox7 (Hox1) and He-Lox6 (Hox4), there may be a loss of Hox2 and Hox3 paralogs in the leech genome CapI-lox2 and CapI-Post2 share the same anterior and posterior expression boundaries and are adjacent to one another in the genome, their expression patterns show gene-specific characteristics. CapI-lox2 is expressed across the ventral midline and in the VNC, where CapI-Post2 is absent, and the two genes show varying expression levels at their anterior boundary.Three exceptions to the rule of spatial colinearity are observed in Hox gene expression patterns between larval and juvenile stages in Capitella sp. I. During larval stages, most Hox genes are broadly expressed in the ectoderm and developing VNC, largely share a common posterior boundary at the posterior growth zone, and have gene-specific anterior expression boundaries. In the transition from larval to juvenile stages, two features of Hox gene expression change: almost all expression becomes limited to the VNC, and discrete posterior expression boundaries appear. Gene-specific larval anterior expression boundaries are maintained into juvenile stages for all Hox genes except for CapI-Antp, in which the anterior boundary shifts rostrally by one half-segment. In juveniles, the expression of each Hox gene spans a few segments, and adjacent Hox genes show partially overlapping but staggered domains of expression in the VNC. For CapI-lox2 and CapI-Post2, newly formed posterior ganglia exhibit the strongest expression, reminiscent of the slight gradient seen in Nereis virens for these two genes Capitella sp. I continues to add segments throughout its life, and undergoes robust posterior regeneration from multiple axial positions, there may be a need to maintain axial information into adulthood. Distinct expression patterns between larval and juvenile stages have not been reported in other annelids. Chaetopterus Hox genes are expressed in the VNC during larval development, although expression in juveniles has not been described Nereis, Hox1, Hox4, Hox5, and Lox5 expression later become more restricted to the VNC in nectochaetes, but nested central nervous system (CNS) expression does not persist into juvenile stages One of the striking findings from our study is the biphasic nature of Capitella sp. I Hox genes are expressed in the posterior growth zone, a region that generates larval segments 10–13, and all segments formed after metamorphosis. As expression patterns mature during late larval and early juvenile stages, posterior expression boundaries appear anterior to the growth zone. Only CapI-Hox3 shows persistent growth zone expression in juvenile stages. This situation contrasts with a greater number of Hox genes in Nereis juveniles that exhibit posterior growth zone expression, including lox2, post2, Hox3, Lox5, Hox7 (Antp), and Lox4. During early larval stages in Chaetopterus, transient growth zone expression is observed for CH-Hox1, CH-Hox2, CH-Hox3, CH-Hox4, and CH-Hox5During larval stages, nearly all Hox genes correlate with the transition between the thorax and abdomen in Capitella sp. I show nested sets of trunk ectodermal and neuroectodermal expression, CapI-lab, CapI-pb, CapI-Hox3, and CapI-Antp have additional expression domains, some of which are conserved with other taxa. Both Capitella and Platynereis have Hox1/lab-positive cells in the head epidermis, although Nereis does not Platynereis Hox1/lab-positive cells are apical tuft cells, a cell type that neither Nereis nor Capitella have. Hox1/lab expression is generally restricted to post-oral regions in other animals. CapI-Hox3 and CapI-Antp are both expressed in the brain. To our knowledge, expression of Hox3 and Antp orthologs or other Hox genes in the brain has not been reported for other protostomes.Although all CapI-lab, CapI-pb, CapI-Hox3, and CapI-Antp are expressed in the presumptive foregut. Foregut expression of Hox1/lab and Hox2/pb orthologs is also reported for ChaetopterusHox1 is expressed at the foregut–midgut boundary in Nereis and Platynereis metatrochophores. To our knowledge, foregut expression of Hox3 and Antp/Hox7 has not been reported for annelids other than Capitella. Outside annelids, anterior Hox gene expression in the developing digestive tract is observed in hemichordates BranchiostomaDrosophilaHox genes associated with the foregut among deuterostomes, lophotrochozoans, and ecdysozoans appears to be conserved.Post1 in lophotrochozoans are quite limited. In the cephalopod Euprymna scolopes, Post1 is expressed in the developing ganglia of the brachial crown, but direct comparison with annelids is difficult due to the specialized cephalopod body plan Post1 expression has only been reported for N. virens and P. dumerilii, and is detected in larval chaetal sacs in both polychaetes Capitella sp. I, CapI-Post1 is not clustered with any other Capitella Hox genes or expressed in broad ectodermal domains at any stage we examined, although we observed expression in the chaetal sacs. CapI-Post1 may also be expressed during life history stages other than those we analyzed, is likely not involved in vectorial patterning, and may have been recruited for other functions.Expression data for Hox genes in vectoral patterning along their main body axis. Due to its key role in axial patterning and segment identity, it is thought that Hox cluster evolution is intricately linked with the evolution of the body plan itself. The five annelids in which Hox gene expression has been studied have a number of important species-specific differences relevant to axial patterning. These differences include direct versus indirect development, differences in segment number generated during larval and adult stages, heteronomy versus homonomy, and morphology of the adult body plan. Chaetopterus exhibits the most complex body regionalization, with three distinct body regions and a number of segments that possess unique specialized structures Nereis and Platynereis are highly uniform, and distinct body regions are not morphologically distinguishable Capitella and Helobdella represent an intermediate level of body regionalization.Expression studies support the hypothesis that ancestral annelids used Hox gene expression patterns. Anterior boundaries of orthologous Hox genes are not consistently expressed in the same segments across species Click here for additional data file.Figure S2Capitella sp. I sequences are shown in bold; all Capitella sequences are delimited by an arrow.Neighbor-joining bootstrap consensus tree. A neighbor-joining (NJ) bootstrap consensus tree (using mean amino acid distances) was constructed using PAUP* v4.0b10 (0.39 MB TIF)Click here for additional data file.Figure S3Capitella sp. I sequences are shown in bold; all Capitella sequences are delimited by an arrow.Maximum likelihood bootstrap consensus tree. A maximum likelihood (ML) bootstrap consensus tree was constructed using RAXML v2.2.1 (0.40 MB TIF)Click here for additional data file. |
We argue that a shift from steady state to dynamic isotopomer analysis is required to deal with these cellular complexities and provide a review of dynamic studies of compartmentalized energy fluxes in eukaryotic cells including cardiac muscle, plants, and astrocytes. Knowledge of complex metabolic behaviour on a molecular level is prerequisite for the intelligent design of genetically modified organisms able to realize their potential of revolutionizing food, energy, and pharmaceutical production. We describe techniques to explore the bidirectionality and compartmentalization of metabolic fluxes using information contained in the isotopic transient, and discuss the integration of kinetic models with MFA. The flux parameters of an example metabolic network were optimized to examine the compartmentalization of metabolites and and the bidirectionality of fluxes in the TCA cycle of Saccharomyces uvarum for steady-state respiratory growth.Isotope labeling is one of the few methods of revealing the Both experimental and analytical methods enabling dynamic studies that require direct measurement of the mass and/or positional isotopomers and the pool sizes of intermediate metabolites are developing quickly , 2, 3. Tde novo design and assembly of biosynthetic pathways for both natural and unnatural compounds.” [MFA is an important tool for strain improvement in biotechnology with a vpounds.” . SynthetSaccharomyces uvarum for steady-state respiratory growth fed with 13C1,2 acetate and unlabeled glucose.This paper is a short review of the motivations for moving from MFA using data collected at isotopic steady state to making full use of the information contained in the isotopic transient. Examples are taken from recent studies that make good use of this information followed by a short section on performing this analysis under conditions of unstationary metabolism. An attempt is made to point towards the future of dynamic modeling of cellular systems using predictive kinetic models–The holy grail of modern biology. Simulations of isotopic transients are used to explore the information contained in the isotopic transient and examine techniques to exploit this information. Following this is a short example where the flux parameters are optimized for the TCA cycle in 1.1.et al. [et al. [The majority of MFA studies have been conducted at metabolic steady state, and the majority of these involve measuring isotopomers at isotopic steady state. Recent studies conducted at the metabolic and isotopic steady state include Blank et al. and Vo e [et al. . These a [et al. , 9 and m [et al. since a E.coli [Saccharomyces cerevisiae [et al. [13C NMR to track metabolite dynamics. Although little is known about protein turnover rates in vivo prokaryotes are expected to display less protein turnover than eukaryotes [A recent study demonstrates the use of MFA at metabolic steady state using isotopic transient data in the pentose phosphate pathway and citric acid cycle (TCA) of E.coli . Their mrevisiae . den Hol [et al. measuredkaryotes . Isotopi2.et al. [Solanum tuberosum). Shastri and Morgan [MFA using isotopic transient data is more often applied in eukaryotic systems as it is not so easy to avoid compartmentalization and bi-directional exchange with large metabolic pools. However, since the nature of many of these dynamic processes has yet to be elucidated, MFA using isotopic transient data has been performed mostly on small linear branches of the metabolic networks without accounting for global dynamic behavior . There aet al. who usedd Morgan assess td Morgan , 19.Often, the organism of interest cannot be sustained in a steady metabolic state over long periods of time. To overcome this limitation one could resort to simulating the isotopic transient with a non-steady metabolism, or shorten the labeling experiment to less than one minute since the concentrations of enzymes in cells remain constant over short time spans (10 s to 1min) .2.1.et al. [et al. [There has been some progress recently in MFA studies with a non-steady metabolism and a lack of kinetic structure. A few researchers have started the move towards non-stationary MFA, with Wahl et al. and Baxt [et al. recently2.2.It is widely accepted that metabolic systems ubiquitously display oscillations in metabolic fluxes through temporal compartmentalization, proposed to be driven by oscillating metabolic cycles . By turnet al. [et al. [In continuous culture yeast can be enticed to grow with a stable oscillating metabolism with a period between 40 minutes to 5 hours. While get al. measured [et al. concludeKeeping in mind that enzyme concentrations remain constant over short time spans it is conceivable that one could use a device like the BioScope to perfo3.in vivo kinetics of many enzyme systems within the metabolic network are well characterized. For many systems this information is not available, so development of kinetic models of metabolic systems is much less common than the use of phenomenological MFA to characterize metabolic activity. However, predictive kinetic models allow us to use the information content of experimental data points measured at one physiological condition to predict the dynamic behavior of the system at another physiological condition.Predictive kinetic models can be created in systems where the The modeling process involves (1) developing a theory of how the biological system operates, (2) representing the system as a set of ordinary and/or partial differential equations with direct physical meaning, (3) fitting the parameters of this system using one dataset, (4) testing the predictive qualities of the system using another related dataset, and (5) adjusting the theory and repeating the process as required. Metabolic models that have passed this kind of scrutiny allow us to predict bi-directional metabolic fluxes and system behavior under conditions where measured data is sparse. Great improvements can be achieved with the use of data gathered decades ago, which is often of high quality and fundamental in nature.The complexity and scope of the model ought to be limited by the quality and amount of measured data used to tune it, so introduction of kinetic parameters into dynamic models must be carefully considered. It is wise to restrict the addition of kinetic parameters to enzyme systems that have been systematically studied such that the kinetic scheme is biologically relevant and the kinetic parameters are known with some level of confidence. This ensures that there is additional data available for the tuning process, and the parameters are physiologically relevant.With this approach it is possible to maintain the structural identifiability of the model while adding more parameters. If many parameter sets can fit the available data, biological insight is severely limited if not impossible, so it is wise to always check the robustness of the solution during parameter optimization. With this in mind, it is not recommended to replace phenomenological MFA with phenomenological kinetic schemes that include more parameters since this only works to reduce the structural identifiability of the model while adding no biological insight.in vivo under a wide range of metabolic conditions. With the availability of additional kinetic insight and data metabolic flux analysis in the heart has progressed along a different path from the microbial and plant systems mentioned above. Predictive kinetic models in the heart are widespread since drug development is only possible with fundamental knowledge of enzyme operation, and this work is best performed in the public domain. With the future shift towards the use of cellulosic biorefineries it is predicted that there will be an increasing economic stimulus to study the fundamentals of exotic metabolisms and thus a resurgence in fundamental kinetic studies in plant and microbial systems.Ultimately, the construction of a predictive kinetic model involves the laborious task of studying each enzyme system et al. [With the complexity of biological systems, predictive models are useful to exclude hypotheses regarding their function. Vendelin et al. quantifiet al. .et al. [Predictive kinetic models are better suited to exclude hypotheses regarding dynamic metabolism than phenomenological MFA. Selivanov et al. and Liebet al. have pub3.1.in vivo is the NMR saturation and inversion transfer technique developed in theory by McConnell [One important tool for probing the mechanisms of complicated kinetic systems cConnell and in pcConnell . Nuclei 31P NMR to study the energy metabolism in hearts is a good example of how compartmentalization and bi-directionality of reaction steps complicates the analysis of a small network of reactions.A number of reviews discuss techniques for using saturation and inversion transfer for studying the kinetics of complex reaction schemes , 35, 36.T1 value [Early studies observed a discrepancy between the measured forward and reverse rate in the creatine kinase reaction when the myocardium was operating at steady state. To resolve this discrepancy it was concluded that analysis of the NMR data should include either compartmentalization of substrates or enzymes, or include an exchange of ATP with other phosphorus species such as inorganic phosphate , 38. In T1 value .et al. [Since the amount of information available from one single magnitization transfer protocol is insufficient to fit all parameters, Joubert et al. used fouet al. , which iet al. .in vivo kinetics was developed to study energy metabolism in skeletal muscle using mass spectrometry to follow the enrichment of oxygen isotopes into energy metabolites. Replacing the external cellular environment with 18O atoms as a function of the enrichment of 18O in the water [18O incorporation into the high-energy phosphoryls one can determine the rate of hydrolysis of the energy metabolites [A complimentary method for exploring he water . The sizabolites .18O transient is induced, followed by freeze clamping in liquid nitrogen and a long preparatory procedure prior to analysis in the mass spectrometer.There are a number of technical difficulties when implementing this approach. The analytical work is very laborious and many animals are required for a statistically significant study. Each dynamic data point requires sacrificing one animal where an 18O in the energy metabolites of toad skeletal muscle, Dawis et al. [18O could be incorporated per molecular turnover. They judiciously discussed the issues bi-directional reaction steps within enzymatic complexes and wrote that “In practice, it will be difficult to verify a multiple-reversal model for the intact cell. Consequently, it will not be easy to choose between a multiple reversal model and a compartmentalization model.” Dawis et al. [The analysis of the data is also tricky since phosphotransfer dynamics contain compartmentalized metabolites and bi-directional reaction steps. To simplify the analysis of their transient experimental data on the uptake of s et al. assumed s et al. also str18O transfer studies is probably not enough to distinguish between possible reaction networks with various combinations of compartmentalization and bi-directional fluxes. Because of these limitations the above assumption of uni-directional fluxes was applied in a series of papers that explored the kinetics and compartmentalization of energy metabolism in rat skeletal muscle [A proper study of the bi-directionality of phosphotransfer networks has yet to be completed, and the amount of data collected in l muscle , 47, 48.31P NMR can be enhanced by the use of either a 17O or 18O induced isotope shift in the 31P NMR spectra. Pucar et al. [18O assisted 31P NMR method to study energetics in mouse heart. The method was employed in a series of papers exploring compartmentalized energetics [18O transfer kinetics, all with the same assumption of uni-directional fluxes. The development of improved methods utilizing NMR saturation and inversion will extend the range of applicability of this powerful technique [Saturation and inversion using r et al. introducergetics , 51, 52 echnique , 55 whil4.The isotopic transient contains information about the underlying behavior of the metabolic system. The task is to build a model of the metabolic system that can best reproduce both the isotopic transient and the steady state isotopomer distribution of all metabolites. This involves finding the sizes of metabolic pools, the bi-directional rates of exchange between compartments in the cell, and the effect of bi-directional enzyme reactions on the isotopomer distribution. Of these, only the sizes of metabolic pools do not affect the steady state labeling state of the metabolites and the biomass created from them.4.1.et al. [To aid in the discussion of extracting information from isotopic transient data, we have composed a simple example of the TCA cycle with carbon enrichment found in et al. . PyruvatAnalogous schemes can be drawn for any biological isotope including oxygen, phosphorus, and nitrogen isotopes, although the atom transitions in these networks are less well defined and functional groups containing these elements tend to be more reactive resulting in a network with a significant number of side reactions and sinks that complicate analysis as in the above phosphotransfer network studies.4.2.13C and end at isotopic equilibrium at an enriched 13C state with steady isotopomer population distribution. Thus, the steady state isotopomer distribution for each metabolite is found from the last points of the simulation when the system has reached isotopic steady state.Isotopomer balance equations can be generated from the metabolic network, and using these, an isotopic transient can be simulated. The transient is induced by a step change in any or all members of the isotopomer population distribution of all metabolites that act as inputs or outputs to the system. For isotopomers that act as outputs to the system, the bi-directionality of the exit reaction step will induce isotope labeling in reverse direction to the net flux. The isotopomer distributions of all metabolites in the system begin at the natural labeling state of 1.1% We used the most direct approach to solve for the isotopic transient by numerically solving the full set of isotopomer balances. Various strategies have been devised to transform this system into an equivalent system that is computationally more efficient to solve, including the bondomer approach , decompo12C and 1’s representing 13C.To illustrate the information one can obtain from the isotopic transient, we present two sets of simulations. Our nomenclature for isotopomers in the figures and discussion below can be summarized as follows: The carbons are numbered according to chemical nomenclature and start at the right with 0’s representing The first set was obtained by continuously feeding pyruvate and acetate while performing a step change in the acetate isotopomer population from natural enrichment to 100% fully labeled 13C1,2 acetate. Two simulations were made with two different sets of metabolic pool sizes (A and B). The pool sizes of all metabolites in both sets were selected at random over three orders of magnitude. All net flux and exchange flux parameters were the same in both simulations. Since only metabolic pool sizes were changed between simulations, the steady state isotopomer distribution are identical for both simulations, as expected. The isotopic transients of the most highly enriched isotopomers of mitochondrial citrate from both simulations are given in 13C when acetate is used as the tracer illustrating the usefulness of this inexpensive tracer for studying the TCA cycle.The second set of simulations was obtained by continuously feeding pyruvate and acetate. The three simulations were made by performing (1) a step change to fully labeled acetate as above, (2) a step change from natural enrichment to 100% fully labeled 13C1,2,3 pyruvate, and (3) a step change in both fully labeled acetate and fully labeled pyruvate together. All other parameters, including metabolic pool sizes, net fluxes, and exchange fluxes were the same in all three simulations. The citrate isotopomers from these three simulations are given in Different isotopomers from each of the three simulations display similar dynamics as the metabolic system is operating in the exact same way. Comparing the dynamics of the citrate isotopomers between the acetate and pyruvate switch, three pairs of isotopomers reach the same proportion of the steady state isotopomer population: (1) the unlabeled citrate isotopomers, (2) the 000011 and 111100 complimentary pair, and (3) the 100011 and 011100 complimentary pair. Different isotopic tracers reveal the same underlying metabolic behavior at steady state for the TCA cycle intermediates, with the dynamics revealing complimentary information.When fully labeled acetate is fed to the metabolic system, the 000011 citrate isotopomer reveals similar dynamics as the same isotopomer when both acetate and pyruvate are fed to the metabolic system. When fully labeled pyruvate is fed to the metabolic system, the 011100 citrate isotopomer reveals similar dynamics as the 011111 citrate isotopomer when both acetate and pyruvate are fed to the system.When both labeled acetate and labeled pyruvate enter the metabolic system, we see both types of isotopomer dynamics appear, however in this case when the isotopomer populations of pyruvate and acetate consist of 100% fully labeled compounds all information about the steady state is lost as the system becomes fully labeled. Thus the use of multiple labeling experiments on the same metabolic system under the same growth conditions is useful to study the dynamic behavior of the metabolic system, and is thus useful to gain insight into the metabolic pool sizes, compartmentalization, and the bi-directionality of metabolic fluxes.To make these two example simulations quantitative one must find the appropriate metabolite pool sizes, net fluxes, and exchange fluxes that adequately reproduce a sufficient amount of transient isotopomeric data, possibly supplemented with additional steady state isotopomeric data, measurements of metabolic pool sizes, substrate utilization rates, and biomass production rates.5.Any difference between measured data and model predictions can be used in an optimization routine to find sets of net fluxes, exchange fluxes, and pool sizes that can reproduce the measured data within experimental errors. If the optimization routine cannot obtain a realistic fit with a sufficient amount of data, the metabolic scheme must be adjusted, possibly with the inclusion of compartmentalization and the process repeated. After finding a set of model parameters that can sufficiently reproduce measured data, one can gain insight into the operation of the metabolic network.13C enrichment probability.All types of isotopomeric measurement can be compared with the output from the dynamic solver, including data collected at isotopic steady state: Mass isotopomers from mass spectrometers, NMR positional enrichments, double enrichments, triple enrichments, and beyond all contain information about the operation of the metabolic scheme. Each measurement type requires one to sum up the appropriate pool of simulated isotopomers that correspond to the measured It should be noted that the process of optimization is not restricted to experiments performed with one enriched substrate. Data from multiple experiments at the same metabolic state using different labeled substrates can be combined to optimize one set of parameters. In this case the optimizer must simulate the isotopomer balance equations once for every experiment with a different step change in labeled substrate using the same set of parameters, and comparing each with their respective set of experimental data. The three simulations in 5.1.Since it is difficult to accurately measure many metabolic pools, making the transient simulation quantitative typically requires additional transient isotopic data. Using an optimization routine it is possible to find a realistic set of metabolic pool sizes that best match isotopic transient data and pool size measurements. To accomplish this, the optimizer would be allowed to manipulate all metabolic pool sizes, thus changing the isotopic transient, while attempting to minimize the difference between measured isotopomeric data and measured pool sizes. In practice one would not usually optimize only the metabolic pool sizes as one usually needs to optimize the net flux and exchange flux parameters at the same time.13C1,2 isotopomer of citrate. With this in mind, transient data that is able to capture the shape and timing of major transient curves like this one are useful for constraining not only the net fluxes and bi-directionality of the metabolic network, but also metabolic pool sizes. If the pool size found by optimization does not match that measured during the experiment, it could be a clue that this metabolic pool is compartmentalized. Other clues in the shape of these transients also aid in identifying compartmentalization.5.2.Information about the bi-directionality of fluxes and the compartmentalization of metabolic pools is contained in the isotopic dynamics. Compartmentalization is revealed in a number of ways. Consider a linear pathway:If the labeling in C becomes enriched faster than B, B is compartmentalized. This means that one should optimize the flux parameters for at least two separate pools of B:i with Bj and their pool sizes. ATP exhibits compartmentalization in cardiomyocytes and astrocytes, as evidenced by a 31P NMR saturation and inversion analysis of the creatine kinase reaction[The shape of the isotopic transient depends on the exchange of B reaction:(3)PCr2The kinetic data suggest that ATP exchanges with inorganic phosphorus and participates in other reactions via separate compartments:et al. [et al. [Fitting the data to this kinetic scheme suggests the need to consider both the function of the bound enzymes and restrictions of diffusion in the system, which both may lead to localized compartmentalization. Evidence for diffusional restrictions and compartmentalization of ATP was explored by Sonnewald et al. who obse [et al. performeet al. [Localized compartmentalization of energy metabolites in cells with high energy requirements is well known , 64. Kaaet al. studied et al. , 67.et al. [Vendelin and Birkedal found diet al. developeet al. .Compartmentalized metabolic pools may play a role in controlling shifts in metabolism. Separate cytosolic pools of pyruvate in astrocytes have been observed to switch between acting as the precursor for energy production depending on the substrate being consumed . In gene5.3.Saccharomyces uvarum. This example introduces the basic process of extracting information from isotopomeric data and does not include many details in the modeling process such as sensitivity analysis and a through discussion of the flux parameters found. Judicious analysis of this system will require a separate publication.To illustrate the process of extracting information from isotopomeric data using isotopic simulation coupled with optimization, we have included a simple example of the TCA cycle in et al. [et al. [13C NMR absolute and conditional enrichments from the carbon skeleton of proteinogenic amino acids harvested and hydrolyzed at isotopic steady state. This excludes the optimization of pool sizes so they have all been set to be equal to simplify simulation, and all comparisons to measured data were made at the last time point simulated after all isotopic dynamics reached steady state.The metabolic system is given in et al. . We opti [et al. measuredWe have included measurements of the rate of biomass production from all TCA metabolites in The optimization was carried out with the following reactions set to be bi-directional: malate dehydrogenase (EC 1.1.1.37), fumerase (EC 4.2.1.2), citrate synthase (EC 2.3.3.1), and the three transport reactions for oxaloacetate, pyruvate, and acetyl-coenzyme A. All reactions involving carbon dioxide, except for the bi-directional production of bicarbonate via carbonic anhydrase (EC 4.2.1.1), were set to be uni-directional.By starting at a large number of plausible starting points selected at random over the range of the free flux parameters, the optimizer always settled on one single optimal solution and occasionally stopped at a few other local optima that did not reproduce the data very well. Changing the weighting of measured data points within the optimizer and excluding one or two at random did not significantly change the optimal solution found as this solution matched all available data quite well. The optimal fit to the isotopomeric data is given in With respect to bi-directional reactions, malate dehydrogenase was found to be very bi-directional with The pyruvate fit was the least perfect and the fit required the pyruvate transporter (R200) to be bidirectional. This may be telling us that the assumption that mitochondrial pyruvate is the sole precursor for Ala production is not entirely true, although at least some production of Ala from mitochondrial pyruvate is required to fit the data. Ala is produced from cytosolic pyruvate during fermentative growth so it is possible that both mitochondrial and cytosolic pyruvate act as precursors for Ala production, but this must be confirmed with additional data and future simulations possibly with the inclusion of an additional compartmentalized pool.Pyruvate is a metabolite that participates in a large number of intersecting central metabolic pathways, typically has a low intra-cellular concentration, and has been observed to exhibit multiple cytoplasmic compartments along with mitochondrial compartmentalization , 74. Thiet al. [The steady state isotopomer profiles of the cytosolic and mitochondrial pools of oxaloacetate are given in et al. . These set al. .To make the transient of this optimization quantitative we would have to include slow bi-directional exchange with storage compounds, since this has been found to dramatically influence the time scale of isotopic dynamics. The isotopic dynamics of TCA cycle metabolites such as 2-oxoglutarate, succinate, fumerate, glutamate, and aspartate, are all influenced by reversible aminotransferase reactions that transfer amino groups from α-amino acids to α-keto acids . This ma6.We have shown that dynamic isotopic transients reveal important insights into the operation of metabolic networks, including the bi-directionality of enzyme and transport reactions, and the compartmentalization of metabolites, including localized compartmentalization not separated by a membrane barrier and that caused by diffusional restrictions. Our optimization of the TCA cycle illustrates that using dynamic isotopic models does not complicate the analysis of steady state isotopomeric data if the transient part of the simulation is excluded, and the possibility for additional insight with the inclusion of only a small amount of transient data should not be overlooked. Models that make use of isotopic transient data are expected to become increasingly important as steady state isotopomeric models currently struggle with the realities of compartmentalization.in vivo. Numerical tools are also developing rapidly, however the current state of dynamic modeling continues to grapple with the difficulties of compartmentalization. Teasing out the details of compartmentalization using dynamic models involves the addition of more parameters. When introducing such parameters, the structural identifiability of the model must be preserved so that biological insight can be extracted from the measured data. This is a challenge for large metabolic systems and can only be accomplished by including as much information as possible to constrain the trajectories of the model solution. Examples include thermodynamic constraints, constraints on the pool sizes, integration of known kinetic information, and the fitting of isotopomeric data from as many experiments as possible.The predicted rise in the use of dynamic models is supported by the rapid development of analytical techniques to measure both isotopomeric transients and the kinetics of individual reactions Although a vast amount of kinetic detail is required to build predictive kinetic models, their use within isotopic transient models is expected to improve and expand phenomenological MFA. It is hoped that fundamental kinetic studies will once again become a funding priority and through their continuation support the use of kinetic schemes within realistically sized metabolic models, since the marriage of kinetics and MFA is predicted to become an ever increasingly important tool in systems biology. |
N-glycolylneuraminic acid (Neu5Gc), but can metabolically incorporate it from dietary sources (particularly red meat and milk) into glycoproteins and glycolipids of human tumors, fetuses and some normal tissues. Metabolic incorporation of Neu5Gc from animal-derived cells and medium components also results in variable contamination of molecules and cells intended for human therapies. These Neu5Gc-incorporation phenomena are practically significant, because normal humans can have high levels of circulating anti-Neu5Gc antibodies. Thus, there is need for the sensitive and specific detection of Neu5Gc in human tissues and biotherapeutic products. Unlike monoclonal antibodies that recognize Neu5Gc only in the context of underlying structures, chicken immunoglobulin Y (IgY) polyclonal antibodies can recognize Neu5Gc in broader contexts. However, prior preparations of such antibodies (including our own) suffered from some non-specificity, as well as some cross-reactivity with the human sialic acid N-acetylneuraminic acid (Neu5Ac).Humans are genetically defective in synthesizing the common mammalian sialic acid We have developed a novel affinity method utilizing sequential columns of immobilized human and chimpanzee serum sialoglycoproteins, followed by specific elution from the latter column by free Neu5Gc. The resulting mono-specific antibody shows no staining in tissues or cells from mice with a human-like defect in Neu5Gc production. It allows sensitive and specific detection of Neu5Gc in all underlying glycan structural contexts studied, and is applicable to immunohistochemical, enzyme-linked immunosorbent assay (ELISA), Western blot and flow cytometry analyses. Non-immune chicken IgY is used as a reliable negative control. We show that these approaches allow sensitive detection of Neu5Gc in human tissue samples and in some biotherapeutic products, and finally show an example of how Neu5Gc might be eliminated from such products, by using a human cell line grown under defined conditions.We report a reliable antibody-based method for highly sensitive and specific detection of the non-human sialic acid Neu5Gc in human tissues and biotherapeutic products that has not been previously described. N-glycolylneuraminic acid (Neu5Gc), due to an irreversible mutation in the gene encoding Cytidine monophosphate (CMP)-N-acetylneuraminic acid (Neu5Ac) Hydroxylase (CMAH) - the enzyme responsible for conversion of CMP-Neu5Gc from CMP-Neu5Ac. Thus, in comparison to our closest evolutionary relatives such as chimpanzees and gorillas, human blood cells and serum proteins lack Neu5Gc and accumulate an excess of the precursor sialic acid Neu5Ac Humans cannot synthesize the common mammalian sialic acid N-acetylneuraminic acid (Neu5Ac). Thus, there remains a need for a highly sensitive and specific method to routinely detect Neu5Gc in all its presentation forms, in human tissues and cells, as well as in biotherapeutic products intended for human use. Here we remedy this deficiency using a new approach that allows highly sensitive and specific detection of Neu5Gc with applications in a variety of methodologies.On the other hand, the anti-Neu5Gc antibodies used to date also have limitations. Monoclonal antibodies can be highly specific for certain Neu5Gc containing glycans, but do not have the ability to detect Neu5Gc on other structurally-related or unrelated glycans N-glycolylneuraminic acid (Neu5Gc) Inalco Pharmaceuticals, San Luis Obispo, CA; ExCell™ VPRO medium, JRH biosciences; Isogel agarose isoelectric focusing (IEF) plates, pH 3–10, Cambrex; Isoelectric Focusing Marker, Sigma; Ureum, USB; Servalyt 3–7 ampholytes, Serva; 1,2-Diamino-4,5-methylene-dioxybenzene (DMB), Cold Water Fish Skin Gelatin, Tween-20, Sigma Chemical Co., St. Louis, MO, Sigma-Aldrich; GlykoSep R high performance liquid chromatography (HPLC) column, Glyko; Sialic Acid Reference panel, Glyko; Quantikine®IVD® Erythropoietin ELISA from R&D Systems Inc. Buffers used were: Tris Buffered Saline (TBS) was prepared with 50 mM Tris HCl, 150 mM NaCl, pH 8; TBST, TBS containing 0.1% Tween-20; Phosphate buffered saline (PBS). Pairs of defined glycan structures containing Neu5Ac or Neu5Gc attached to polyacrylamide (PAA) were from Glycotech, and those attached to human serum albumin (HSA) were prepared as previously described The sources of some reagents are listed within the method descriptions below. The following materials were from the sources indicated: Affi-Gel 15, Dowex AG50WX-2 and Dowex AG1X8, Bio-Rad, Richmond, CA; 3(Neu5Gc)) was prepared from horse erythrocytes Ganglioside Neu5Gcα2-3Galβ1-4G1cβ1-1'Ceramide (GMN-morpholino)propanesulfonic acid (MOPS) pH 7.5, and gently agitated overnight on an end-over-end mixer at 4°C. Any remaining active esters were blocked by the addition of 1 ml of 1 M Ethanolamine and continued mixing for one hour. The resin was poured into a glass column and washed with 3 column volumes of 50 mM Sodium acetate pH 5.5. The sialic acid content of bound glycoproteins was determined by performing mild acid hydrolysis on an aliquot of each resin, and by performing the thiobarbituric acid (TBA) assay on the supernatants containing the released sialic acids.The pre-clearing column was prepared by coupling pooled human type AB serum sialoglycoproteins to Affigel-15 activated immunoaffinity support according to the manufacturer's instructions. The affinity column was prepared by similarly coupling chimpanzee serum to Affi-Gel 15. For each column, 10 ml of resin was washed with 30 ml of 50 mM Sodium acetate pH 5.5, mixed with one ml of serum diluted to 14 ml of 100 mM 3-(O-phenylenediamine (OPD), 50 µl of 30% hydrogen peroxide). Once adequate color had developed, the reaction was quenched with 40 µl of 4 M Sulfuric acid, and the absorbance was read at 490 nm.The crude immune IgY preparation was applied to the human serum Affi-Gel 15 pre-clearing column and allowed to run through. The effluent was collected and reapplied to the same column to allow for maximum binding of any non-specific or Neu5Ac-recognizing IgY antibodies to the Neu5Ac-containing human serum glycoproteins. The column was then washed with 10 ml of PBS, pH 7.4 and the washes combined with the column effluent. The pooled washes were applied onto the chimpanzee serum affinity column, the effluent collected and reapplied to the same column to allow for maximum binding of anti-Neu5Gc antibodies. The column was washed with 50 ml of PBS, pH 7.4, and the specific antibody then eluted from the resin using 5 mM Neu5Gc in PBS, pH 7.4. The first 5 ml of the eluting buffer was added to the column and allowed to run through. The column was then closed off, a second 5 ml of the eluant added (to prevent the column from drying out) and allowed to stand overnight, for a more complete elution of the antibody from the column. The following day, 11 additional 5 ml fractions were collected, by washing with the same eluant. The Neu5Gc-reactive fractions were detected by ELISA, using Costar high-binding plates coated in alternating rows with either 2.5 µg per ml of Neu5Gc or Neu5Acα-PAA-Biotin (Glycotech) or with 1 µl of Bovine or Human serum in 100 µl of 50 mM sodium carbonate-bicarbonate buffer, pH 9.5 at 4°C overnight. The wells were washed with TBS pH 7.5 followed by blocking with 200 µl of TBST at room temperature for 1 hr. For the identification of anti-Neu5Gc positive fractions, 100 µl aliquots of dilutions of the eluted affinity column fractions were added to each well and incubated at room temp for 2 hr. The wells were washed with TBS pH 7.5 followed by the addition of 100 µl of a 1∶10,000 dilution of Donkey anti-chicken IgY-horseradish peroxidase (HRP) (Jackson ImmunoResearch) in TBST and incubated at room temp for 1 hr. The wells were washed and developed using 140 µl of a developing solution . In addition, we coated wells with Human or Bovine Fibrinogen (0.5 µg/well), serum from C57BL/6 wild-type or Cmah−/− mice, human or chimpanzee serum . Methanol was allowed to evaporate completely for 4 hours at room temperature (RT) and plates were incubated overnight at 4°C. Wells were blocked for 1 hours at RT with 1% ovalbumin in PBS, followed by incubation with affinity purified chicken anti-Neu5Gc diluted 1∶10,000 in the same blocking solution for 2 hours at RT. The plates were washed three times with PBS containing 0.1% Tween (PBST) and subsequently incubated for 1 hour at RT with HRP-conjugated donkey-anti-chicken IgY diluted in PBS . After washing three times with PBST, wells were developed with O-phenylenediamine in citrate-PO4 buffer, pH 5.5, and absorbance was measured at a 490 nm wavelength on a SpectraMax 250 (Molecular Devices). Neu5Gc-specific antibody levels were defined by subtracting the readings obtained with the Neu5Ac-glycoconjugates from the readings obtained using the respective Neu5Gc-glycoconjugates .Anti-Neu5Gc antibody reactivity was detected by ELISA as previously described Sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) separated proteins were transferred to nitrocellulose membranes following standard procedures. Membranes were blocked overnight at 4°C with 0.5% gelatin from cold water fish skin (Sigma) in TBST, and then incubated at room temperature for 2 hr with affinity purified chicken anti-Neu5Gc diluted 1∶100,000 with TBST or with a control non-specific Chicken IgY antibody pool (Jackson ImmunoResearch) at the same protein concentration. The membranes were washed again with TBST and then incubated with Donkey anti-chicken HRP (Jackson ImmunoResearch) 1∶50,000 in TBST at room temperature for 1 hr. The membranes were washed and incubated with Pierce SuperSignal West Pico Substrate (Pierce) as per manufacturer's recommendation, exposed to X-ray film and the film developed.6 cells were used for each staining. All staining reactions were performed at 4°C. The cell pellet was gently resuspended in 100 µl of either affinity purified chicken anti-Neu5Gc antibody or control pre-immune IgY diluted 1∶4000 in blocking solution and incubated on ice for 1 hr. The cells were washed with 1 ml of blocking buffer, mixed gently, and pelleted at 500×g for 5 min. The cells were suspended in 100 µl Cy5-conjugated Donkey-anti-chicken IgY antibody, diluted 1∶4000 in blocking buffer, incubated on ice for 1 hr, and washed as above. Stained cells were suspended in 400 µl PBS, the data collected on a FACSCalibur and analyzed with Flowjo software .The blocking solution used for all the analysis, manipulations and dilutions was 0.5% cold water fish skin gelatin in PBS, pH 7.3 containing 1 mM ethylenediaminetetraacetic acid (EDTA). Chinese hamster ovary-K1 (CHO-K1) cells were detached from the tissue culture dish using 10 mM EDTA in PBS, pH 7.3 for 5 to 10 min. The cells were immediately washed in blocking buffer containing 5 mM EDTA and counted. Peripheral blood mononuclear cells (PBMCs) were prepared by standard Ficoll-Paque Plus protocol, and washed in blocking buffer. Once prepared, 1×10Frozen sections or paraffin sections of wild type mouse embryos, or wild type adult mouse organs, along with similar sections from CMAH null tissues, were used initially to confirm specificity of antibody binding to Neu5Gc containing tissues, with no binding seen to the CMAH null tissues . When studying human tissues, frozen sections or paraffin sections of human placenta were always used as positive controls, because staining of endothelial cells lining blood vessels was the control necessary for interpretation of staining on other tissues. The anti-Neu5Gc antibody or Chicken IgY concentrations used on human sections were each at ∼5 micrograms per ml on frozen or on paraffin sections . The frozen sections were air-dried, and washed in phosphate buffered saline with 0.1% Tween (PBST) and overlaid with blocking buffer (0.1% fish gelatin in PBST). The washes were performed between each step and the blocking buffer was used for dilution of each of the reagents that were overlaid onto the tissue sections. The slides were incubated in a humid chamber with parafilm on them, to prevent drying during the incubation steps. The sections were blocked for endogenous biotin, overlaid with primary reagents, the binding of which was detected using a secondary biotinylated secondary, and a labeled streptavidin.If paraffin sections were used in an immunohistochemistry assay, the slides were de-paraffinized before proceeding with the steps outlined above. Slides were immersed in 3 changes of xylene for 10 minutes each to remove the wax, followed by rehydration in decreasing concentrations of alcohol, before submersion in buffer. Following the biotinylated secondary antibody enhancement steps using the DAKO CSA kit (which uses the biotinyl tyramide amplification method) was used. We also found that following incubation with the primary reagents, specific binding could be detected using a secondary rabbit anti-chicken antibody (Jackson ImmunoResearch), followed by a fluorescently or enzyme labeled tertiary anti-rabbit antibody (Jackson ImmunoResearch). When Horse Radish Peroxidase (HRP) was the label, endogenous peroxidases were blocked before proceeding with the other steps and color was developed using peroxidase substrates (Vector labs) following manufacturer's recommendations, and nuclei were counterstained using Mayer's hematoxylin before coverslipping using aqueous mounting media. If fluorescent labels were used, the slides were mounted in aqueous mounting media and viewed using epifluorescence with a Zeiss Axiophot microscope, digital images were captured using the Scion NIH image program and analyzed using Adobe Photoshop. With the color read-out, digital images were captured on an Olympus BH2 microscope, using the Magnafire digital photocapture program.A polyclonal monospecific chicken anti-Neu5Gc antibody was prepared as described in “O-acetylation of the glycerol-like side chain of sialic acid, such as that found in Bovine submaxillary mucin (BSM) did not block recognition, as reactivity was not altered by prior de-O-acetylation of BSM by base treatment , confirming the extreme specificity of the antibody for the single oxygen atom that differs between Neu5Gc and Neu5Ac. This contrasts with prior methods of preparing chicken polyclonal anti-neu5Gc antibodies (including ours), which showed varying degrees of cross-reactivity with Neu5Ac-containing epitopes, as well as other non-specific reactivity. This improvement likely resulted from both the pre-clearing step using immobilized human serum sialoglycoproteins (containing only Neu5Ac), and from the specific elution by Neu5Gc from the Neu5Gc-containing immobilized chimpanzee serum sialoglycoproteins. The pre-clearing using human proteins also helped to eliminate other non-specific cross-reactivities when studying human tissue samples. To further ensure specificity, all subsequent studies used a commercial pooled batch of IgY as a control, which showed no anti-Neu5Gc reactivity.Human serum and bovine serum proteins were electrophoresed on 10% SDS-PAGE gels and transferred onto nitrocellulose membranes as described in the Flow cytometry of various cell types was carried out as described in Cmah-null mice showed no staining and the presence of this epitope on biotherapeutics can cause adverse events |
Strengthening Cardiac Rehabilitation and Secondary Prevention for Aboriginal and Torres Strait Islander peoples, published in 2005, provide checklists for services to assist them to reduce the service gap for Indigenous people. This study describes health professionals' awareness, implementation, and perspectives of barriers to implementation of these guidelines based on semi-structured interviews conducted between November 2007 and June 2008 with health professionals involved in CR within mainstream health services in Western Australia (WA). Twenty-four health professionals from 17 services listed in the WA Directory of CR services were interviewed.Cardiovascular disease is the major cause of premature death of Indigenous Australians, and despite evidence that cardiac rehabilitation (CR) and secondary prevention can reduce recurrent disease and deaths, CR uptake is suboptimal. The National Health and Medical Research Council (NHMRC) guidelines The majority of respondents reported that they were unfamiliar with the NHMRC guidelines and as a consequence implementation of the recommendations was minimal and inconsistently applied. Respondents reported that they provided few in-patient CR-related services to Indigenous patients, services upon discharge were erratic, and they had few Indigenous-specific resources for patients. Issues relating to workforce, cultural competence, and service linkages emerged as having most impact on design and delivery of CR services for Indigenous people in WA.Strengthening Cardiac Rehabilitation and Secondary Prevention for Aboriginal and Torres Strait Islander Peoples: A Guide for Health Professionals. The disproportionate burden of CVD morbidity and mortality among Indigenous Australians mandates urgent attention to this problem and alternative approaches to CR delivery. Dedicated resources and alternative approaches to CR delivery for Indigenous Australians are needed.This study has demonstrated limited awareness and poor implementation in WA of the recommendations of the NHMRC Cardiac rehabilitation (CR) programs are widely recommended for individuals with coronary heart disease (CHD) and widely endorsed in public health policy ,2. DespiWhile the incidence of coronary heart disease (CHD) has been declining over the last three decades in the general population, this trend has not occurred in Indigenous Australians, in spite of an enabling policy context. Cardiovascular disease (CVD) also occurs at a younger age, with rates in the 35-54 year age group four times that in Indigenous compared to non-Indigenous populations . A previStrengthening Cardiac Rehabilitation and Secondary Prevention for Aboriginal and Torres Strait Islander Peoples: A Guide for Health Professionals [Guideline development is an important step in driving practice change and promoting cultural awareness. Yet it is well-recognised that guidelines alone do not result in either practice or workplace culture and values changes. This study investigated practitioners' awareness and implementation of ssionals in CR seKey to increasing participation of Indigenous people in these programs is the understanding of barriers and facilitators from their perspectives.Guidelines (Appendix 2), but also allowed for more in-depth discussions not fully captured in the question list regarding the experiences and perceptions of CR services for Indigenous people. All but three interviews were audio-recorded with permission of participants. Written notes were taken for those who declined recording. Transcripts and notes were analysed using thematic content analysis [The sampling frame for this study included public hospitals and community-based public CR services listed in the Directory of Western Australian Secondary Prevention Services . Health analysis . Frequenanalysis . Relatedanalysis . Ethicaln = 4), serviced negligible numbers of Indigenous clients , or where staff were unavailable during data collection or failed to respond to invitations to participate (n = 3). Participating programs were in rural settings and the metropolitan area . Twenty-four interviews were conducted with participants from 17 tertiary hospitals and community-based public CR services. Of the respondents who reported having received the Guidelines , few could recall any specific elements or recommendations, nor did they report attempting to implement the approaches recommended in the resource. Findings related to Indigenous inpatients and outpatients are summarised below. The denominator for data reported below relates to participants in interviews (n = 24).Several services listed in the Directory of WA Secondary Prevention Services were not interviewed, including those who had few or no CR patients/referrals . A minority reported having Indigenous community input into CR design and delivery.A quarter of respondents reported having joint initiatives with an Aboriginal Medical Service (AMS), while nearly one-third reported faxed or telephoned patient referrals to/from an AMS. Fewer than half of respondents reported that their service has a system in place for identifying Indigenous status (n = 7) reported discussing with them the importance of CR. The majority of respondents did not have access to Indigenous-specific education resources on common CVD conditions, tests, interventions, and medications for patients during their hospital stay. However, a minority of programs reported providing culturally appropriate resources and had a buddy/mentoring scheme in place for Indigenous people hospitalised for a heart condition .Respondents explained that during a hospital stay, they usually did not visit Indigenous patients. Of those who do see Indigenous in-patients, 29% (n = 2) of services reported being notified by tertiary hospitals when local Indigenous patients were discharged back to their area following a cardiac event, while a further 46% (n = 11) reported inconsistent notification. When referrals were obtained, 58% (n = 14) reported seeing Indigenous patients following discharge and of these, 62.5% (n = 15) reported talking about the importance of CR during this time and 37% (n = 9) had Indigenous-specific education materials. Only one post-discharge mentoring system was reported.Only 8% ; lack of awareness of available services ; lack of transport ; other health issues ; and financial constraints . Many of the services offered CR only within very limited hours, compounding geographical barriers to access. Issues relating to workforce, cultural competence, and service linkages emerged as having most impact on design and delivery of CR services to Indigenous people in WA (Table Respondents identified the following barriers they were aware of that could prevent Indigenous people's access to services: family commitments and restrictions n = 5, 62.5%;Despite the ready availability of NHMRC guidelines to all CR services in WA, the majority of respondents reported that they were unfamiliar with this document and as a consequence had not attempted to implement its recommendations. Although there were examples of good practice, we were unable to identify evidence of a systematic implementation strategy or outcome assessment strategy across WA. It is well-documented that guideline implementation is a complex and multifaceted process that needs to consider systems, patient and provider issues . To effeAnother important consideration in of the delivery of CR services is the interface between state and federal government initiatives . CommonlWhen interpreting these study findings, consideration should be given to the method of sampling which may have reflected the view of health professionals who had not necessarily been working in that service over a long period. Further, although our informants were those most likely to know the situation within the CR service and at the patient-CR provider interface, there was no source data verification from health service management regarding the opinions expressed. In spite of these limitations, this study elucidated barriers and facilitators to guideline implementation and strategies to improve Indigenous Health in WA. In addition, it underscores the importance of following up guideline release with targeted implementation and evaluation strategies. Further, it emphasises the importance of policy diffusion from a state and federal level to a local service delivery context. Importantly, the views reported are the views of clinicians responsible for CR service implementation and guideline adherence in the real world. It is important to understand these views in improving services. This information provides a way forward for service planning and underscores an urgent need to invest in enabling health providers to provide culturally appropriate service models.Strengthening Cardiac Rehabilitation and Secondary Prevention for Aboriginal and Torres Strait Islander Peoples: A Guide for Health Professionals among the professionals at whom they were targeted. Potentially limited endorsement and recognition at a local policy level have influenced this. Unsurprisingly, limited uptake of the recommendations was also identified. The disproportionate burden of CVD morbidity and mortality among Indigenous Australians, particularly following an acute cardiac event, requires urgent attention to ensure culturally appropriate and competent secondary prevention services. Alternative approaches to how CR services could be delivered are needed.Although evidence-based guidelines are integral for clinicians and supporting service reform, this study demonstrated sub-optimal awareness in WA of The authors declare that they have no competing interests.SCT contributed to study design, securing funding, ethics approval, interpretation and writing, MLD assisted with analysis, interpretation and writing; JSS assisted with study design, data collection, stakeholder engagement and interpretation, KPT assisted with data collection and interpretation, LD assisted with conception, funding and stakeholder engagement, MA assisted with study conception and analysis, MMW assisted with stakeholder engagement, TGL assisted with study development and stakeholder engagement, PMD assisted with analysis, interpretation and writing. All authors approved the final manuscript.• Ensure cultural competency is integral to the core business of an organization and supported at all levels within the organization.• Involve Aboriginal Health Workers and family members in the care of Indigenous Australians and develop flexible approaches to highlighting the merit of CR.• Draw on existing CR and secondary prevention services as appropriate and engage with local community networks.• Ensure community involvement at every level in planning and implementing CR, including the development of culturally appropriate resources.• Develop and sustain partnerships between stakeholder agencies.• Tailor CR approach according to the specific needs of Indigenous Australians and develop supportive policies and procedures.• Develop specialist education resources for continuing professional development and support of all health professionals working in heart care, including Aboriginal Health Workers.• Awareness of NHMRC guidelines • Degree of incorporation of recommendations into routine practice• Barriers to implementation• Aboriginal Health Worker involvement in care of Indigenous patients• Collaboration and integration with existing service providers• Cultural competency training• Opportunities for continuing professional development• Type, structure, content, organisation, coordination, staffing and funding of the service with specific relevance to Indigenous people |
Stringently controlled conditional expressing systems are crucial for the functional characterization of genes. Currently, screening of multiple clones to identify the tightly controlled ones is necessary but time-consuming. Here, we describe a system fusing Tet (tetracycline)-inducible elements, BAC and Gateway technology together to allow tight control of gene expression in BAC-transfected eukaryotic bulk cell cultures. Recombinase cloning into the shuttle vector and the BAC facilitates vector construction. An EGFP (enhanced green fluorescent protein) allows FACS (fluorescence activated cell sorting) and the BAC technology ensures tight control of gene expression that is independent of the integrating site. In the current first application, our gene of interest encodes a β-catenin-ERα fusion protein. Tested by luciferase assay and western blotting, in HTB56 lung cancer cells the final BAC E11-IGR-β-catenin-ERα vector demonstrated sensitive inducibility by Tet or Dox (doxycycline) in a dose-dependent manner with low background, and the EGFP was an effective selection marker by FACS in bulk culture HTB56 and myeloblastic 32D cells. This is a highly efficient tool for the rapid generation of stringently controlled Tet-inducible systems in cell lines. The rapid development of genomic functional research requires stringently controlled expression systems. Tet (tetracycline)-regulated expression systems are widely used. Tet-inducible systems are divided into two classes: one is TetOff, which is constitutively active in the absence of Tet or Dox (doxycycline), whereas off in the presence of Tet or Dox So far, several kinds of vectors have been used to construct Tet or Dox-inducible expression systems such as lentiviral attL, attR, attB, and attP) and the LR or BP Clonase enzyme mixtures that mediate the lambda recombination reactions are the foundation of Gateway Technology. In our current study, we cloned a versatile shuttle vector pIGR-RFC. To use this system, the gene of interest is cloned into an entry vector (pENTR), which is then mixed in vitro with pIGR-RFC and the Gateway Clonase enzyme mixtures. Site-specific recombination between the att sites (attR x attL) generates an expression clone and a by-product. Thus, the reading frame C (RFC) in the shuttle vector is replaced by the gene of interest However, it is often cumbersome to clone genes into BAC including two steps: first, clone a gene of interest into an intermediate shuttle vector by traditional restriction digestion and ligation; second, the gene of interest is recombined into BAC from the shuttle vector. In the case of multiple expression and functional analysis, proper restriction sites have to be selected according to the different sequences of genes in above-mentioned step I, and then step II is repeated. It is a time- and money-consuming process. However, this work could be simplified by Gateway Technology using lambda phage-based site-specific recombination instead of restriction endonuclease and ligase to insert a gene of interest into the shuttle vector. The DNA recombination sequences may be used as a selection marker because of its convenience for fluorescence activated cell sorting (FACS). By the means of flow cytometry, positive-transfected cells can be easily purified. Thus, in cellular and animal experiments EGFP could act as a useful visible marker by the fluorescence in positive clones.To the best of our knowledge, our current Tet-controlled expression system is the first combination of Tet-inducible elements, BAC and Gateway technology. It boasts the tight and quantitative expression inducibility by Tet or Dox, the gene cloning convenience by Gateway technology, stable expression in BAC vector and efficient selection for EGFP contributing to a universal technical tool for the analysis of gene expression and its function.RFC , EGFP, IRES and all the elements of Tet-inducible expression system were cloned into pE11.F3.M.F. , and pIGR-RFC was generated. The map of pIGR-RFC is shown in l-glutamine, 100 units/ml penicillin and 100 µg/ml streptomycin at 37°C in 5% CO2. The 32D cells were cultured and maintained as described earlier HTB56 cell line from American Type Culture Collection (ATCC) was cultured in Modified Eagle's medium supplemented with 10% Tet-free fetal calf serum (FCS), 1% non-essential amino acids, 1 mM sodium pyruvate, 2 mM HTB56 cells were seeded 8 hours before transfection into 6-well plates with a density of 300,000 cells per well. Transfection was performed with Lipofectamine transfection reagent by using 1 µg of super-coiled BAC DNA per well. For luciferase assay, 0.1 µg of pRLSV40 encoding renilla luciferase was cotransfected with BAC as internal control to normalize the transfection efficiency. Tet or Dox was added into the culture medium 24 hours after transfection.SceI restriction enzyme . For electroporation, 3×106 32D cells suspended in 300 µl culture medium were transferred into an electrocuvette with a diameter of 4 mm containing 32 µg linearized BAC DNA. The electrical conditions were at 300 V, 6 ms using Pulse Generator EPI 2500 .Before transfection into 32D cells, the supercoiled BAC DNA was linearized by digestion with I-Activities of the firefly luciferase and Renilla luciferase in a single sample were measured sequentially using the Dual-Luciferase Report Assay System . Briefly, after 24 hours of Tet or Dox treatment, cells were rinsed twice with phosphate-buffered saline (PBS) and then lysed in 120 µl of passive lysis buffer at room temperature for 15 min. 10 µl of the cell lysate were quickly mixed with 100 µl of Luciferase assay reagent in a luminometer tube. The light emission for the firefly luciferase was recorded for 10 s after a 5 s premeasurement delay using a TD-20/20 luminometer . Subsequently, 100 µl of Stop&Glo reagent was added to the same tube to inactivate the firefly luciferase while activating the Renilla luciferase. Variation in transfection efficiency was normalized by dividing the value of the firefly luciferase activity with that of the Renilla luciferase activity.g for 10 minutes. After adjustment of protein concentrations, the lysates were boiled in SDS sample loading buffer for 5 minutes and separated by SDS-polyacrylamide gel electrophoresis . Gels were blotted on a polyvinylidene difluoride (PVDF) membrane and stained with the anti-human β-catenin first antibody . Antibody binding was detected with a horseradish peroxidase (HRP)-coupled secondary antibody followed by chemoluminescence detection .For preparation of whole-cell lysates cells were washed with ice-cold PBS and lysed for 30 minutes on ice in RIPA buffer with 150 mM NaCl as described P values of 0.05 or less were considered significant.Quantitative data are presented as means plus standard deviation (SD). Statistical analyses were performed with SPSS, version 10.0 . Statistical significances of overall differences between multiple groups were analyzed by one-way ANOVA analysis. S-M2, an optimized rtTA construct exhibiting significantly increased sensitivity to Dox SM2 and EGFP to allow expression of these two genes driven by a single hCMV promoter. The EGFP acts as a sorting marker by flow cytometry in eukaryotic cells. The Tet-responsive expression cassette contains a bidirectional promoter Ptetbi, driving expression of two genes simultaneously. The firefly luciferase is a surrogate marker for the expression of the gene of interest, which can be conveniently recombined into Gateway RFC from a pENTR vector. In the current study, the gene of interest is the β-catenin-ERα fusion gene . The dose-dependent inducibility indicated that the expression level of the gene of interest can be regulated deliberately by adding different doses of Dox. In this way, the expression of the gene of interest is controlled not only qualitatively but also quantitatively in transiently transfected bulk cultures.Then, tetracycline inducibility of BAC E11-IGR-gene of interest was evaluated. HTEB56 cells transiently transfected by E11-IGR-β-catenin-ERα were exposed to different doses of Tet, Dox or not. We assayed the activity of luciferase, a sensitive surrogate marker reflecting the expression of the gene of interest in the other direction of Pin vitro recombination with Gateway RFC Click here for additional data file. |
To assess the horizontal Lang two-pencil test as a bedside test to detect gross stereopsis.Eighty-four strabismic subjects divided into two groups based on the amount of deviation, and 40 normal subjects were studied. Sensory status examination including binocularity and stereopsis were evaluated with Bagolini, Titmus test and the Netherlands organisation for applied scientific research (TNO), Randot, synoptophore and horizontal Lang two-pencil test.The subjects in the group with smaller deviation showed better performance on all the four stereo tests and over 90% demonstrated presence of fusion. When compared to TNO and Randot for determining presence of stereopsis, the horizontal Lang two-pencil test demonstrated sensitivity of 100% and 83.9%, specificity of 77.8% and 73.7%, and negative predictive value of 100% and 100% respectively. It also showed 100% specificity as a test for binocularity when compared with the Bagolini striated glass test.Horizontal Lang two-pencil test, an easily performed test with a high sensitivity and negative predictive value can be used as a screening test to detect gross stereopsis and binocularity. Stereopsis is defined as the highest level of binocular interaction and requires a good visual acuity in each eye, simultaneous perception, and fusion. When strabismus is acquired later in life, the loss of stereopsis is felt acutely and may present a real handicap. It is uset al.[Amongst the stereo tests,‐11 the LThis was a cross-sectional study evaluating the horizontal Lang two-pencil test in acquired strabismus and normal subjects after approval from the Institutional review board of our Institute. The subjects were enrolled from the squint clinic and outpatient department of our Institute. The inclusion criteria were subjects aged six years and above, with an onset of deviation after the first year of life, best corrected visual acuity (BCVA) of 20/60 or better in each eye at the time of examination, and neurologically and developmentally normal. Any subject with vertical strabismus more than 5 prism diopters (PD), or with intermittent deviation or any heterophoria, or not willing to participate in the evaluation was excluded. Patients with intermittent strabismus were excluded because it is believed that they may have some fusional component. Eighty-four subjects met the inclusion criteria. The subjects were divided into two groups based on the amount of deviation; Group 1 with an angle of deviation less than or equal to 8 PD, and Group 2 with deviation greater than or equal to 10 PD. There were 40 normal subjects. The criteria for normal subjects were a BCVA of 20/20 with no significant anisometropia, and who were orthophoric. Informed consent was obtained from the subjects or parents.A history provided by the parents or guardians detailing the age of the patient, age of onset of deviation, previous therapy including optical, surgical and amblyopia treatment, age at alignment, and whether optically or surgically realigned, was noted. Clinical evaluation included visual acuity testing, refraction, ocular movement assessment, cover test, and prism bar cover test (PBCT) to determine the amount of deviation. Sensory status examination for binocularity and fusion were performed using the Bagolini striated glass test (a routinely used test), the three circles test on TNO and the R and L test in the Randot booklet. Stereopsis was assessed by the synoptophore, horizontal Lang two-pencil test, TNO and Randot test booklets. TNO or Randot are routinely used stereo tests to determine level of stereo-acuity.Visual acuity was assessed using the Snellen's visual acuity chart. Bagolini glass test was used to assess binocularity and fusion consists of lenses with striations which are at right angles to each other. It was performed by keeping a pair of the striated glasses in front of each eye, and the subject was asked to fixate on a punctate light source. The possible responses were a) symmetrical cross response b) asymmetrical cross response c), single line response, and d) cross response with a central gap in one line. Responses 'a' and 'b' indicate binocularity while response 'c' indicates suppression. The central suppression response 'd' indicates either a fixation point scotoma or foveal scotoma . The three circles test on TNO and the R and L test in the Randot booklet was explained together with the respective tests.Gross stereopsis was determined by synoptophore using stereopsis slides, and the horizontal Lang two-pencil test. The synoptophore consists of two cylindrical tubes placed horizontally and contains a +6.0 or a +6.5D lens in each eyepiece which sets the target distance to about 6 meters. Stereopsis was detected as the ability to obtain the impression of depth by the superimposition of two pictures of the same object taken at a slightly different angle. The different stereopsis slides used were that of a bucket; a clown with several objects about him. In the horizontal Lang two-pencil test, an examiner held a pencil horizontally at the eye level in front of the subject in the middle, who, with another pencil was asked to touch the tip of the examiner's pencil with the tip of his/ her pencil . The tesThe level of stereo-acuity was evaluated using TNO and Randot stereo tests, which are based on the Random dot stereograms. They contain no information about the shape or nature of the object hidden in the visual noise of random dots. Only when the images from the right and left eye are combined at the neural level and the object is seen in depth does recognition take place.The TNO stereo test was performed by placing the plates at a test distance of 40 cm squarely in front of the patient, wearing spectacle correction if using one. The test consists of seven plates, the first three of which were used for screening to detect the presence of gross stereopsis. The fourth plate was a suppression test. The last three plates on the other hand were used to quantitatively assess stereo-acuity in the range of 15 to 480 sec of arc. Each plate consisted of four squares, within which was a circle with a 'pie'/ piece missing. The subjects were asked to point to the missing piece. This test required the use of red-green glasses. The normal value for stereo-acuity was considered ≤60 sec of arc.The Randot stereo test was administered by holding the test booklet upright before the subject, about 40 cm away. The test required the use of polarizing glasses to be worn over prescription glasses, if using any. The Randot stereo test consisted of three parts–geometrical shapes, animals, and circles with a disparity range of 500-250, 400-100, and 400-20 sec of arc respectively. The booklet also contained a test for suppression in the form of an R, L and a cross.presence of stereopsis. False positive is defined as the absence of measurable stereo-acuity on the TNO or Randot, but presence of gross stereopsis on the synoptophore or horizontal Lang two-pencil test.Any level of measurable stereo-acuity on the Randot (up to 500 sec of arc) or TNO (up to 480 sec of arc) was considered as P value of < 0.05 was considered as statistically significant.Mean age and gender ratio between the groups was compared using student t-test and chi square test respectively. P=0.3 for both). The type of strabismus and amount of deviation is given in detail in Of the 84 strabismic subjects there were 56 males and 28 females aged between 6 and 19 years with a mean age of 9.13 ± 3.38 years. Of the 40 normal, there were 23 males and 17 females ranging in age from 6 to 17 years with a mean age of 9.7 ± 2.98 years. There was no statistical difference between the strabismic and normal subjects in mean age and gender ratios . The patient was diagnosed to have partially accommodative esotropia, with a deviation of 25 PD prior to surgery. The patient's hyperopic correction was 4.37 diopters spherical equivalent.A subgroup analysis was done for the subjects in Group 1 between those with and without stereopsis. There were 26 subjects with stereopsis (25 had measurable stereo-acuity levels and one had only gross stereopsis) and 18 without stereopsis. Of the 26 with stereopsis, two were missed on the synoptophore. One of these patients had stereo-acuity of 480 arc seconds on the TNO and the other had stereo-acuity of 400 arc seconds on the Randot. However, in those without stereopsis, all but one patient showed absence of stereopsis on the synoptophore. Evaluation using the horizontal Lang two-pencil test showed that all the patients with stereopsis were picked up correctly and there were four false positive results. There were no false negative results. Examination using the Bagolini striated glass test for binocularity showed that all the patients with stereopsis had binocular single vision. However, 14 of the 18 patients with no measurable stereo-acuity also showed presence of binocular single vision (data not shown). The study was to compare any level of measurable stereo-acuity on the two stereo tests, namely TNO and Randot, with the gross stereopsis detected by the horizontal Lang two-pencil test. Therefore, comparison of patients with random dot versus local stereopsis was not performed.In the current study, we describe the horizontal Lang pencil test as a parameter to evaluate gross stereopsis and compare it with the currently and commonly used stereo tests. We found that the easily performed horizontal Lang two-pencil test detected all subjects who had stereopsis. In addition, with no false negative responses and a 100% sensitivity and negative predictive value (NPV), this test may be used as a potential screening test for detecting gross stereopsis.et al.[Stereo-acuity has been measured by various tests and there are conflicting reports on their validity in the evaluation of strabismic and amblyopic patients. We found that the median in the normal subjects was 60 sec of arc on TNO and 40 sec of arc on Randot while in the strabismic subjects, the median was 120 and 70 sec of arc respectively. Similar observations were made by other authors.[7The horizontal Lang two-pencil test, a subjective test which could be easily performed, was able to detect all the patients with stereopsis. It was interesting to note that it also detected stereopsis in four of the 18 patients who otherwise had no measurable stereopsis on TNO and Randot. These four subjects with false positive responses did show binocular single vision on the Bagolini, TNO and Randot, hence they were likely to have had stereopsis of the order of 3000 arc sec detected by the Lang two-pencil test alone.[et al.[The Lang two-pencil test has not been extensively studied as an adjunct to the orthoptic/ ophthalmological evaluation of strabismic patients, or as a screening test for stereopsis. Pugesgaard et al. noted thThere were some limitations to our study. First, we have not attempted to compare the horizontal Lang two-pencil test with the popularly performed vertical test, hence our assumption that the horizontal test contains less monocular cues could not be proven. Second, the pencil test is a qualitative test, it should be used purely for screening especially in situations where quantitative tests like the TNO, Randot and Frisby are not readily available.In conclusion, the horizontal Lang two-pencil test, an easily performed test even in children, with a high sensitivity and negative predictive value can be used as a potential bedside test to detect stereopsis and binocularity. |
In order to determine the significance of local oestrogen biosynthesis within the breast, aromatase activity has been measured in adipose tissue from the breasts of women with either benign (n = 36) or malignant breast disease (n = 51). Particulate fractions from all samples possessed aromatase activity, but levels in adipose tissue adjacent to malignant tumours were significantly higher than those in tissue close to benign breast lesions (P less than 0.0001). Elevated aromatase activity in adipose tissue from breast cancer patients may be of importance in view of the central role played by oestrogen in the natural history of breast cancer. |
The secreted enzyme autotaxin (ATX) stimulates tumor cell migration, tumorigenesis, angiogenesis, and metastasis. ATX hydrolyzes nucleotides, but its hydrolysis of lysophospholipids to produce lysophosphatidic acid (LPA) accounts for its biological activities. ATX has been identified only as a constitutively active enzyme, and regulation of its activity is largely unexplored. In spite of its presence in plasma along with abundant putative substrate LPC, the product LPA is found in plasma at unexpectedly low concentrations. It is plausible that the LPA-producing activity of ATX is regulated by its expression and by access to substrate(s). For this reason studying the interaction of enzyme with substrate is paramount to understanding the regulation of LPA production.In this study we determine ATX hydrolytic activities toward several artificial and natural substrates. Two novel point mutations near the enzyme active site (H226Q and H434Q) confer attenuated activity toward all substrates tested. The Vmax for LPC compounds depends upon chain length and saturation; but this order does not differ among wild type and mutants. However the mutant forms show disproportionately low activity toward two artificial substrates, pNpTMP and FS-3. The mutant forms did not significantly stimulate migration responses at concentrations that produced a maximum response for WT-ATX, but this defect could be rescued by inclusion of exogenous LPC.H226Q-ATX and H434Q-ATX are the first point mutations of ATX/NPP2 demonstrated to differentially impair substrate hydrolysis, with hydrolysis of artificial substrates being disproportionately lower than that of LPC. This implies that H226 and H434 are important for substrate interaction. Assays that rely on hydrolyses of artificial substrates (FS-3 and pNpTMP), or that rely on hydrolysis of cell-derived substrate, might fail to detect certain mutated forms of ATX that are nonetheless capable of producing LPA in the presence of sufficient exogenous substrate. H420Q-ATX could not be differentiated from WT-ATX, indicating that histidine at position 420 is not required for any of the activities of ATX tested in this study. Autotaxin ATX, NPP2), a secreted enzyme originally purified as a tumor cell motility-stimulating factor , enhance, a secreAlthough products of the ATX nucleotide phosphodiesterase activity, such as adenosine nucleotides , have beThe biological activities of ATX are now understood to arise from its lysophospholipase D (LPLD) activity that catThe LPLD, nucleotide PDE, and motility-stimulating activities of ATX all require the presence of threonine at (human sequence) position 210 (T210) as well as three metal-binding histidines . The catWe have identified two novel point mutations in the vicinity of the active site of ATX that disproportionately discriminate against the hydrolysis of two artificial substrates (FS-3 and PpNpTMP), have attenuated activity toward LPC, and are defective in the stimulation of migration. In this manuscript, we define the Km and Vmax of native ATX for its various substrates, and characterize the altered kinetic and biological properties of ATX-H226Q and ATX-H434Q.Nucleotide pyrophosphatase and phosphodiesterases (NPPs) are metallo-enzymes that contain a number of histidine and aspartate residues in the presumed metal-binding site. Several of these residues have been shown to be required for their enzymatic activities ,17,19. WThe enzymatic activities of the wild type vs. mutant forms of ATX were tested for three structurally distinct types of ATX substrates. Fig. To better understand the altered hydrolytic efficiency and substrate selectivity of H226Q-ATX and H434Q-ATX, we determined the effects of substrate concentrations on the reaction rates and calculated the kinetic parameters Km and Vmax for each substrate. Fig. Km and Vmax values from these data, normalized for ATX protein concentration, are included in Table We compared the kinetic parameters of the mutant forms toward LPC 16:0, LPC 18:0, and LPC 18:1; these results are also included in Table ® Red, the fluorescent detector for choline oxidase activity, may be susceptible to direct hydrolysis, which we occasionally observed in partially purified ATX preparations from transfected insect (HiFive) cell conditioned medium (data not shown). Notably, none of the ATX preparations used in this study (from transfected COS1 cell conditioned media) hydrolyzed Amplex® Red directly (data not shown).The kinetic data demonstrate the strengths and weaknesses of each enzymatic assay for the detection of ATX activity. Product formation kinetics were linear at 30 – 100 ng WT-ATX protein for FS-3 and LPC, and at 30 – 60 ng WT-ATX protein for pNpTMP (data not shown). LPC has the advantage of being ATX-specific. Although FS-3 hydrolysis by NPP1 and NPP3 is considered unlikely because they lack activity toward lysophospholipids, direct evidence that FS-3 itself is resistant to hydrolysis by NPP1 or NPP3 has not been reported and this limits the interpretation of ATX specificity . In contMigration responses of A2058 cells, with or without inclusion of exogenous LPC (18:1), to WT-, H226Q-, and H434Q-ATXs are shown in Fig. Migration stimulation by H420Q-ATX was indistinguishable from WT-ATX (data not shown). At tested concentrations, migration stimulation by H226Q-ATX or by H434Q-ATX, without exogenous LPC, was not significantly different from background. Inclusion of sufficient exogenous LPC with either mutant resulted in a significant migration response. Together these results suggest that, compared to WT-ATX, H226Q-ATX and H434Q-ATX are not only less efficient in hydrolyzing exogenously-provided LPC but are also less efficient in hydrolyzing and/or retrieving cell-derived substrate. LPC alone failed to stimulate migration responses in the absence of exogenous ATX. Therefore the migration response data reflect properties intrinsic to the various ATX constructs.The product of extra-cellular ATX activity is LPA, a powerful stimulatory lipid which acts via cell surface receptors and whose concentration must be tightly regulated in space and time. This suggests that ATX itself is localized near its products' site of action. If both WT-ATX and the attenuated mutants, e.g. H226Q-ATX, have a common target, competition could occur between the two forms. To detect a dominant negative effect of H226Q-ATX on WT-ATX activity, we tested the migration response of WT-ATX in the presence and absence of excessive amounts of H226Q-ATX, and the results are shown in Fig. At higher concentrations of H226Q-ATX activity of WT-ATX, and the results are shown in Fig. The prevailing context of this study was cancer theory and therapy, but as noted in the Background section, the findings have implications for development and for other pathologies. ATX is extra-cellular and a metallo-enzyme; therefore it is an attractive pharmacological target. Knowledge of the details of the lysophospholipase D enzyme mechanism can inform efforts at drug design. For example, ATX and the other NPPs use a "ping-pong" type mechanism that involves two hydrolytic steps. The second step is an attack by water on the covalent enzyme intermediate, and this releases the final product, LPA. Enzymes using this type of mechanism are often sensitive to product inhibition, and it is now apparent that the proposed natural inhibitor, S1P, and the recently reported synthetic inhibitors, are either a product or product analog.The role of particular amino acids within ATX in this enzyme mechanism is incompletely understood. Studies using chimeric constructs with regions from other NPPs indicate that regions throughout the entire length of ATX are irreplaceable for LPC hydrolysis. It is known that threonine at position 210, the site of intermediate formation, is absolutely required; and certain histidine residues have been implicated as coordinators of required metals. Histidine residues within enzymes can also participate directly in other aspects of catalysis. For example, in histidine phosphatase, histidine plays a crucial role in the phospho-transfer reaction . MeasuriTwo mutants, H226Q-ATX and H434Q-ATX showed anomalous results: they could hydrolyze LPC, albeit at a reduced rate, but did not stimulate cell migration. The initial study, identifying plasma LPLD as ATX reportedH226Q-ATX and H434Q-ATX are the first point mutations of ATX/NPP2 demonstrated to differentially impair substrate hydrolysis, including that of endogenous substrate(s) in the migration assay. These two histidine residues appear to be important in ATX-substrate interaction. H420Q-ATX could not be differentiated from WT-ATX, indicating that histidine at position 420 is not required for any of the activities of ATX tested in this study. There was no apparent cross-inhibition of either migration stimulation or hydrolytic activity between WT-ATX and the attenuated mutant H226Q-ATX.Except as noted, reagents were from Sigma-Aldrich . FS-3 was from Echelon Biosciences , and Amplex UltraRed was from Invitrogen Molecular Probes .The HA-tagged ATX was obtained by amplification utilizing the Platinum Pfx DNA polymerase . An antisense oligonucleotide primer was used to introduce the HA epitope tag (YPYDVPDYA) and an XbaI site into the C terminus of ATX:(5'ATGCATGCTCTAGAATAGTCAGGAACATCGTATGGGTACTCGAGAATCTCGCTCTCATATGT3'). The sense primer that we utilized to introduce a HindIII site was (5'ATCTATCTAAGCTTATGGCAAGGAGGAGCTCGTT3'). ATX/NPP2 cDNA, derived from MDA 435 cells cloned into pcDNA3.1 vector (pcDNA3.1wATX/NPP2) was used as a template [All point mutants of ATX were constructed utilizing the QuikChange XL Site-Directed Mutagenesis Kit from Stratagene per the manufacturer's protocol . Each mutant plasmid was sequenced to confirm the presence of the mutation and the fidelity of the PCR amplification. COS-1 cells were transiently transfected with pcDNA3.1-wtATX or with each mutant plasmid using Lipofectamine 2000 reagent (Invitrogen Life Technologies) per the manufacturer's protocol. A non-vector control was produced by adding appropriate medium and identical treatments but no vector to COS-1 cells. Following transfection, medium was switched to DMEM and cells were incubated for 48 hr. The conditioned media were collected, concentrated, and analyzed by immunoblot using 4–12% polyacrylamide gels, anti-ATX-peptide rabbit polyclonal affinity-purified primary antibody , goat-anti-rabbit HRP-conjugated secondary antibody, ECL-plus (Amersham), and quantification by direct scanning . Relative ATX protein concentrations were determined and normalized prior to the assays by comparing immunoblot signal intensities.Cell migration was measured using A2058 human melanoma cells as described earlier with min2, 1 mg/ml BSA (fatty acid free); substrates and their concentrations were included as indicated. LPC hydrolysis assays were based on detection of released choline. The reactions contained choline oxidase (0.1 U/ml), peroxidase (1.0 U/ml), and Amplex UltraRed (10 μM). Product formation kinetics (peroxide-driven Amplex UltraRed hydrolysis to yield fluorescent resorufin) was monitored by fluorimetry (Ex560 nm/Em590 nm). The assays for hydrolysis of pNpTMP [Reaction buffer (TCB) was 50 mM Tris pH 7.4, 5 mM CaClf pNpTMP and FS-3f pNpTMP were adaATX: (autotaxin); DB: (DMEM supplemented with 0.1% FAF-BSA); FAF-BSA: ; LPA: (lysophosphatidic acid); LPC: (lysophosphatidylcholine); LPLD: (lysophospholipase D); NPP: (nucleotide pyrophosphatase and phosphodiesterase); PDE: (phosphodiesterase); pNpTMP: (p-nitrophenyl-TMP).The authors declare that they have no competing interests.EK performed the mutagenesis, construction of vectors, and ATX expression. RWB developed the enzyme assay methodology. DDR analyzed and interpreted data. TC performed the enzyme activity and migration assays. MLS and TC designed the study, performed statistical analysis, and wrote the manuscript. All authors read and approved the final manuscript. |
Previous histological and imaging studies have shown the presence of variability in the degree of bronchoconstriction of airways sampled at different locations in the lung . Heterogeneity can occur at different airway generations and at branching points in the bronchial tree. Whilst heterogeneity has been detected by previous experimental approaches, its spatial relationship either within or between airways is unknown.in vitro. The portion comprised contiguous airways spanning bronchial generations (#3-11), including the associated side branches. We used a recent optical imaging technique, anatomical optical coherence tomography, to image the bronchial tree in three dimensions. Bronchoconstriction was produced by carbachol administered to either the adventitial or luminal surface of the airway. Luminal cross sectional area was measured before and at different time points after constriction to carbachol and airway narrowing calculated from the percent decrease in luminal cross sectional area.In this study, distribution of airway narrowing responses across a portion of the porcine bronchial tree was determined When administered to the adventitial surface, the degree of airway narrowing was progressively increased from proximal to distal generations . This 'serial heterogeneity' was also apparent when carbachol was administered via the lumen, though it was less pronounced. In contrast, airway narrowing was not different at side branches, and was uniform both in the parent and daughter airways.Our findings demonstrate that the bronchial tree expresses intrinsic serial heterogeneity, such that narrowing increases from proximal to distal airways, a relationship that is influenced by the route of drug administration but not by structural variations accompanying branching sites. Structural and functional heterogeneity, which impacts on normal respiratory function, could be present across different generations of the bronchial tree, and notably at branching points where the parent airway gives rise to daughter generations. There is a need to better characterize airway heterogeneity as it is thought to be important in the pathophysiology of obstructive pulmonary disease [Airways are structurally complex and disease ,2.1) or airway resistance, leaving the contribution from different airway generations unknown.The method used to measure airway narrowing is critical to the identification of heterogeneity. Several studies based on direct imaging have compared the extent of airway narrowing across different airways in the lung -8, and nIn vivo, narrowing increases from the trachea to the major bronchi [Whilst heterogeneity in airway narrowing responses has been frequently observed, it remains unclear whether the amount and rate of airway narrowing are randomly distributed throughout the lung, or whether the response varies systematically along axial pathways, such as may occur with a serially distributed heterogeneity. bronchi ,13, pres bronchi or in mi bronchi while hi bronchi ,11. Some bronchi thereby In contrast to heterogeneity between different airway generations, the potential for more localised physiological variability at the branching points of airways appears to have been overlooked. The structural design at the bifurcation deviates from the rest of the airway reflected by differences in the shape and size of cartilage plates as well as the orientation of ASM fibres -18. DespaOCT), that incorporates a moving (rotating and translating) probe and so enables the airway to be viewed across a predetermined distance such that the organ is imaged essentially in three dimensions. Unlike all previous studies, aOCT enabled dynamic narrowing responses of different generations of airway and side branches, in the same preparation, to be recorded contemporaneously and under identical experimental conditions. Specifically we recorded airway narrowing to carbachol, in a portion of the bronchial tree that was separated from the lung parenchyma so that any differences could be attributed to the properties of the airway alone and not to surrounding lung tissue. Carbachol was chosen as the agonist since regional differences in narrowing or the kinetics of response are independent of enzymatic breakdown. By adding carbachol directly to the fluid bathing the adventitia or lumen of the airways, we were also able to control the route of drug delivery and the doses to which the ASM was exposed.This study determined the distribution of airway narrowing along a part of the bronchial tree comprising a series of contiguous conducting airways spanning a range of airway generations, including associated side branches. To measure changes in airway calibre we used a recent optical imaging technique, anatomical optical coherence tomography , were sedated with tiletamine/zolazepam (4.4 mg/Kg im.) and xylazine (2.2 mg/Kg im.) and exsanguinated under pentobarbitone sodium anesthesia (30 mg/Kg iv.). Lungs were then removed and transported on ice to the laboratory for dissection of airways.aOCT is shown in Figure A length of the bronchial tree was dissected from the right lower lobe of the lung, beginning from the lobar bronchus and extending distally ~5-6 cm. In the pig lung, the first 6-7 cm of bronchus comprises a large parent bronchus that runs axially with minimal bending, giving rise to daughter airways (side branches) at regular intervals . The daughter airways are smaller than the parent bronchus and typically branch off with a high angle of departure. As each side branch was reached it was cleared of parenchyma over a distance of ~1 cm and ligated at a distance furthest from the parent bronchus. Airway generation was determined by counting the number of side branches arising from the parent bronchus, taking the trachea as generation #0. The dissection produced a straight, tapering and cylindrical bronchial tree spanning generations #1 to #13. A 3D rendering of an airway preparation imaged with 2, 5% CO2) Krebs solution at 37°C. The preparation was stretched slightly to a length shown previously to approximate functional residual capacity in the pig lung, i.e., ~105% of the fully deflated length at 0 cmH2O [2O, set by the height of a reservoir containing Krebs solution connected at the distal side of the preparation.Airway preparations were cannulated at both ends and placed horizontally in an organ bath containing gassed [aOCT imaging, low coherence near infra-red light is emitted from an optical probe. The same probe is used simultaneously to detect reflections of light from the air-tissue interface of the lumen which allows the distance to the luminal surface to be determined by interferometry. By rotating the probe, a 2D axial image of the lumen may be reconstructed, and by precisely moving the probe backwards or forwards using a motorized translation stage, these axial images may be combined into a 3D data set. Airway measurements using aOCT are calibrated to account for the refractive index of the medium, e.g., air or liquid. Airway segments in the present study were filled with Krebs solution which we determined to have a refractive index of 1.37.Airway dimensions were measured using anatomical optical coherence tomography (aOCT) -23. DuriaOCT system has an axial resolution of 32.9 μm, and a minimum beam waist of 100 μm occurring 6.6 mm from the probe head. The depth of focus of the probe was 11 mm. For the present study, the rotating aOCT probe was encased in a transparent catheter (OD 2.2 mm). The catheter was inserted into the airway lumen, beginning at the cannula in the proximal end of the airway and extended down to the internal edge of the distal airway cannula where it was locked in position. The airway lumen was sealed by wrapping silicon tape around the catheter at its point of insertion at the proximal side of the airway. The aOCT probe was rotated at ~0.8 Hz, acquiring quantitative images of lumen cross sectional area, which were displayed in real time on a computer monitor. For 3D airway assessment, the probe was slowly drawn back along the length of the airway (referred to as a 'pullback scan'), constructing a 3D model of the airway followed by a recovery period of at least 1 hour.Before experimentation airway preparations were allowed 1 hour to equilibrate to organ bath conditions during which the lumen and adventitia of the preparation were regularly flushed with fresh Krebs solution. Tissue viability was confirmed by airway contractions to electric field stimulation and acetylcholine . Pullback aOCT scans were performed in the relaxed airway before the addition of carbachol to the bath and then at 5, 15 and 30 minutes after carbachol, which approximated the time course of bronchoconstriction (see Results). The rate of pullback was 0.19 mm/sec. In the second protocol, carbachol was applied to the lumen (inside) of the airway. To achieve a comparable level of bronchoconstriction the dose of carbachol administered to the lumen (3 × 10-4M) was 30-300 fold greater than that applied to the adventitial surface due to the high integrity of the epithelial barrier [Airway narrowing was assessed across the full range of generations incorporated in the airway preparation. Two protocols were used to measure airway narrowing to the bronchoconstrictor agent carbachol. In the first protocol, carbachol was administered to the adventitial surface (outside) of the airway preparation with a final bath concentration of ~1 × 10 barrier . Further barrier , likely At the conclusion of the experiment, airways were fixed in the bath, frozen in Tissue Tek embedding media and cryo-sectioned for staining with a Servio Stain kit .Luminal cross sectional area was measured at different locations in airways before and after the addition of carbachol, and airway narrowing was calculated from the percentage decrease in luminal cross sectional area. Unless otherwise stated, airway cross sectional area was measured by tracing an area around the lumen using custom designed quantification software developed in the C++ language.Three separate analyses were performed. For the first analysis , we compared airway narrowing between generations, at sites located away from branching points in which to make the cross-sectional area measurements. This was the plane containing the mouth of the daughter side branch. To eliminate errors caused by any change of angle between the relaxed and contracted airways, this oblique plane was identified separately for each aOCT acquisition. Effects of luminal carbachol only were examined. VolView software was used for 3D reconstruction of airways and for the subsequent measurement of luminal cross sectional area in parent and daughter bronchi.In addition to assessing differences in airway narrowing between generations, this study also determined whether there were local inhomogeneities in narrowing at regions of airway branching. Two additional analyses were carried out to assess this effect: Analysis 2) Airway narrowing within the parent bronchus was measured at the midpoint of branching, i.e., where the parent bronchus was seen to open into a daughter side branch and Statistica . Airway narrowing at different anatomical locations was compared using two-way ANOVA and Newman-Keuls post hoc analyses with anatomical location and time as repeat measure variables. Time to 50% narrowing was computed for both outside and inside application of carbachol and used as an index of the rate of airway narrowing. Maximal airway narrowing/time to 50% narrowing (rate) in response to outside or inside application of carbachol were compared at proximal and distal locations using two-way ANOVA and Newman-Keuls post hoc analyses, with route of drug administration as a non repeat measure variable, and anatomical location as a repeat measure variable. Linear correlations between maximum narrowing and time to 50% narrowing were computed using Pearson's correlation analysis. Comparisons between airway narrowing measured in connecting daughter-parent bronchi were made using Student's paired t-test. Data are means ± standard error where N equals the number of animals/airway preparations, or where stated, N refers to the number of data points (see Results). A P-value < 0.05 was considered statistically significant.aOCT are shown in Figure aOCT for airway wall measurements such as wall thickness [Example cross sectional images of airways recorded by hickness ,25, thouScans were acquired along the entire length of the airway preparation before and after carbachol and changes in cross sectional area were measured until the narrowing to carbachol had reached a minimum cross sectional area. Airway narrowing to carbachol administered to either adventitial or luminal surfaces produced a heterogeneous pattern of airway narrowing, such that narrowing was more pronounced at distal locations. Furthermore, there was a close correlation between airway generation and narrowing by the adventitial route in all preparations investigated Figure , N = 4. As a result of the progressive increase in narrowing with generation there were substantial differences in airway narrowing to carbachol in the most distal airway compared to the most proximal, irrespective of the route of drug administration Figure and 5B. The rate of airway narrowing also varied with airway generation and was more rapid in distal than proximal airways as indicated by negative correlations in the time to 50% response for adventitial drug administration in all four preparations investigated Table . By thatIn addition to the measurements of airway narrowing at different generations within the parent bronchus , airway narrowing was also measured at regions where branching occurred. We assessed whether structural variations at regions of branching modified airway narrowing within the parent bronchus itself . Airway narrowing was measured in the parent bronchus either side of the branching site, and at the mid point where the parent bronchus opened into the side branch Figure . For meaA further analysis was performed to compare airway narrowing in the mouth or opening of daughter bronchi and the parent bronchus . Daughter bronchi were readily visible on 3D reconstructions of the airway preparation Figure . Airway Finally, in order to identify possible structural properties that may influence airway narrowing at regions of branching, histological cross sections of parent bronchi were obtained at branching points . While airway closure was not observed in this study, it is important to appreciate that flow may well be reduced to physiologically unsustainable levels prior to absolute airway closure, that is 'functional closure'[Based on the relationship between airway narrowing and generation observed here, we would predict that airway closure would only occur, if at all, in the most peripheral airway generations. Airway closure closure'. Moreove closure', manifes closure'. However closure', bronchoPrevious attempts have been made to identify serial heterogeneity within the bronchial tree. However, to our knowledge no study has determined whether more localized heterogeneity exists at side branches. Indeed, branching points might have been considered an obstacle to be avoided in past studies. By constructing both 2D and 3D images, we provide the first information on narrowing at the entrance of the daughter airway and whether the presence of a side branch affects narrowing in the parent trunk. The results of the analysis have shown that branching has no major effect on airway narrowing; responses were uniform both within the trunk of the parent airway and in the entrance, or mouth, of an emerging side branch. Given the structural complexity of branching, which requires a transition in ASM orientation and cartilage, each of which could potentially affect airway narrowing, these findings are somewhat surprising. In the monopodial airway of the pig, and other species, daughter airways emerge from the parent trunk and the predominant circumferential orientation of ASM in the parent re-orientates around the daughter ,18, whicA number of explanations can be offered as to why airway narrowing is maintained at regions of branching. One may be that the structural complexity at the dividing point is too localized to exert an overall effect on airway function, e.g., active ASM stress from neighboring parts of the airway prevails over any lack of stress at the bifurcation. Importantly, a strength of our approach was that we preserved the 3D structural integrity of the airway wall so that the physiological behavior of the entire airway wall could be determined. Secondly, a semi-quantitative analysis of airways used in the present study indicated an abundance of ASM as well as cartilage in the immediate point of branching, which could explain why airway narrowing responses were maintained at these regions. We speculate that a greater ASM mass at a bifurcation would develop more force than elsewhere in the airway tree, compensating for any change in ASM orientation that necessarily accompanies transition from parent to daughter airway, or any additional load associated with the cartilage in the dividing airway wall ,35.aOCT images provide a comprehensive view of contiguous regions of the bronchial tree enabling both steady state and dynamic responses of airway narrowing to be followed in identifiable and defined portions of the tree. Although the bronchial tree exhibits an intrinsic and progressive increase in the rate and amount of narrowing to carbachol as it extends peripherally, the expression of this physiological heterogeneity is partly offset when drugs are administered via the lumen and epithelium. aOCT-derived 3D images also provided the first measurements of airway narrowing in and around side branches. Our findings are that airway narrowing is not affected by structural complexities produced by branching, as indicated by similar narrowing between parent and daughter airways.In summary, aOCT: anatomical optical coherence tomography; ASM: airway smooth muscle; FEV1: forced expiratory volume in 1 sec; OD: outer diameter.JJA, PRE, DRH and DDS are listed as inventors on a provisional patent application associated with clinical applications of anatomical optical coherence tomography. RAM is listed as a potential beneficiary of this same provisional patent application. The other authors have no competing interests regarding this study.PBN was responsible for experimental design, data collection/analysis, and also preparation of the manuscript. RAM was responsible for the development of the quantification software, and assisted in data collection and manuscript preparation. ARW assisted in data collection, manuscript preparation and contributed to experimental design. SB and JJA assisted in data collection. PKM, PRE, DRH, and DDS provided intellectual input and assisted in manuscript preparation. HWM was responsible for experimental design and manuscript preparation. All authors read and approved the final manuscript. |
The Np—O distances are 1.8975 (7) and 1.8891 (7) Å in the NpO4 group and 2.3451 (7) Å to the OH group. Both Na atoms have a distorted octahedral oxygen environment.The title compound, Na Na3[NpO4(OH)2] 2]·4H2O 2]·2H2O 6][NpO4(OH)2]·2H2O 2]·3H2O 2]·2H2O 2] 2]·2H2ONaM r = 440.02 Monoclinic, a = 7.8166 (3) Å b = 7.7703 (2) Å c = 6.8211 (2) Å β = 112.9139 (14)°V = 381.60 (2) Å3 Z = 2 Kα radiationMo −1 μ = 13.79 mmT = 100 (2) K 0.12 × 0.08 × 0.02 mm Bruker Kappa APEXII area-detector diffractometerSADABS; Sheldrick, 2004T min = 0.522, T max = 0.770Absorption correction: multi-scan (16264 measured reflections2357 independent reflectionsI > 2σ(I)1920 reflections with R int = 0.024 R[F 2 > 2σ(F 2)] = 0.010 wR(F 2) = 0.021 S = 1.04 2357 reflections70 parameters3 restraintsAll H-atom parameters refinedmax = 0.75 e Å−3 Δρmin = −0.88 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 1997a SHELXL97 (Sheldrick, 1997a SHELXTL97 (Sheldrick, 1997b SHELXTL97.Data collection: 10.1107/S1600536807066962/sg2217sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536807066962/sg2217Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
BMC Bioinformatics, 2005, 6, Art. No. S11 Suppl. 2.) reported usage of a Full Moon BioSystems slide for calibration. Inspired by the Shi et al. work, we have calibrated microarray scanners in our previous research. We were puzzled however, that most of the signal intensities from a biological sample fell below the sensitivity threshold level determined by the calibration slide. This conundrum led us to re-investigate the quality of calibration provided by the Full Moon BioSystems slide as well as the accuracy of the analysis performed by Shi et al.Calibration of a microarray scanner is critical for accurate interpretation of microarray results. Shi et al. (Signal intensities were recorded on three different microarray scanners at various photomultiplier gain levels using the same calibration slide from Full Moon BioSystems. Data analysis was conducted on raw signal intensities without normalization or transformation of any kind. Weighted least-squares method was used to fit the data.We found that initial analysis performed by Shi et al. did not take into account autofluorescence of the Full Moon BioSystems slide, which led to a grossly distorted microarray scanner response. Our analysis revealed that a power-law function, which is explicitly accounting for the slide autofluorescence, perfectly described a relationship between signal intensities and fluorophore quantities.Microarray scanners respond in a much less distorted fashion than was reported by Shi et al. Full Moon BioSystems calibration slides are inadequate for performing calibration. We recommend against using these slides. Shi et al. publisheOur experiments show the sensitivity and linearity of the photomultipler tube (PMT) is significantly underestimated by the Full Moon BioSystems calibration slide. Because understanding the scanner response is crucial for the meaningful interpretation of microarrays, we feel it is appropriate to communicate this note to the readers, especially in light of the fact that the Shi et al. paper has been well cited.i.e. a buffer spotted without the dye).Based on the text of Shi et al. paper, wFull Moon BioSystems calibration slide was scanned by three different scanners: Agilent, Bio-Rad and GenePix. Prior scanning, no hybridization was conducted, because the calibration slide already carries spots of dyes. With Agilent and Bio-Rad both color channels were investigated. In addition, several PMT settings were tested on the Agilent scanner.Given that signal intensity vs. concentration curves partially linearize in log-log coordinates (not shown), we propose the following model of scanner response:SI is signal intensity, x - surface density, g - autofluorescence of the buffer, B and a - empirical parameters. This model was used to fit the newly obtained data by an Agilent scanner as well as previously recorded data by Bio-Rad and GenePix scanners. An example of fitting is shown in Figure where x and y dimensions, a regular least-squares fit is inadequate. A modified merit function was found to be the best for the given data:A magenta line shows the model prediction, while the green line theoretically represents scanner response without the "buffer" interference. It is important to note that because of the extremely large span of data in both E was attained. Table The model fitting was conducted by varying parameters until a minimum of B, the sensitivity of the photomultiplier and a, the curvature of the line. It is important not to confuse the slope in our model (B) with the slope reported by Shi et al., because the latter is in log-log coordinates, which corresponds to our parameter a. Although Figure a means deviation from the straight line (a = 1). As our model predicts, the lower plateau does not apply to a PMT in reality and curvature (a).In non-transformed coordinates, the new model introduces two parameters: line a = . As our The reason why the above mentioned finding is relevant to the discussion of the Shi et al. paper is that calibration of a microarray scanner with Full Moon BioSystems slide is confounding the situation. The calibration slide introduces an artifact of the lower plateau. Moreover, one can see from the Shi et al. study that the span of the linear part (in log-log coordinates) of the PMT response curve depends on the PMT gain. Specifically, at the high gain, the linear part is short, same as at the low PMT gain. We argue that it is because of the lower plateau artifact the linear part is affected. At low PMT gain, the signal is drowned in background fluorescence, while at high gain, the background fluorescence is saturating the PMT. It may very well be that the linear (or slightly curvy) response line spans over much larger range of concentrations than it is reported by Shi et al. This explains why most of the signals were below the lower plateau in our ongoing gene expression studies. In retrospect, the only reason for calibrating a scanner could be to determine the saturation limit of the PMT.a) does not significantly depend on the PMT gain and channel. For the scanners investigated , the curvature of the line does not differ markedly between Cy3 and Cy5 channels , but the curvatures of the lines (parameter a) are essentially the same. Given that fact, simple ratios of signal intensities between red and green channels for Agilent and Bio-Rad scanners will be perfectly sufficient to describe gene expression changes without calibration. Figure The secondary finding of this study is that the curvature of the calibration line (parameter g). Our model accurately captured the value of autofluorescence, because, as one would expect, the parameter g is independent on the PMT setting. The g values for other scanners are somewhat different from that of Agilent, which is because the calibration slides were from different batches. The g value itself (~8-12) is about 4 orders of magnitude larger than the lowest concentration of the dye on the slide. Obviously, with this level of autofluorescence the dilution series 15-27 have no utility . We recommend against using Full Moon BioSystems calibration slides.Alexander Pozhitkov conducted the research and wrote the manuscript. |
It was synthesized from 2-acetylpyridine and N,N-dimethylformamide dimethyl acetal in a one-step reaction.The molecule of the title compound, C Å b = 23.117 (5) Å c = 7.6880 (15) Å β = 108.17 (3)°V = 956.9 (3) Å3 Z = 4 Kα radiationMo −1 μ = 0.08 mmT = 295 K 0.12 × 0.10 × 0.08 mm Bruker APEXII CCD diffractometerSADABS; Bruker, 2004T min = 0.990, T max = 0.994Absorption correction: multi-scan (7131 measured reflections1775 independent reflectionsI > 2σ(I)1403 reflections with R int = 0.027 R[F 2 > 2σ(F 2)] = 0.047 wR(F 2) = 0.143 S = 1.00 1775 reflections121 parametersH-atom parameters not refinedmax = 0.18 e Å−3 Δρmin = −0.15 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809030530/hb5023sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536809030530/hb5023Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Loss of excess weight can improve blood lipids, insulin sensitivity, and blood pressure. However, data are scant on behavioral strategies related to maintenance of weight loss. We examined dietary practices, physical activity, and self-efficacy among adults self-reported to be successful at maintaining weight loss.Using the 2004 Styles survey, a mailed survey of U.S. adults aged 18 years or older, we examined behaviors associated with weight loss maintenance among people who reported trying to lose weight. We analyzed data on number of daily fruit and vegetable servings, minutes per week of physical activity, dining out behavior, and confidence in one's ability to engage in behavioral strategies. We conducted frequency and multivariable logistic regression analyses.More men (35.5%) than women (27.7%) were classified as successful weight loss maintainers. Compared with adults who reported eating at a fast-food restaurant two or more times per week, adults who reported not eating at fast-food restaurants were more successful at weight loss maintenance . Compared with adults who consumed fewer than five fruit and vegetable servings per day and were sedentary, adults who consumed fewer than five fruit and vegetable servings per day and accrued 420 minutes or more per week of physical activity or consumed five or more fruit and vegetable servings and accrued 150 minutes or more per week of activity were more successful at weight loss maintenance.The behavioral strategy of reducing consumption of fast foods could assist people in keeping weight off. The combined approach of consuming five or more fruit and vegetable servings per day and attaining 150 minutes or more per week of physical activity was a common strategy among adults successful at weight loss maintenance. An increasing number of people worldwide are obese or overweight, and being overweight increases the risk of developing chronic diseases . Almost Dietary Guidelines for Americans 2005 is the largest study of adults aged 18 years or older who have maintained long-term weight loss ,20. ThisWe used a population-based approach to examine behavioral strategies used by people successful at weight loss. We examine racial and ethnic differences in men and women and describe the combined dietary and physical activity behavior among U.S. adults who were attempting weight loss maintenance. We set out to examine whether the combined behavior of eating higher amounts of low-energy–density fruits and vegetables and engaging in regular physical activity is associated with successful weight loss maintenance. In addition, we assessed respondents' dining out behaviors and confidence in their ability to engage in behavioral strategies that support successful weight loss maintenance.Data for these analyses came from the 2004 Porter Novelli HealthStyles and ConsumerStyles databases , the age group distribution of responders did not differ significantly from the 2000 U.S. census distribution.During July and August 2004, after the loss of 32 people from the ConsumerStyles panel, the HealthStyles survey was mailed to the remaining 6175 households that had completed the ConsumerStyles survey. Responses to HealthStyles were received from 4345 people, yielding a response rate of 70%. Health and lifestyle data used in our analysis were mainly from the HealthStyles survey, whereas demographic information was obtained from the ConsumerStyles survey. Although the median age of responders to the HealthStyles survey was older than that of nonresponders I've lost weight and have been able to keep it off, 2) I've lost weight but haven't been able to keep it off, 3) I've tried to lose weight but haven't been successful, 4) I've maintained my weight with conscious effort, 5) I've maintained my weight without effort, 6) I've gained weight and haven't tried to lose it, and 7) I pay no attention to my weight. Participants who reported they lost weight and kept it off were defined as Dietary behaviorsThe Styles survey asked respondents about their consumption of fruits and vegetables: "How many servings of vegetables did you eat or drink yesterday, not counting potatoes?" and "How many servings of fruit did you eat or drink yesterday?" Respondents were asked to include 100% vegetable or fruit juice and fresh, frozen, or canned vegetables or fruit. The upper tertile of consumption was five servings; therefore fruit and vegetable consumption was categorized as fewer than five servings or five or more servings.Physical activity levels Physical activity behavior was assessed by asking respondents to answer two questions about the frequency and duration of both moderate- and vigorous-intensity physical activities: "During a usual week in the past month, how many days did you do moderate or vigorous physical activities?" and "What is the average number of minutes you spent on these activities each day?" Respondents were prompted that moderate activities referred to activities that cause an increase in breathing or heart rate, such as fast walking, cycling for pleasure, dancing, and yard work, and that vigorous activities referred to activities that cause large increases in breathing, such as running, aerobics, fast bicycling, competitive sports, or heavy yard work. Responses were combined to create categories for total time of weekly activity: none, fewer than 150 minutes, 150 to 419 minutes; 420 to 629 minutes, and 630 minutes or more of moderate- or vigorous-intensity activity.Dining out behaviorsRespondents were asked about the number of nights during the last week they had engaged in certain dining out behaviors. The lead-in to the question was the following: "In the past 7 days, on how many nights did you (or the person who makes dinner in your household): 1) make dinner at home, 2) go out to a fast-food restaurant to eat, 3) go out to a nonfast-food restaurant to eat, 4) bring home take-out food from a restaurant, 5) bring home prepared food from a supermarket, or 6) order food to be delivered to your home?" We created the variable "days per week bring home or have delivered prepared food" by combining "bring home take out," "bring home prepared food from supermarket," and "order delivered food." The following dining behaviors also were combined to create a new index variable, "days per week eat away from home," by combining "eat at fast-food restaurant" and "eat at nonfast-food restaurant." Respondents were asked to indicate the average number of times per week they made dinner at home using a number from zero through seven. Responses were classified into the following: less than three, three to five, and six to seven times per week. With a separate question, respondents were asked, "Which of the following would you say you often do when eating out at a restaurant?" Participants were asked to respond either yes or no to all that apply: 1) order an appetizer to serve as an entrée, 2) split an entrée with someone, 3) order a half-portion of an entrée, and 4) split a dessert with someone. The first three were combined to create "order reduced entrée or split an entrée."Behavioral strategies Respondents were asked to rate their level of confidence in their ability to engage in certain dietary behaviors on a scale of 1 through 10. The questions centered on the following behaviors: "Keep track of the number of calories you eat," "Eat smaller amounts of food at each meal to control or lose weight," "Balance the amount of food you eat each day with how active you are," "Keep fewer high-fat or high-calorie snack foods in your house," "Snack on fruits and vegetables instead of high-calorie or high-fat snacks," "Limit dining out to only two times a week." The responses were grouped into the following three categories: not confident (response of 1–3), somewhat confident (response of 4–7) and very confident (response of 8–10). Missing responses were not included in the analyses.From the 4345 HealthStyles respondents, we first limited our analytic sample to the 2124 participants whom we classified as successful weight loss maintainers or unsuccessful weight loss maintainers . Characteristics of respondents included in the analyses were similar to those of respondents not included, with the exception of sex. However, we examined weight loss maintenance among men and women separately. From the 4345 respondents, we excluded the following 2221: respondents who had maintained weight with effort (n = 765) or without effort (n = 598); respondents who gained weight and had not tried to lose it (n = 355); respondents who paid no attention to weight (n = 304); and respondents who were missing data on weight loss or maintenance (n = 199). Of the remaining 2124, we then excluded respondents with missing self-reported height or weight (n = 77); respondents who reported extreme height or weight values (n = 44); female respondents who stated they were currently pregnant or who did not respond to the question on pregnancy (n = 52); and respondents who were missing data on moderate- or vigorous-intensity activity (n = 260) or fruit and vegetable intake (n = 17). Some participants met one or more exclusion criteria. After exclusions, the final sample numbered 1713, with 648 men and 1065 women.2]), fruit and vegetable servings, physical activity level, dining out behaviors, and confidence in their ability to engage in specific behavioral strategies. We used multivariable logistic regression to calculate adjusted odds ratios (ORs) with 95% confidence intervals (CIs) for those successful (versus unsuccessful) at weight loss maintenance. We excluded from the individual comparisons data that were missing because of participant nonresponse. The data were poststratified and weighted to the U.S. census population on age, race/ethnicity, sex, household size, and household income to create a population-based data file. We conducted all analyses using SAS version 9.1-callable and SUDAAN version 9.0 software to account for the complex sampling design and weighting procedure.We calculated the prevalence of respondents who were successful at maintaining weight according to sex, age, race/ethnicity, education, income, body mass index were more likely to maintain weight loss than people who were sedentary . CompareAfter adjusting for sex, race/ethnicity, education, income, BMI, and physical activity, we found similar odds of successful weight loss maintenance for people who often ordered a reduced-size entrée when dining out and people who ordered regular-size entrées. Adults who did not eat at fast-food restaurants were more likely to maintain weight loss than people who reported fast-food dining two or more times per week .Analysis of confidence in one's ability to engage in dietary strategies showed that respondents who were more confident in their ability to engage in certain behaviors were more successful at weight loss maintenance than those who were not confident . SpecifiAlthough studies have linked the consumption of fruits and vegetables and regular physical activity to the management of chronic diseases , no epidOne common characteristic among people who were successful at weight loss maintenance is their participation in regular physical activity. These results are consistent with past research documenting the importance of physical activity in successful weight loss maintenance . The higIn this study, men and women successful at weight loss maintenance reported different individual behaviors. Among women who reported consuming five or more fruit and vegetable servings on the previous day, one-third were successful at weight loss maintenance. Among women who reported consuming fewer than five fruit and vegetable servings, one-fourth were successful. However, we found higher odds of successful weight loss maintenance among adults who engaged in the combined behaviors of eating five or more fruit and vegetable servings per day and moderate to high levels of physical activity. Data from the NWCR also found that participants who have maintained long-term weight loss reported that fruits and vegetables made up a large percentage of food items reported on a food frequency questionnaire . SubstitData on consumption of foods away from home suggest that when dining out, people eat more food, higher-calorie food, or both . TherefoIn our study, respondents' level of confidence in their ability to engage in diet modification, including eating smaller amounts of food, balancing food intake with activity, and keeping track of calories, was also related to successful weight loss maintenance. Normative beliefs, such as confidence, can act as a motivating factor for behavior change . In a coOur analysis is subject to several limitations. First, Styles participants are obtained through survey panels, which commonly are used in marketing research but less commonly in health research. Research comparing findings from paneling techniques and traditional health-research sampling techniques has found similar prevalence responses to several survey items . HoweverOur study suggests that one dietary strategy associated with successful weight loss maintenance was eating infrequently at fast-food restaurants. The combined approach of consuming five or more fruit and vegetable servings on the previous day and accruing 150 minutes or more per week of physical activity also was associated with successful weight loss maintenance. Further research is needed to determine an array of practical dietary strategies and modes of physical activity that help people develop long-term healthful habits that can result in improved health and quality of life through successful weight loss maintenance. |
Few studies have examined the association between weight perception and socioeconomic status (SES) in sub-Saharan Africa, and none made this association based on education, occupation and income simultaneously.Based on a population-based survey (n = 1255) in the Seychelles, weight and height were measured and self-perception of one's own body weight, education, occupation, and income were assessed by a questionnaire. Individuals were considered to have appropriate weight perception when their self-perceived weight matched their actual body weight.The prevalence of overweight and obesity was 35% and 28%, respectively. Multivariate analysis among overweight/obese persons showed that appropriate weight perception was directly associated with actual weight, education, occupation and income, and that it was more frequent among women than among men. In a model using all three SES indicators together, only education and occupation were independently associated with appropriate perception of being overweight. The OR reached 6.9 [95% CI: 3.4-14.1] when comparing the highest vs. lowest categories of SES based on a score including all SES indicators and 6.1 [95% CI: 3.0-12.1] for a score based on education and occupation.Appropriately perceiving one's weight as too high was associated with different SES indicators, female sex and being actually overweight. These findings suggest means and targets for clinical and population-based interventions for weight control. Further studies should examine whether these differences in weight perception underlie differences in cognitive skills, healthy weight norms, or body size ideals. Weight perception is known to be associated with a number of factors including sex -3, race An appropriate perception of one's own weight is conducive to improved weight control behavior ,16. BettFew studies have compared the association between weight perception and different SES indicators. Previous reports indicate that the association between SES and weight perception ,5 and boIn this study, we examined the association between one's own weight perception and SES indicators in individuals randomly selected from the population in a rapidly developing country in sub-Saharan Africa, and whether this association differed based on education, occupation, and income.The Republic of Seychelles is a group of islands located approximately 1800 km east of Kenya. The national gross domestic product per capita increased, in real terms, from US$ 2927 in 1980 to US$ 5239 in 2004. The Seychelles is considered as an upper middle-income country. The majority of the population is of African descent and 90% of the total population lives on the largest island.The data in this paper come from the Seychelles Heart Study III, a population-based survey conducted in 2004 under the auspices of the Ministry of Health of the Republic of Seychelles. Detailed methods and results of the survey have been described previously and the A structured questionnaire was administered by experienced nurses to all participants through a face-to-face interview. Weight perception was assessed using the question: "Do you think your weight is: largely too high, a bit too high, good, or too low?"-2) categories were defined as follows: underweight: <18.5, normal weight: 18.5-24.9, overweight: 25-29.9, and obesity: ≥30 [Weight and height were measured using precision electronic scales and fixed stadiometers (Seca™). Body mass index , the high category included professionals and non-manual occupations with formal training , while the intermediate category included all other professional occupations. Occupation referred to the current occupation or to the most recently held occupation if the individual was currently not working for a wage. Of note, more than 80% of men and women aged 25-64 reported to currently have a job. Monthly income related to the reported occupation was trichotomized into three categories including fairly even numbers of persons .Weight perception was stratified by sex, actual weight status, and SES. A proportional Venn diagram was used to display agreement between the upper categories of the three SES indicators . The assOverall, 3.5% of the participants were underweight, 33.4% were normal weight, 35.3% were overweight, and 27.9% were obese. The age-adjusted prevalence of these categories was 3.9%, 36.0%, 35.0% and 25.1%, respectively. Among normal weight participants, 6.5% inappropriately perceived their weight as being too low. Among persons with excess weight, 54% of overweight participants and 18.8% of obese participants failed to perceive their weight as being too high. Moreover, it should be noted that even a belief that one's weight is "a bit to high" (vs. 'largely too high") may actually be somehow inappropriate among obese persons.Figure Figure Similar associations were found using occupation and income Figures and 4: pTable In multivariate analysis adjusting for age, sex, and actual weight status and the three SES indicators, only education and occupation remained significantly associated with perception of having a weight that is too high. Strong associations were also found for sex (OR 2.4 for women vs. men) and actual weight status (5.4 for obese vs. overweight). These results suggest independent effects for education and occupation, as well as for female sex and for being obese.Figure th and 6th categories, respectively. The odds of an overweight/obese individual to perceive his/her weight as too high gradually increased along the two SES scores and was 6.1 (95% CI: 3.0-12.1) (column 1) and 6.9 (95% CI: 3.4-14.1) (column 2) comparing participants with a high vs. low SES score. Again, perception of a high weight was also independently associated with being a woman (vs. men) and being obese (vs. overweight). Consistent with results in Table Table We found that reporting a high self-perceived weight, among persons who actually were overweight or obese, was more frequent in women than men, in obese than overweight persons, and in persons of high vs. low SES. The association between appropriate perception of one's own weight and SES was fairly similar for all three SES indicators when these SES indicators were considered in isolation, but the association was no longer significant for income when all three indicators were considered together. This suggests that any SES indicator is a useful marker when information is not available on the other SES indicators but that income does not add substantial information when a person's education and occupational status are known. Correspondingly, the OR for the association between weight perception and SES ranged between 2.7 and 4.3 when education, income or occupation were considered in isolation and reached 6.1 based on a score combining education and occupation and 6.9 based on a score combining these three SES indicators.Among individuals with a normal BMI, the majority had an appropriate weight perception, i.e. they perceived their weight as being 'good'. It is worth noting however, that high SES individuals more frequently overestimated their weight . This is consistent with previous reports showing that high SES persons, particularly women, tend to be less satisfied with their weight , and areObese participants perceived their weight as too high more often than overweight participants . These results are in line with previous studies showing that obese individuals are less likely to misclassify their weight status as compared to overweight individuals ,6,8. ConWe found that overweight/obese individuals of high SES were more likely to have an appropriate perception of their excess weight. The association between appropriate self-perception of weight and high SES has been previously documented ,3,5,6,9,While previous reports have shown that the SES-obesity relationship is more apparent when using education and occupation as SES indicators , there rThe finding that weight perception was more strongly associated with education and occupation vs. income may reflect differences in health literacy across educational groups . IndividOur findings provide further evidence on phenomenological mechanisms that can fuel the obesity epidemic in the population in this region, and clues to guide interventions to prevent and control overweight and obesity. At a clinical level, our data suggest that health professionals should systematically clarify their patients' beliefs related to their own weight and address the identified related misbelieves. At a population level, our findings suggest that it is important to gather information on weight perception in populations according to various dimensions in order to guide information campaigns and other culturally sensitive interventions related to a healthy weight.Strengths of this study include the population-based design and the availability of three SES indicators reflecting three main domains, education, occupation and income. Moreover, weight and height were actually measured, in contrast to a number of similar studies that have relied on self-reported values. On the other hand, the cross-sectional design of this study limits inference on the direction of the associations (i.e. whether low SES leads to poor weight perception or whether poor weight perception -possibly a marker of other poor cognitive skills- leads to poor SES outcomes). Also, as we did not have data on ideal body size, health awareness or cognitive skills (e.g. abstraction skills), we could not disentangle whether differences in appropriate weight perception corresponded to differences in cognitive skills, healthy weight awareness, or body size ideals.Appropriately perceiving one's weight as too high was strongly associated with different SES indicators, female sex and being actually overweight. Given the association between appropriate perception of one's own weight and adequate weight-related behavior ,16, our The authors declare that they have no competing interests.HA led the analysis of data and write up of the manuscript; BV and JW conducted the interviews and reviewed the manuscript; FP participated in the study design and reviewed the manuscript; PB was the PI of the survey and actively participated in data analyses and in the write up of the manuscript. All authors have read and approved the manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/467/prepub |
The clinical effectiveness of intensive lifestyle interventions in preventing or delaying diabetes in people at high risk has been established from randomised trials of structured, intensive interventions conducted in several countries over the past two decades. The challenge is to translate them into routine clinical settings. The objective of this review is to determine whether lifestyle interventions delivered to high-risk adult patients in routine clinical care settings are feasible and effective in achieving reductions in risk factors for diabetes.Data sources: MEDLINE (PubMed), EMBASE, CINAHL, The Cochrane Library, Google Scholar, and grey literature were searched for English-language articles published from January 1990 to August 2009. The reference lists of all articles collected were checked to ensure that no relevant suitable studies were missed. Study selection: We included RCTs, before/after evaluations, cohort studies with or without a control group and interrupted time series analyses of lifestyle interventions with the stated aim of diabetes risk reduction or diabetes prevention, conducted in routine clinical settings and delivered by healthcare providers such as family physicians, practice nurses, allied health personnel, or other healthcare staff associated with a health service. Outcomes of interest were weight loss, reduction in waist circumference, improvement of impaired fasting glucose or oral glucose tolerance test (OGTT) results, improvements in fat and fibre intakes, increased level of engagement in physical activity and reduction in diabetes incidence.Twelve from 41 potentially relevant studies were included in the review. Four studies were suitable for meta-analysis. A significant positive effect of the interventions on weight was reported by all study types. The meta-analysis showed that lifestyle interventions achieved weight and waist circumference reductions after one year. However, no clear effects on biochemical or clinical parameters were observed, possibly due to short follow-up periods or lack of power of the studies meta-analysed. Changes in dietary parameters or physical activity were generally not reported. Most studies assessing feasibility were supportive of implementation of lifestyle interventions in routine clinical care.Lifestyle interventions for patients at high risk of diabetes, delivered by a variety of healthcare providers in routine clinical settings, are feasible but appear to be of limited clinical benefit one year after intervention. Despite convincing evidence from structured intensive trials, this systematic review showed that translation into routine practice has less effect on diabetes risk reduction. The clinical effectiveness of intensive lifestyle interventions in preventing or delaying development of diabetes in people at high risk has been established from randomised controlled trials of structured, intensive interventions conducted over the past two decades in the USA ,2, ChinaCalls for broader implementation of lifestyle interventions for diabetes prevention in clinical settings are not uncommon in the literature -17, althTo our knowledge, no compilations of trials or reviews of replication studies as part of preventive care in routine clinical practice appear to have been reported. Accordingly, this review presents a summary of outcomes from the routine clinical context and examines the feasibility of transferring the diabetes prevention research to real-world settings. In short, the review assesses the extent that outcomes from clinical trials of lifestyle interventions into physical activity and nutrition to lower diabetes risk have been replicated in routine clinical practice.The search was confined to English language articles published between January 1990 and August 2009. Three authors separately interrogated different data sources using the same search terms (see appendix). This was supplemented with hand searches of the reference sections of other systematic reviews ,19,25-40The review focused on translational research studies where interventions were based on any of the large reference diabetes prevention RCTs mentioned above. These could be: replication studies in the form of RCTs, before/after evaluations, cohort studies with or without a control group, or interrupted time series analyses, where participants have been exposed to a lifestyle intervention of at least 3 months duration and followed up for at least 3 months. Routine clinical practice was defined as a health service setting providing patient care such as primary health clinics, hospital outpatient clinics or specialist medical centres.Interventions were classified as single , or combined nutrition and/or physical activity programs (structured or unstructured) whether or not they included medication. Structured intervention components were defined as those in which participants received a standard set of sessions with instructions on specific dietary and/or physical activity requirements and goals. In unstructured interventions participants were given generic advice on healthy living without specific goals other than improving diet or physical activity in relation to baseline. The comparison group might be 'no intervention group' or an 'alternative intervention' (single or combined). Prevention programs delivering diabetes education materials only were excluded. Likewise, medication-only studies were excluded. Only programs conducted in routine health services, delivered on-site or in associated facilities, with outcomes measured in healthcare settings by general medical practitioners, specialist physicians, practice nurses, dietitians, physiotherapists, allied health professionals, community health staff, or research staff attached to the health service, were included in this review. Interventions either had to be replications or modification of all or some components of the US Diabetes Prevention Program [DPP] or FinniParticipants were adult men or women with any degree of impaired glucose regulation (impaired fasting glucose or impaired glucose tolerance) or with normal glycaemia but at risk of diabetes as determined by risk factors such as obesity or family history. They may have been recruited from the primary or other healthcare patient clientele or from the general population but had to receive the intervention through routine healthcare services. Participants' risk of diabetes may have been determined by a diabetes risk score, either measured or from self-report, and may have had accompanying blood glucose tests to either identify impaired glucose regulation or exclude diabetes before receiving the intervention. Studies including patients with diagnosed diabetes were included in this review only if they were a replication of the reference trials and whose outcomes were reported separately from participants without diabetes.Studies were included if they reported at least one of the following main outcome measures of interest:• Improvement in objectively measured risk factors such as weight loss or waist circumference reduction.• Metabolic outcomes indicative of diabetes risk reduction • Self-reported or objectively measured behavioural outcomes such as increased physical activity (minutes per day or METS per hour), increased fibre consumption (grams per day or gm per KJ), or reduction of fat intake .The secondary outcome examined was:• Prevention of diabetes .To assess the potential for bias, and given the heterogeneity of studies included in this review, a generalisability and bias assessment tool covering elements of various checklists and resources from the literature was specifically designed. Items examined included participant recruitment source, selection criteria, treatment allocation, blindness of outcome assessment, simultaneous collection of data for intervention and control groups, measurement error, subgroup analysis and discussion of study limitations (tool available from the authors on request). Reference tools used for this design were STROBE, COCHRANE Collaboration, CLEAR NPT, EQUATOR, PRISMA, TREND and MOOSE -46. One Study quality was assessed and graded on the following criteria: (1) evidence of assessment of risk for diabetes at enrolment; (2) explicit eligibility and exclusion criteria; (3) reported participation rate of at least 50% of eligible people; (4) follow-up assessment rates of ≥ 65% of program participants by study conclusion or follow-up; (5) evidence of measurable or explicit outcome assessment; (6) appropriate statistical methods, including adequate control for confounders (in non-RCTs); (7) explicit intervention components; (8) conclusions supported by findings. A numeric score giving equal weight to each of the above criteria was used to determine quality. The maximum possible score was thus 8, indicating highest quality.The denominator for the effect sizes was the number of subjects in whom the outcome had been assessed. Study results were categorised as positive , negative , or inconclusive (showed no difference but lacked sufficient power to detect a difference). Given the heterogeneity of designs, length of follow-up and outcome measurements of the available studies, pooling of selected results for a meta-analysis was feasible only for four RCTs reporting 12-month follow-up results -50. The Sensitivity analysis by study quality was not deemed necessary as all four studies finally selected for meta-analysis had a quality score of 7 or 8 out of the possible 8 maximum score. Our search did not identify unpublished replication studies of diabetes prevention in routine clinical practice. Accordingly, we expected findings not to be significantly affected by publication bias.Our searches identified 41 potentially eligible diabetes prevention studies of lifestyle interventions in clinical practice that included various combinations of diet and/or exercise for diabetes risk reduction or diabetes prevention. Of these, 18 studies were excluded because: their replications of lifestyle interventions were conducted in non-routine clinical settings -59, or iDifferences in presentation of results , 3 before-after designs without a control group and two before-after designs with a control group , fasting plasma glucose (9/12) waist circumference (7/12), and 2-hour OGTT 3/12) . Differential withdrawal rates were reported in a further three studies, where a larger proportion of drop-outs were observed: in participants at highest baseline risk ; in thosThe meta-analysis showed that the pooled weight loss in the intervention group from the four RCTs yielded a weight loss of 1.82 Kg at one year Figure . Exceptiet al. trial which reported half the participants meeting the fibre goal and achieving the total fat intake goal and a third achieving the saturated fat goal [The one-year improvements in fasting plasma glucose were similar to the DPP across several studies but were too small to be clinically important; and reductions of diabetes incidence in the two studies reporting them at 12 months follow-up ,83 were fat goal .Nine of the 12 studies explored whether translation of the reference trials into clinical care was feasible. Eight concluded that modification of the original trial approaches for adaptation to real life practice made the lifestyle interventions feasible, affordable or replicable in clinical care settings despite barriers to implementation -84,86,87Seven trials which randomised a total of 4,905 participants to lifestyle intervention or control were identified. The shortest follow-up period was 4 months and the longest follow-up period was six years. Four of these, randomising a total of 1,129 to intervention or control, reported selected outcomes in comparable units at one year -50,87. TThe systematic review of RCT results at 12-month follow-up showed: mean weight reduction was 1.82 Kg greater in treatment than control groups which was statistically significant (95% CI:-2.7 to -0.99 Kg); pooled mean waist measurement reductions in treatment exceeded control groups by 4.6 cm, and this was also significant (95% CI:-5.8 to -3.4 cm); fasting plasma glucose reduction was 0.19 mmol/l greater in treatment than controls but non-significant (95% CI: -0.44 to +0.06 mmol/l); and a non-significant greater increase in 2-hour oral glucose tolerance test result of 0.04 mmol/l (95%CI: -0.49 to +0.42 mmol/l). From the above, it is apparent that the interventions can achieve significant weight and waist measurement reductions at one year but do not significantly change the main metabolic indicators of diabetes risk such as FPG or OGTT.Four of the 12 studies achieved the greatest weight loss, i.e. 5 Kg or more at 12 months. As only two of these successful studies had optimal quality scores ,80, we fIt is apparent that clinical services are making concerted efforts to translate lifestyle intervention trials into routine practice in several countries, whether as pilot studies or as full-scale interventions. All studies included in this review recruited individuals at high-risk of diabetes from IGT, obesity, metabolic syndrome, a combination of these, or based on other standard inclusion criteria. All interventions combined dietary and physical activity and attempted replication of previously published studies. The wide range of intervention intensities, durations of follow-up and outcome assessments reflected the availability of service time, staff skills, levels of reimbursement for prevention services, and limited funding and resources for translation research within the health systems.Results from the lifestyle intervention studies that relied on weight change show promise in achieving some degree of risk reduction. The weight reduction in intervention subjects exceeded controls by 1.8 kg, which was less than that found in the reference U.S. DPP 5.6 Kg) or the Finnish DPS (4.2 Kg). Results from studies that relied on changes in fasting plasma glucose or 2-hr plasma glucose as a measure of success, were less convincing. However, similarly small changes in FPG after the intervention were also observed in the reference trials is develThis review also examined the feasibility of implementation of interventions as an integral part of routine clinical care, as this can inform policy on dissemination of diabetes prevention programs or associated subsidies within healthcare systems. To this end, we examined authors' conclusions on whether the given intervention could sustainably be incorporated into usual care provided, for example, without the need for excessive time beyond usual consultation, additional funding or contracting of external staff.Finally, while the outcomes of the two US studies, where participation incurred a fee, probably are the most representative of real life in USA, such market-based rationing of diabetes prevention might not be acceptable in other health systems, and certainly would not reach those most in need of such interventions, including low socio-economic groups and people with higher prevalence of risk factors for diabetes.To our knowledge, this is the first attempt to comprehensively compile feasibility and effectiveness of translation of diabetes prevention trials specifically for routine clinical settings.We used a purpose-built comprehensive quality scoring system based on individual components of relevance from checklists widely used by others in quality assessment of the literature. Our quality criteria allowed for the inclusion of several study types to maximise the chances of identifying and assessing relevant diabetes prevention programs. The search was extensive and individual study authors were contacted to either confirm that their study was conducted under routine clinical care or to exclude any translation study conducted in research settings or under simulated clinical care. Meta-analytic techniques were used when feasible.Despite the good quality of papers covered in this review, the total number of studies finally included was small; some were exploratory (3 pilots) and many of them had short follow-ups and only modest sample sizes which essentially reflect the financial and time restrictions of real-life interventions in routine clinical practice. We included studies with intervention and follow-up durations of at least 3 months. These are not unusual in routine practice, as modifications to duration and intensity of the strict approaches in the reference trials are common in the replication literature. While longer interventions and follow-up times are ideal, in real-world situations longer studies inevitably are affected by sample attrition and attendant generalisability issues. We wanted to include some measurement of short-term impact and avoid attrition bias and selection bias in our assessment of what is being evaluated in routine practice and therefore we allowed for feasibility and pilot studies to be incorporated.Analyses from before-and-after studies often did not report on adjustment for confounders. More importantly, the reporting of outcomes of interest was often incomplete or in disparate units of measurement precluding inclusion in the meta-analysis. However, the overall good quality of these studies enabled their inclusion in the broader systematic review.Many weight-loss-only programs and other lifestyle interventions for reduction of cardiovascular disease risk were excluded as they did not specifically mention replication of the diabetes prevention trials. However, we acknowledge that results from these may also be applicable to diabetes risk reduction, and while examples of reviews of these are available in the literature, their focus is beyond the scope of our review.Despite convincing evidence from structured intensive randomised controlled trials in research settings, this systematic review shows that translation into routine practice has somewhat less of an impact on diabetes risk reduction. Given the heterogeneity and limitations of the studies included in this review, it is also not possible to determine conclusively whether the type of clinical setting, the frequency or intensity of interventions, or the modality of the intervention are critical success factors for translation of diabetes prevention programs in routine clinical care. Nor was it possible to assess the separate contributions of individual lifestyle change components to diabetes risk reduction. Accordingly, we cannot yet make specific recommendations on the most effective features of these targeted lifestyle interventions.However, based on our findings, the direction of the effects on the four most commonly reported outcomes are encouraging; and the consensus on feasibility of their modification as part of routine care without excessive cost suggest that it is still worth promoting the translation of modified, group-based lifestyle interventions, and conducting more rigorous evaluations in these settings. The establishment of a register of translation projects using consistent, measurable outcomes would add more certainty to the effectiveness of routine practice interventions, and when more studies with larger sample sizes and data on intermediate end-points become available they could be included in a more comprehensive meta-analysis.• Articles were identified through searches in MEDLINE, PubMED, The Cochrane Library, Google Scholar, CINAHL and EMBASE.• Internet searches and searches of the grey literature were conducted to identify non peer-reviewed internal reports from government and health services websites and non-government sources.• Hand searches of reference lists from related articles found whether or not they were eligible for inclusion in this review• Hard copy Australian government publications and unpublished internal reports from key informants for non-indexed publications.• Authors of reviewed articles were contacted by MC-M if it was unclear from their papers whether the intervention was conducted in a research or community-based or a routine clinical setting. However, due to resource constraints, no attempt was made to contact the investigators whose papers did not report all measured outcomes.Diabetes, Pre-diabetes, Type 2 diabetes, Impaired glucose tolerance OR glucose intolerance, Lifestyle intervention OR lifestyle program OR strategy, Physical activity OR Exercise OR Resistance Training, Healthy eating OR diet OR dietary modification OR weight loss, Behavioural modification, AND , AND .The authors declare that they have no competing interests.MC-M, conceived the study, designed the quality and bias assessment tools, conducted database searches and quality assessments, wrote the first draft of the manuscript and incorporated changes suggested by others. MC-M coordinated database searches by LR and AB; LR, SM and PTE conducted bias assessments; AB and LR assisted in the design of the study; MC-M and SM performed the statistical analyses. SM, AB and LR helped to comment on and refined the manuscript. All authors have read and approved the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2458/10/653/prepub |
The trichlorophenyl ring is nearly perpendicular to the triazole plane [dihedral angle 80.56 (8)°], whereas the two hydroxyphenyl rings are approximately coplanar with the triazole ring [dihedral angles of 2.79 (12) and 8.00 (14)°]. Intramolecular O—H⋯N hydrogen bonding is observed between the hydroxyphenyl and triazole rings.The title compound, C Å b = 12.021 (2) Å c = 12.014 (2) Å β = 104.99 (3)°V = 1998.7 (7) Å3 Z = 4 Kα radiationMo −1 μ = 0.48 mmT = 293 (2) K 0.20 × 0.20 × 0.18 mm Rigaku SCXmini diffractometerCrystalClear; Rigaku, 2005T min = 0.907, T max = 0.915Absorption correction: multi-scan (16254 measured reflections3501 independent reflectionsI > 2σ(I)3052 reflections with R int = 0.047 R[F 2 > 2σ(F 2)] = 0.044 wR(F 2) = 0.104 S = 1.11 3501 reflections261 parametersH atoms treated by a mixture of independent and constrained refinementmax = 0.35 e Å−3 Δρmin = −0.35 e Å−3 Δρ CrystalClear used to solve structure: SHELXTL/PC (Sheldrick, 2008SHELXTL/PC; molecular graphics: SHELXTL/PC; software used to prepare material for publication: SHELXTL/PC.Data collection: 10.1107/S1600536808001505/xu2398sup1.cif Crystal structure: contains datablocks I, global. DOI: 10.1107/S1600536808001505/xu2398Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |
Hyperproinsulinaemia is associated with obesity and is a risk factor for Type 2 diabetes. We explored the dynamics of proinsulin and insulin and postprandial effects on glucose and lipids in subjects who had undergone gastric bypass (GBP) surgery compared with morbidly obese (MO) subjects and normal weight control subjects (NW).sd, 34.8±6.2kg/m2] who had undergone GBP surgery, 10 MO subjects (BMI 44±3.1kg/m2) and 12 NW control subjects (BMI 23.2±2.4kg/m2). After an overnight fast, a standard meal (2400 kJ) was ingested and glucose, proinsulin, insulin free fatty acids and triglycerides were determined up to 180 min.Subjects free from diabetes were recruited: 10 previously MO subjects [body mass index (BMI)±P < 0.05). Postprandial AUC for glucose was similar in the three groups and AUC for proinsulin was high in MO, intermediate in the GBP group and lowest in NW control subjects (P for trend = 0.020). Postprandial proinsulin at 60 min was similar in the GBP group and MO subjects and twofold higher than in NW control subjects. Postprandial proinsulin at 180 min was normal in the GBP group, but fivefold increased in MO subjects (P = 0.008). Insulin increased rapidly at 30 min in the GBP group and was normal at 90 min, whereas insulin was still increased at 90–180 min in the MO subjects (P < 0.001).Fasting proinsulin was similar in the GBP group and NW control subjects, but threefold increased in MO subjects (MO subjects, free from diabetes, have elevated proinsulin concentrations in the fasting as well as the postprandial phase. After GBP surgery markedly lower fasting and postprandial proinsulin concentrations were observed, although BMI was higher compared with NW control subjects. Obesity is associated with insulin resistance , fastingPatients were recruited from the out-patient clinic for obesity care, University Hospital, Uppsala, Sweden, where preassessments before and long-term check-up visits of patients after surgery were performed. Control subjects were recruited locally. All subjects were White. Exclusion criteria for all three groups were established diabetes or use of glucose-lowering agents, as well as use of ACE-inhibitors, angiotensin II receptor blockers or β-blockers, to avoid possible influence on glucose, proinsulin and insulin status.Three groups of subjects were compared2 (mean ±sd), who had undergone GBP surgery 1–5 years (mean 4.1 years) before study. The mean presurgery BMI was 45.3 ± 7.6 kg/m2. The mean absolute weight loss was 31.8 kg (range 16–47 kg). The mean fall in BMI after surgery was 10.5 kg/m2 (23%).Ten surgically treated patients considered weight stable after weight loss due to GBP surgery, with body mass index (BMI) 34.8 ± 6.2 kg/m2. These patients had refused surgery or were on the waiting list for surgery after preassessment. Their mean BMI was similar to the presurgery BMI in the group of subjects who underwent GBP surgery (P for difference = 0.59).Ten surgically untreated patients with MO, with BMI 44.0 ± 3.1 kg/m2. Age and sex distribution were similar in the three groups , consisting of: carbohydrates 68.2 g, fat 22.3 g, proteins 24.6 g and fibre 6.4 g.After an overnight fast for 17 h the standardized test meal was ingested at 13.00 h in the obesity out-patient clinic, allowing supervision of food intake, which was finished within 15 min. Blood samples were collected, centrifuged and freshly frozen immediately before the test meal and thereafter at 30, 60, 90, 120 and 180 min after ingestion. Data were collected on preprinted Case Report Forms.2) was calculated. All patients completed a standardized questionnaire, including questions concerning their health status and smoking habits.Weight (kg) and height (m) were measured on standardized, calibrated scales and BMI on a Bio-Rad Coda automated EIA analyser . Concentrations of serum FFA were determined using the Wako NEFA C-test kit and serum TG by a lipase and quinoneimine dye method (Konelab) on a Konelab analyser . At the Department of Medical Sciences, University Hospital in Uppsala, plasma glucose concentrations were determined using a routine glucose oxidase technique .All plasma samples before and after the meal for all subjects were analysed as one batch, thus avoiding drift of determinations.1c, aspartate aminotransferase, alanine aminotransferase, creatinine, sodium, potassium, haemoglobin and white cell count were analysed using routine methods at the Department of Clinical Chemistry, University Hospital, Uppsala.Basal routine tests for concentrations of HbAa priori. Results are given as arithmetic mean with sd and sem. anova and Students t-test were used for group comparisons. Tests were two-tailed and a P-value < 0.05 was considered significant. Test meal data are given as absolute concentrations in the GBP group and 0.5 mmol/l higher in the MO group compared with the NW control subjects. HbA1c was 0.3% higher in both the GBP and MO groups compared with NW control subjects (P < 0.05 for both).Clinical characteristics of the study subjects are presented in Fasting proinsulin and insulin did not differ between the GBP and NW control subjects, whereas proinsulin and insulin concentrations were significantly higher in the MO group compared with the GBP and NW control subjects, respectively. The mean fasting FFA value in the MO and GBP groups was not significantly different. TGs were higher in MO group, as expected.Absolute concentrations of glucose, proinsulin, insulin, FFA and TG are shown in sd) for glucose (mmol × min) did not differ between the MO group (270 ± 92), the GBP group (310 ± 110) and NW control subjects (250 ± 130) (P for trend = 0.27).The AUC (mean ±Data for changes in glucose are presented in sd) for proinsulin (pmol × min) was largest in the MO group (7600 ± 5300), intermediate in the GBP group (5300 ± 2700) and lowest in NW control subjects (3000 ± 1600) (P for trend = 0.02). Data for changes in proinsulin are shown in The AUC (mean ±sd) for insulin (pmol × min) was highest in the MO group (41 000 ± 9900), intermediate in the GBP group (32 000 ± 16 500) and lowest in NW control subjects (18 000 ± 8300) (P for trend < 0.001). Data for changes in insulin are presented in The AUC (mean ±P = 0.48 and 0.39).The proinsulin to insulin ratio decreased identically in all three groups during the first 30 min. The mean ratio decreased from approximately 0.32–0.10, with no significant difference between groups (sd) for FFA (mmol × min) did not differ between the MO group (84 ± 31), the GBP group (68 ± 24) and NW control subjects (63 ± 54) (P for trend = 0.44).The AUC (mean ±P = 0.03–0.007) at each postprandial time point except at 180 min in the MO group compared with the GBP group and NW control subjects. Prior to 180 min, the FFA values were all lower in the GBP group compared with the NW control subjects and the MO group.FFA absolute concentrations, shown in No significant differences were observed regarding postprandial changes in circulating FFA and concentrations between the three groups, except at 180 min, where FFA were higher in the GBP group .sd) for TG (mmol × min) was greatest in the MO group (32 ± 29), intermediate in the GBP group (16 ± 22) and lowest in NW control subjects (8 ± 15), although the differences did not reach statistical significance (P for trend = 0.07). TG absolute concentrations, presented in P = 0.06–0.003) at each postprandial time point in the MO group compared with the GBP group and NW control subjects. No significant differences were observed regarding postprandial changes in circulating TG and concentrations between the three groups, except at 180 min, where TG were higher in the MO group and with AUC for insulin , but not with AUC for glucose , AUC for FFA or AUC for TG .BMI correlated with AUC for proinsulin and T2DM . FastingThe relative hypoinsulinaemia in the late phase of the test in the GBP group followed the rapid decrease in both glucose and insulin after peak concentrations in the early phase, and coincided with the time point when symptoms of the so-called dumping syndrome may occur . The mecIn summary, GBP surgery results in dramatically improved insulin sensitivity and rapid meal-stimulated secretions of proinsulin and insulin with sustained effects on glucose and lipid metabolism. Our results suggest that future studies should determine whether proinsulin is a marker for diabetes risk before and after GBP surgery. It might be speculated that the proinsulin status can be used as an indication for bariatric surgery. To answer such questions, further research on proinsulin and insulin as markers for T2DM and CHD in long-term follow-up after GBP surgery is warranted.None to declare. |
Africa's progress depends on her capacity to generate, adapt, and use scientific knowledge to meet regional health and development needs. Yet, Africa's higher education institutions that are mandated to foster this capacity lack adequate resources to generate and apply knowledge, raising the need for innovative approaches to enhance research capacity. In this paper, we describe a newly-developed program to support PhD research in health and population sciences at African universities, the African Doctoral Dissertation Research Fellowship (ADDRF) Program. We also share our experiences implementing the program. As health research capacity-strengthening in Africa continues to attract attention and as the need for such programs to be African-led is emphasized, our experiences in developing and implementing the ADDRF offer invaluable lessons to other institutions undertaking similar initiatives. Several challenges face university education in sub-Saharan Africa. Unprecedented growth in student enrolment, rising from 337,000 in 1980 to an estimated 4,000,000 in 2004 and the expansion of training programs, especially at the undergraduate level, have occurred at a time when per capita funding for universities is being reduced [Students in graduate programs on the continent lack role models and mentors, strong academic and research networks, opportunities to participate in international conferences, and exposure to strong research environments. Further, many graduate students on the continent lack funding for their studies and are forced to work part-time, consequently taking many years to graduate. The declining quality of products from graduate programs in Africa is already telling as evidenced, among other things, by frequent complaints by employers regarding the competence and ability of the graduates . To a veThe great need facing graduate-level training in Africa creates an enormous opportunity for innovative interventions. Indeed, several international agencies and funding bodies now provide a wide range of fellowships to support African PhD students. For example, the International Development Research Centre (IDRC) in Canada runs the Southern Junior Researchers Awards program which primarily supports PhD studies in developing countries, with a focus on sub-Saharan Africa . The UK In this paper, we provide an overview of one response to the challenges facing graduate-level training in Africa: the African Doctoral Dissertation Research Fellowship (ADDRF) Program, a program funded under IDRC's Southern Junior Researchers Awards program. The aims of the program are to facilitate rigorous research addressing health issues in Africa, enhance the quality of doctoral dissertation research, and equip doctoral students with essential research skills. Initiated in 2008 with funding from the IDRC and the Ford Foundation, the ADDRF is now in its third year of operation. As capacity-strengthening for health research continues to receive attention in Africa, our experiences as implementers of the ADDRF offer funders and research capacity-strengthening institutions something to learn from.The African Doctoral Dissertation Research Fellowships are awarded to advanced doctoral students who are citizens or permanent residents of a sub-Saharan African country and are within two years of completing their doctoral thesis at an African university. The fellowships target students whose research shows great promise of making significant contributions to governance, equity, sexuality, health or population-related issues in the region. In particular, the fellowship program aims to bridge the knowledge gap in health systems research in sub-Saharan Africa. The program's general objectives are to facilitate more rigorous engagement of doctoral students in research; to provide the Fellows an opportunity for timely completion of their doctoral training; and to strengthen doctoral students' research skills.Each fellowship includes a modest monthly stipend, funds to support data collection and analyses, as well as support to attend a regional or international conference. Anecdotal reports indicate that the dissertation review process in many African universities is long, laborious, and often delays graduation by years. Thus, where needed, candidates' home departments are also provided with modest facilitation grants to enable them provide effective and timely supervision to the grant recipients and to facilitate internal and external reviews of students' completed dissertations. As part of the award, all grant recipients participate in two training workshops. The program has managed to award more fellowships than budgeted because students are not always funded at the full amount. Consequently, the estimated total cost per student taking into account the fellowship award, institutional support, workshop and other administrative costs is US $25,000.The training workshops are intended to introduce students to research methods and ethics, literature retrieval, reference management, scientific writing, proposal development, and communication of research. The workshops also serve as a networking opportunity for cohorts of Fellows which is hoped to strengthen future collaborations across national boundaries. The content for these workshops is largely informed by areas of training needs highlighted by the Fellows.To qualify for the award, applicants must have completed all pre-dissertation requirements and show evidence of being able to graduate within 24 months of the start of the fellowship. As part of the application process, applicants submit a scientific proposal detailing the research question(s), policy-relevance, study design, and a statement of future research interests. They also provide a detailed time-frame for completing their dissertation which is endorsed by the head of department or the chair of the dissertation committee. Applicants also provide evidence that their research topic has been approved by their doctoral committee, and that the study has received ethical clearance. The fellowship is awarded only once to a doctoral student.Fellowship funds are disbursed in three installments. However, to reduce administrative costs and ensure greater flexibility for successful candidates to apply the funds in ways that enhance their work, a substantial proportion of the grant amount is paid at the outset with the rest tied to meeting specific milestones. The final payout is expected to be released upon approval of the dissertation by the department.The ADDRF program is managed by the African Population and Health Research Centre (APHRC) based in Nairobi, Kenya. The ADDRF team works closely with other departments and staff at the Center. These include the finance department (for administration of the awards), logistics staff (for organization of the workshops and trainings), and researchers at the Center who assist with the review process and serve as mentors to Fellows or applicants whose proposals are not funded, but show great promise.For the first two rounds of application reviews, applications were evaluated on the following criteria (maximum score in parentheses): candidate's scientific background and potential for development of a strong research career (20%); scientific merit of the proposed research project including originality of research question; clear study design including a description of sampling methods and considerations, tools for data collection, data management and quality assurance; demonstrated knowledge of relevant and current literature; detailed analysis plan, etc. (40%); research environment including departmental commitment to facilitate timely completion of the dissertation (20%); well-elaborated statement on the policy relevance of the research (10%); and budget summary and justification, including clear plan to complete the dissertation within 24 months (10%). For the third round, applications were evaluated on three criteria: the candidate's scientific background and potential for development of a strong research career (20%); the scientific merit of the proposed research project (60%); and the research training environment (20%).Narrowing the large number of proposals received to the small proportion that gets funded requires a rigorous review process. To do this, we engage reviewers who are reputable academics with extensive experience in doctoral training and/or research on governance, equity, health and population-related issues in Africa. Before applications are sent to reviewers, a preliminary assessment is undertaken to ensure completeness and adherence both to the application guidelines and the spirit of the fellowship.Each proposal is evaluated by three reviewers, at least one of whom must serve on the selection committee. One of the reviewers must also have substantive knowledge of the applicant's disciplinary background. Each reviewer scores a given proposal and makes written recommendations as to whether the proposal should be funded, discussed, or rejected.The selection committee, comprising some of the reviewers, then meets face-to-face to review the scores and recommendations and makes a final agreement on which proposals should be funded. Generally, where all three reviewers are in agreement to reject a proposal, the proposal is rejected with little discussion. Depending on the number of proposals in which the committee is in agreement to fund, proposals are then ranked. While emphasizing the quality of the proposed research project and suitability of the candidate, the selection committee takes into consideration the country of origin and gender of the applicants to ensure balanced regional (Anglophone and Francophone) and gender representation of grantees. However, grants are awarded nonetheless to other qualified applicants if no suitable applicant with the expected regional or gender attributes is found.In its first year (2008), the fellowship program supported 20 doctoral students from eight African countries studying health-issues or matters related to sexuality. Two of these fellowships were supported by the Ford Foundation. In its second year, an addition 25 students (three of whom are supported by the Ford Foundation) representing 13 sub-Saharan African countries and 16 African universities have received support. In 2010, 19 students (three of whom are supported by the Ford Foundation) were awarded fellowships.Administratively, our initial experience brought to light the importance of establishing a system to facilitate the review process. In the first instance, we simply requested students to submit key documents . As a result, applications were received in different formats and did not always include key supporting documents, creating substantial challenges for reviewers. For the second call, we required that all applications be submitted using a pre-defined template to ensure uniformity and completeness. Although this alleviated some of the challenges, the template needed further refinement to incorporate information on other sources of funding available to the applicant, at what stage the study is, institutional capacity, and budget justification. These refinements were implemented for the third round of applications.Maintaining regional balance has been a critical element of the ADDRF program. However, our experiences show that the vast majority of applicants have been from Anglophone Africa and in particular, from South Africa, Nigeria, Kenya, and Uganda. In the first call for applications, we received a relatively large number of applications from Cameroon (15), which though bilingual (Anglo- and Francophone), has primarily had Francophone applicants. However, none of the applications from Francophone Africa were successful in the first round. Reflecting back, several possible reasons may have accounted for the low success of French-speaking applicants: First, the fellowship announcement was in English, which may have reduced coverage and reach in Francophone Africa. Second, although applicants could send applications in French, we did not state this clearly in the application form. Consequently, majority of French-speaking candidates submitted English translations that were often poorly prepared and written, which invariably reduced their chances of selection. Having noted this, the calls for second and third rounds of applications were issued in both English and French and applications were invited in both languages. While this has led to increased staffing demands because a bilingual person has to assist with the correspondence and translation of documents, it has resulted in a large increase in the number of French-speaking applicants as well as in the selection of five of these applicants for funding in the second round and two in the third. Our efforts to effectively reach Francophone African scholars, however, have also raised the need to ensure that the training workshops cater appropriately for a linguistically-diverse audience. Due to financial constraints, we cannot hold separate workshops for French and English speakers; thus, despite our best efforts to increase fellowship access to Francophone African and our having bilingual facilitators in the training workshops, those who benefit from the full program of activities are those who have a good working knowledge of English. Expansion to Lusophone African countries is also a high priority for the ADDRF program. However, budgetary, as well as staffing currently prevent us from accepting applications written in Portuguese.A strong institutional base that fosters scholarship and research is critical for training and retaining the next generation of researchers and academics. Our experience suggests that efforts to build research capacity in African universities need to also specifically target graduate-level research supervisors, perhaps through mentorship or faculty development initiatives. Judging by the quality of many of the proposals we received, there is an apparent lack of strong supervision among majority of doctoral candidates, demonstrated, for instance, in significant flaws in the methods section of many proposals, poor writing skills, reliance on dated references, and in the poor conceptual capacity of the students. Moving forward with the ADDRF, we are keen to establish a mechanism to better assess the research environment . One suggestion is to have the heads of departments provide details on available infrastructure and resources at the university. However, the bureaucratic processes at many universities are likely to hinder timely provision of this information. In the third call, we required all students to submit their primary supervisor's curriculum vitae. Further, we are exploring the possibility of inviting Fellows' supervisors to the training workshops for sessions on effective supervision of graduate students.Sound financial management is key to the program's sustainability. As such, we must ensure close follow-up of fund use by Fellows. Further, inculcating budgeting and accounting skills is an integral part of training students in research management thus, we require rigorous reporting and accounting for funds disbursed to students. While receiving the first progress and financial reports from the first cohort , we realized that many were unfamiliar with reporting requirements. Progress reports ranged from scanty to overly detailed narratives while financial reports lacked the necessary support upon which further disbursement was contingent. This led us to develop templates for both progress and financial reports that would allow Fellows to include all the necessary details while simplifying the process for them. The progress report template, therefore, captures details on the progress of Fellows' work, timeline to completion, challenges faced (if any), any conferences attended or papers published, and expected date of graduation. This also allows us monitor more closely the progress of the Fellows, not just in their current research, but also in the development of their career as researchers. The financial reporting template has simplified the financial reporting for the Fellows and made it easier for us, administratively, to expedite the disbursement process. Fellows also receive training on reporting during their first workshop.The fellowship program aims to address existing knowledge gaps in health systems research in sub-Saharan Africa. Ideally, funded studies should demonstrate clear linkages to relevant national policies and strategies and show great promise of making substantive contribution to strengthening health systems in Africa or should address cutting-edge issues in the field of sexuality (for Ford Foundation-funded applications). The fellowship calls specify that dissertation research may address any of the following issues: health sector analysis; health management and organization; disease burden; health care financing mechanisms ; quality of care; human resources for health; program evaluation; health equity; research to practice; information, education and communication; health policies processes ; and health information systems, among others. While the need and demand for fellowships targeting health issues, broadly defined, is great, there is good reason to narrow the scope of the program specifically to research on health systems. This is particularly important since one of our ultimate goals is to facilitate substantive contributions, by African scholars, to strengthening health systems in Africa.not at all useful to very useful. Thirty-five percent (n = 6) and 65% (n = 11) rated the overall workshop as useful and very useful, respectively. Our own self-evaluation has also proved helpful. For example, during the initial training workshop, we noted that many students were not only unfamiliar with reference management software, but the cost of such software was also prohibitive. Subsequently, we approached one of the software developers and negotiated a discounted bulk purchase for Fellows. In addition, we included a training session on the software.As a new program, we actively request feedback on processes and program activities. For example, during the application review committee meeting, all reviewers have the opportunity to provide feedback on ways to improve the review process. Some of the changes to the application forms, for example, have been based on this feedback. In addition, following each training workshop, Fellows are requested to complete an evaluation form rating different aspects of the workshop . For example, in the scientific writing workshop organized for the first cohort of students, participants were asked to rate the usefulness of each workshop session on a 4-point Likert-type scale ranging from Underperformance of many tertiary institutions in Africa following economic and political crisis from the 1970's to 1990's led to widespread withdrawal of funding for tertiary education by many international agencies and funders. Further, structural adjustment programs forced many African governments to reduce investments in tertiary education . However"The ADDRF came at a critical point in my life as a doctoral student. I did not know how or who was going to help me meet most of the costs during my last two years of study as I was sponsoring my own studies. I tried to get part-time work to assist me pay for the required fees, accommodation costs, and most importantly, research as well as most of the costs needed for a propitious environment for academic engagement. But when the APHRC offered me the fellowship, it was like manna from heaven. And within the stipulated time, I was able to concentrate on my studies and beat the deadline by a good margin." Overall, fellows, reviewers, and program staff have indicated great satisfaction with this program. In one recipient's own words:"When I was selected to be part of the first set of ADDRF fellows, little did I know that it was the beginning of great things for my career. Through the fellowship grant, I was able purchase a laptop which was quite useful for my thesis writing... attended two workshops... the Population Association of America (PAA) conference in USA and the International Conference on Urban Health (ICUH) in Kenya where I presented some of the findings from my study. Attending these conferences gave me the opportunity of meeting and interacting with some scholars whose work I have read in learned journals." The most critical outcome of the program will be its long-term impact in enhancing high-quality research outputs. With the monies currently available to support the program, the fellowship is expected to support 65 doctoral dissertations from African universities by 2012. Since Fellows are expected to publish at least one peer-reviewed article from their research within 36 months of receiving the award, we anticipate significant contributions to the body of knowledge in health, population, and sexuality research. Currently, five Fellows out of the 20 funded in the first round and two Fellows from the 25 funded in the second round have successfully defended their dissertations. Altogether, the first cohort of Fellows have given over 40 oral and poster presentations at regional and international conferences, and have submitted or published at least 15 papers in peer-reviewed journals since 2008. Further evidence of the long-term impact will include the proportion of dissertations completed within 24 months of receiving the awards, the number of manuscripts from the dissertations that are published in peer-reviewed journals and the first destination of grantees upon graduation (i.e. field and geographic location of their job placement). These indicators will be monitored to determine the ultimate value of the fellowship program. For us, then, future challenges include how to attribute outcomes to the fellowship program, maintaining long-term contact with Fellows after they graduate, and ensuring that they remain active in research and teaching.The authors declare that they have no competing interests.All authors are involved in coordinating the ADDRF program. CWK, COI, and ACE contributed to the grant proposals submitted to IDRC and the Ford Foundation for funding to support the ADDRF program. CWK prepared the journal manuscript. COI, SWW, and ACE reviewed and edited the manuscript. All authors read and approved the final manuscript. |
In the crystal, molecules interact through intermolecular C—H⋯N hydrogen bonds, forming chains parallel to the b axis. These chains are further linked into a three-dimensional network by C—H⋯π stacking interactionsIn the title compound, C For a review of the antimicrobial activity of bifonazole and its therapeutic use in superficial mycoses, see: Lackner and Clissold 1989. 22H18N2 CM r = 310.40 Monoclinic, a = 7.9737 (7) Å b = 6.2591 (6) Å c = 33.265 (3) Å β = 93.805 (8)°V = 1656.5 (3) Å3 Z = 4 Kα radiationCu −1 μ = 0.56 mmT = 150 K 0.20 × 0.20 × 0.04 mm Rigaku RAPID II diffractometerSCALEPACK; Otwinowski & Minor, 1997T min = 0.860, T max = 0.979Absorption correction: multi-scan (19391 measured reflections3064 independent reflectionsI > 2σ(I)2801 reflections with R int = 0.030 R[F 2 > 2σ(F 2)] = 0.041 wR(F 2) = 0.107 S = 1.06 3064 reflections218 parametersH-atom parameters constrainedmax = 0.19 e Å−3 Δρmin = −0.20 e Å−3 Δρ CrystalClear used to solve structure: SIR2004 (Burla et al., 2005SHELXL97 (Sheldrick, 2008ORTEPII (Johnson, 1976PLATON (Spek, 2009SHELXL97 and local programs.Data collection: 10.1107/S1600536810037876/rz2487sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536810037876/rz2487Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials: |