Datasets:

hatakeyama-llm-team

/

PMC

like 0

Follow

Team Hatakeyama 25

Interleukin-5 (IL-5) has been shown to be a selective eosinophilgrowth and differentiation factor. In the present study, the effectof recombinant human IL-5 on human eosinophil sulfidopeptideleukotriene production was investigated. IL-5 did not affectleukotriene synthesis in unstimulated eosinophils. However, IL-5potentiated leukotriene synthesis by eosinophils stimulated withserum treated zymosan (STZ) or the calcium ionophore A23187 by69% and 135%, respectively. The priming effect of IL-5was dose dependent, with significant stimulation occurring at 1 000U/ml for STZ and 100-1 000 U/ml for A23187. Pre-incubation with IL-5did not increase leukotriene synthesis further.

A spectrometric method for the determination of L-carnitine hasbeen developed based on the reaction of the 5,

This study will test the uptake and effectiveness of a flexible package of smoking cessation support provided primarily by the practice nurse (PN) and tailored to meet the needs of a diversity of patients.This study is a cluster randomised trial, with practices allocated to one of three groups 1) Quit with Practice Nurse 2) Quitline referral 3) GP usual care. PNs from practices randomised to the intervention group will receive a training course in smoking cessation followed by access to mentoring. GPs from practices randomised to the Quitline referral group will receive information about the study and the process of written referral and GPs in the usual care group will receive information about the study. Eligible patients are those aged 18 and over presenting to their GP who are daily or weekly smokers and who are able to give informed consent. Patients on low incomes in all three groups will be able to access free nicotine patches.Primary outcomes are sustained abstinence and point prevalence abstinence at the three month and 12 month follow-up points; and incremental cost effectiveness ratios at 12 months. Process evaluation on the reach and acceptability of the intervention approached will be collected through Computer Assisted Telephone Interviews (CATI) with patients and semi-structured interviews with PNs and GPs.The primary analysis will be by intention to treat. Cessation outcomes will be compared between the three arms at three months and 12 month follow-up using multiple logistic regression. The incremental cost effectiveness ratios will be estimated for the 12 month quit rate for the intervention groups compared to usual care and to each other. Analysis of qualitative data on process outcomes will be based on thematic analysis.High quality evidence on effectiveness of practice nurse interventions is needed to inform health policy on development of practice nurse roles. If effective, flexible support from the PN in partnership with the GP and the Quitline could become the preferred model for providing smoking cessation advice in Australian general practice.ACTRN12609001040257 Tobacco remains the most common preventable cause of death in the world today. The World Health Organization estimates that tobacco killed 5.4 million people globally in 2008 and on current trend this will rise to 8 million deaths per year by 2030 with more than 80% of deaths occurring in the developing world . DespiteGeneral practice is well suited for supporting smoking cessation. Around 85% of the Australian population visits a general practitioner (GP) at least once a year . There iThere is clear evidence that smoking cessation advice from a physician has an effect. The Cochrane review of 17 trials of brief advice versus no advice estimates that brief advice increases absolute rates of cessation at one year follow-up by about 2.5% compared to usual care . This efGPs in Australia as elsewhere have been encouraged by clinical practice guidelines to offerAn alternative to in-practice support from the GP is for GPs to identify smokers, provide brief advice and actively refer interested patients to the telephone Quitline. A study in Australia which compared standard in-practice management to this active referral to Quitline has shown that at 3 month follow up patients randomised to the referral intervention had a higher rate of sustained abstinence (12.3% compared with 6.9%). At 12 month follow-up patients in the referral intervention had a higher rate of sustained abstinence (6.5% compared to 2.6%), however this did not reach statistical significance . The resAn innovative model for enhanced smoking cessation support is provision of advice in the practice by general practice nurses. Practice nursing is rapidly emerging in Australia and is making a considerable contribution to capacity in primary care .In Australia the practice nurse workforce has grown rapidly since 2003. Almost 60% of Australian general practices now employing a practice nurse and pracAlthough consumers support the practice nurse role in principle, there is no research to date on consumer acceptability of specific practice nurse interventions . There iSeveral studies have explored the effectiveness of involving the practice nurse in supporting smokers to quit -31. In aSmoking cessation strategies have been shown to be highly cost effective compared to many pharmacological, surgical and hospital treatments or services . A recenFace to face interventions are the most common strategies. A recent review of cost effectiveness studies for such face to face health behaviour interventions addressing smoking cessation found favourable cost effectiveness ratios for smoking cessation programs compared to preventative pharmaceutical and invasive interventions .More intensive interventions may be more effective but also more costly . Many stQuit with Practice Nurse) involves flexible support for quitting provided primarily by the practice nurse in partnership with the patient's GP and the Quitline. The number and diversity of smokers receiving intensive intervention will be optimised by offering a flexible package of support from the nurse, GP and Quitline to match the patient's needs. The rationale is that delivering more integrated and intensive quitting support will be more effective and offering flexibility in service provision will reach more smokers from a wider range of demographic, socioeconomic and cultural backgrounds.This study will test the uptake and effectiveness of enhanced in-practice support for smoking cessation. The in-practice intervention . The control group is usual care by the GP (control group). Referral to a specialized cessation service such as the Quitline represents the major alternative approach to supporting cessation. An important strength of this study is the comparison of the new approach to both a referral model and usual care.Hypothesis: the 'Quit with Practice Nurse' intervention will reach more smokers because it will meet the needs of a greater range of smokers with different demographic, socioeconomic and cultural characteristics than referral model or standard in-practice GP management.• Evaluate uptake of the 'Quit with Practice Nurse' intervention versus the referral intervention and the control group in terms of the number of patients, demographics, socio-economic status, language and ethnicity, smoking history and level of nicotine dependence. Hypothesis: the 'Quit with Practice Nurse' model will achieve higher quit rates as more patients will receive a cessation intervention that meets their individual needs.• Compare the effect on cessation of 'Quit with Practice Nurse' versus 'Quitline Referral' and the control group. Hypothesis: the more intensive intervention may be more costly than usual care or 'Quitline Referral' but any higher costs of the 'Quit with Practice Nurse' intervention will be justified by its higher uptake and quit rate.• Examine the cost effectiveness of the three approaches and their components from the perspective of the health care sector. Hypothesis: the 'Quit with Practice Nurse' intervention will be acceptable to patients as it offers a flexible package of support to meet patient needs.• Assess the acceptability to patients of the 'Quit with Practice Nurse' intervention. Hypothesis: the 'Quit with Practice Nurse' intervention will be acceptable to practice nurses and GPs as it provides an important new role for practice nurses and provides GPs the option of referral within their practice.• Assess acceptability and sustainability of practice nurse assisted support to quit from the perspective of practice nurses and GPs. This study is a three arm cluster randomised trial involving general practices with practice nurses located in Sydney and Melbourne, which are Australia's two largest cities. Recruitment will expand if necessary to other parts of New South Wales and Victoria. Practices will be allocated to one of three groups 1) Quit with Practice Nurse 2) Quitline Referral 3) usual care control group.Practices which employ at least one practice nurse will be eligible to participate. Eligible practices will be identified with the assistance of local general practice networks . All GPs working in these practices will be approached by mailing an initial invitation letter followed by a telephone call from one of the chief investigators. GPs expressing interest on the phone will be visited by project staff to explain the project to GPs and practice nurses and to gain informed consent.Randomisation to intervention groups will follow procedures outlined in the CONSORT statement and willEligible patients are those aged 18 and over presenting to their GPs who are daily or weekly smokers. Potential participants will be excluded if they meet any of the following criteria: unable to give informed consent , insufficient command of English to comprehend the consent process and/or data collection questions. A research assistant will be attached to each participating practice for a two week recruitment period and approach patients in the waiting room prior to the consultation with the GP. Initially the research assistant will assess patient eligibility and, if eligible, patients will be given a copy of participant information statement. Patients providing a written consent will be asked to complete the baseline data questionnaire at this time. Patients take notice of their participation into the GP consultation. GPs respond to this notification depending on their group allocation.This method of recruitment maintains a separation of baseline data collection from the intervention. Waiting room recruitment has previously been used successfully by members of the research team in studies on smokers, ,38 riskyThis intervention involves the practice nurse, GP and Quitline working in partnership with the patient to provide flexible assistance that meets the needs of individual smokers. The GP identifies smokers and their willingness to quit and offers brief advice. Patients with any interest in quitting are referred to the practice nurse. The practice nurses will see the patient for an initial assessment visit. At this assessment the practice nurse gathers information about patient demographics, smoking behaviour, stage of readiness to quit, previous quit attempts, nicotine dependence (using Fagerstrom test), previous use of pharmacotherapy and perceived barriers to quitting. Patients are assisted to develop a quit plan and (in consultation with the GP) encouraged to use pharmacotherapy according to recommendations in clinical practice guidelines ,41. PatiPatients in this group who are unable to attend for face-to-face consultations or who prefer telephone counseling to support their quit attempts will be referred to the Quitline using a faxed referral system. As in the referral intervention described below, patients are contacted and offered services to meet their needs. Patients are encouraged to use the proactive callback service which has been shown to be more effective than reactive counseling . FeedbacTraining for the practice nurses will consist of a one day training workshop where the nurses are educated in: 5As approach to smoking cessation counseling ; basics of motivational interviewing; nicotine dependence; smoking cessation pharmacotherapy and resources for smoking cessation including Quitline services. The practice nurses will receive mentoring over the course of the project from an experienced Quitline counselor who they can contact for advice. The counselors involved will attend the practice nurse training sessions to establish this mentoring relationshipQuitline Referral' intervention involves the GPs identifying smokers and their willingness to quit and offering brief advice. Patients with any interest in quitting are offered referral to the Quitline. Patients who consent will have their referral faxed to the Quitline and are provided with a brochure on Quitline services. Patients are telephoned by the Quitline and offered services to meet their needs. Patients who express interest in quitting are offered a series of proactive callback counseling/advice sessions [The 'sessions . ReferriThe control group involves GPs identifying smokers and their willingness to quit and offering assistance in accordance with their usual practice. This should include advice on use of medications to quit and prescriptions where appropriate. It may involve advice provided by themselves within the practice or referral to the Quitline or both where the GP deems it appropriate, but no provision is made to facilitate either. Based on previous work, levels of either referral or intense counseling within practice interventions are likely to be very low .Patients in all three groups will be encouraged to use smoking cessation pharmacotherapy based on best practice guidelines ,41. For Patient level measures will be assessed at baseline, three months and 12 months Cost analysis will be from the perspective of the health care sector and include direct costs of the intervention, including for recruitment, and for the intervention .Quantitative and qualitative data on process outcomes will be collected as part of the CATI of participating patients in each of the three arms at the three month follow-up point. These questions will be asked only after the primary outcome data on abstinence has been collected. In the CATI patients in all three arms will be asked about uptake including barriers and enablers to uptake, extent and nature of the intervention received including use of smoking cessation pharmacotherapy (type of pharmacotherapy used and duration of use), acceptability and perceived value of the smoking cessation support received. The interviews will also explore patient perception on the influence of culture, language and socioeconomic status on the acceptability of the intervention approaches. Patients in the 'Quit with Practice Nurse' arm will be asked further questions about the perceived value of the flexible approach to cessation support. These will include their level of awareness or lack of awareness of the flexibility, its importance or otherwise for them, the important factors in the choices made about support options, and their perception on the roles of the providers involved .The acceptability and sustainability of the 'Quit with Practice Nurse' intervention will be evaluated with semi-structured interviews with participating practice nurses, GPs and Quitline counselors.Analysis for the primary outcomes of sustained abstinence and point prevalence abstinence will be on an intention to treat basis with cases retained regardless of whether they accept or receive the intended intervention. A series of planned imputation strategies for missing data will be used in examining outcomes for missing data. These are 1) analysis will be done on all participating patients, where all patients with missing outcome data will be assumed to be smokers; 2) the last known value carried forward to replace the missing value; 3) an analysis of outcomes for patients with complete outcome data. We will compare cessation outcomes between the three arms at three months and 12 month follow-up using multiple logistic regression. This approach will allow us to adjust for clustering and to assess the effect of potential confounders such as age, sex, socioeconomic status, ethnicity, language spoken at home and nicotine dependence on cessation outcomes.The study will estimate incremental cost effectiveness ratios (ICER) of cost per quitter for brief advice and referral to Quitline, and with the flexible support intervention, compared to standard GP care. The ICER will be estimated for the 12 month quit rate for the intervention, less an unaided/natural quit rate. Adjustments to effect sizes will also be made for long term relapse rate among the 12 month quitters.Analysis will be based on thematic analysis. Our aim is to identify common themes and issues about barriers and facilitators to the uptake of the intervention from the perspective of both patients and providers. This will allow a richer understanding of the experiences of participants in the study and maximise our capacity to provide meaningful answers to our research questions .The observed 12 month sustained abstinence outcomes of GP usual care and Quitline referral in Borland et al.'s study in Victoria were 2.6% and 6.5% respectively . The susThe study has received ethics approval from the University of New South Wales, University of Melbourne and University of Western Sydney Human Research Ethics Committees.Australian New Zealand Clinical Trials Registry (ANZCTR). Number: ACTRN12609001040257.This project will test an approach to supporting smoking cessation in general practice based on partnership between the practice nurse, GP and patient to support quitting. This is a new approach in Australia which has not had a system to provide face to face quitting support from specifically trained health professionals in a way that is accessible for most of the population. If successful it would have major benefits for addressing smoking which remains Australia's most important cause of preventable death and disease. The project is highly relevant with current policy direction in developing practice nurse roles and expanding access to Medicare rebates for services provided by practice nurses. Trials of actual interventions involving practice nurses have been identified as an important step in advancing the practice nurse role and thisGP: General Practitioner; CA: TIComputer Assisted Telephone Interviews; CALD: Culturally and Linguistically Diverse; LYS: Life Years Saved; CONSORT: CONsolidated Standards Of Reporting Trials; ICER: Incremental Cost Effectiveness Ratios; STATA: Portmanteau of the words "statistics" and "data"The authors declare that they have no competing interests.NZ - leading development of the study conceptualisation, design, refining of protocol and write up for publication, RR - input into development of the study conceptualisation, design contribution to protocol publication. EH - input into development of the study conceptualisation with a focus on the role of the practice nurse, design, contribution to protocol publication. JF- input into development of the study conceptualisation, design including qualitative assessment of the intervention, and contribution to protocol publication. JS - development of the study conceptualisation, design with focus on health economic evaluation, contribution to protocol publication. OH - refining of protocol, outcome assessment tools and contribution to protocol publication, IB - refining of protocol, outcome assessment tools, and contribution to protocol publication. RB - input into development of the study conceptualisation, design and contribution to protocol publication. All authors have read and accepted the final manuscript.The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2296/11/59/prepub

Leishmania species, causative agents of cutaneous, mucocutaneous and visceral leishmaniasis, is revealing unusual features of potential relevance to parasite virulence and pathogenesis in the host. While the genomes of Leishmania major, Leishmania braziliensis and Leishmania infantum are highly similar in content and organisation, species-specific genes and mechanisms distinguish one from another. In particular, the presence of retrotransposons and the components of a putative RNA interference machinery in L. braziliensis suggest the potential for both greater diversity and more tractable experimentation in this Leishmania Viannia species.Recent progress in sequencing the genomes of several Although the available technology for completion of such large genomes was lacking at that time, these projects were considered feasible given the organisation of a committed consortium of participating laboratories, sufficient funding and anticipated advances in sequencing technology. Thirteen years later, three completed Leishmania genomes are in the public domain (Leishmania mexicana) in progress (http://www.genedb.org/). These first four species were chosen to represent the main species complexes of the L. Leishmania subgenus together with the best-characterised species of the L. Viannia subgenus. The strains selected were all infective, allowing study of host responses in suitable rodent models in vivo, and adapted for maintenance and manipulation in the laboratory , the most common disease form that is usually self-healing in humans but leaves unsightly scars in those affected is the most serious disease form and frequently fatal if left untreated. Closely related species of the L. donovani complex are found in different geographical regions: L. donovani is the primary cause of VL in the Indian subcontinent and East Africa, L. infantum in the Mediterranean region and L. chagasi in the New World , is the third and most divergent species sequenced to date – and the principal cause of CL and mucocutaneous leishmaniasis (MCL) in tropical America. Originally associated with close contact with the forest environment, it is now accepted that L. braziliensis transmission may occur in peri-domestic and domestic habitats. More recently, studies on the reservoir hosts strongly suggest that a number of rodent species are involved, including domestic rats as polycistronic transcription units range in size from a few to hundreds of genes stretching over 1 Mb of DNA. DGCs are separated by AT-rich strand switch regions (SSRs) believed to contain sites for transcription initiation and termination but seven of the “core” SCG genes are found exclusively at distinct subtelomeric sites and L. infantum . The PSA-2s are known to bind to host cell macrophages and protect the parasite from complement-mediated lysis during infection with L. chagasi and L. infantum . The first cytokine to be identified, MIF is also one of the most pleiotropic, implicated in a wide range of cellular activities that could influence parasite survival . Functional analysis of these sequences may be of considerable interest, given that MIF expression in the filarial worm Brugia malayi influences the progression of the CD4+ T cell response to infection towards a TH2 pathway or 34 (L. mexicana complex). These differences were shown to be due to fusion of pairs of chromosomes , with the former observation now confirmed in the sequencing project.From an evolutionary perspective, phylogenetic analyses have suggested a neotropical origin for the ia genus and, whiia genus , this haia genus . Irrespeears ago , within analysis : L. majoL. major and L. infantum across the whole genome, while L. braziliensis has only a few possible sequence re-arrangements in infective stages of L. major and L. infantum, with their protein products localizing to the plasma membrane and intracellular membranes, respectively, in these species accounts for ∼80% of the species differences in Leishmania. These degenerate sequences have in-frame stop codons and frame shifts, generating truncated open reading frames that are presumably not translated. One example is the gene encoding cysteine peptidase Pfp1, which is present as an intact gene and translated in L. major gene, present in L. infantum and L. braziliensis but absent from L. major. Acquisition of novel genes in this way may be a mechanism for environmental adaptation to promote survival; similar adaptations to stress or other stimuli may lead to the redundancy of other sequences clearly identified as pseudogenes in the Leishmania genomes and non-LTR retroelements account for ∼5% and 2% of the haploid T. cruzi and T. brucei genomes, respectively , site-specific retroposons and non-site-specific retroposons (Ingi and L1Tc) have been described . Trypanoectively . These mLeishmania species originally indicated a lack of active retroelements , which had been previously described in trypanosomes , a family of 20–30 novel DNA transposable elements, each including putative reverse transcriptase, phage integrase (site-specific recombinase) and DNA/RNA polymerase domains. These are highly conserved retroelements with a precise site of insertion within the telomeric hexamer repeats and a typical TT duplication flanking the transposon. The clusters of tandemly arrayed TATEs at the ends of chromosomes resemble ribosomal mobile element (RIME)/Ingi retroelements that are also organised in clusters within the subtelomeric regions of T. brucei chromosomes . On the other hand, only remnants of TATE elements are detected at L. braziliensis internal chromosomal sites. Besides the bias of abundance of these elements at the chromosome ends, selection against disruption of coding regions at chromosome central domains could explain TATE distribution patterns. To understand the role of the TATEs in shaping the L. braziliensis genome, it will be necessary to improve genome assembly and further analyse TATE distribution in different strains and species of the Viannia subgenus.In addition, the organization of the omosomes . Based o repeats . The TAT7Caenorhabditis elegans and the microRNAs (miRNAs) have been extensively studied in gene silencing. Initially described in elegans , the ter elegans and link elegans .Currently, RNAi is the best-known mechanism of gene silencing, an evolutionary conserved process in which double-stranded RNA induces the sequence-specific degradation of homologous mRNA . BesidesT. brucei into small interfering RNA (siRNA). Annotation of the genomes of three Leishmania species and the trypanosomes did not reveal a Dicer orthologue .An RNAi mechanism was rapidly identified in . brucei but has T. cruzi . Therefothologue . InsteadT. brucei Dicer-like protein (TbDcl1), quite divergent from the typical Dicer proteins described for other eukaryotes, is required for the generation of siRNA-size molecules and for RNAi . It is also possible that the parasite genome may play only a minor role in determining disease phenotype. In-depth functional analyses may ultimately unravel the relative contribution of parasite genes to disease progression in this spectrum of crippling infections.More fundamentally, genomic knowledge is revealing fascinating insights into

The aim of the study was to assess the relationship between bone mineral density and periodontitis in premenopausal and postmenopausal women.Twenty women between the age group of 45-55 years were selected for this study. Ten premenopausal women with healthy periodontium constituted the control group and 10 postmenopausal women with ≥2mm of clinical attachment loss in >30% of sites constituted the study group. All patients were assessed for plaque index, probing depth and clinical attachment loss. Radiographs (six IOPA and two posterior bitewing) were taken and assessed for interproximal alveolar bone loss. The patients were scanned to assess the bone mineral density of lumbar spine (L2) and femur using dual energy X-ray absorptiometry (DEXA).The bone mineral densities of lumbar spine (L2) and femur were significantly lower in the study group than the control group. Osteopenia of the lumbar spine and femur was observed in 60% whereas osteoporosis of lumbar spine was observed in 30% of cases in study group.Increased proportion of osteopenia and osteoporosis cases of lumbar spine and femur in postmenopausal women with periodontitis suggests that there is association between bone mineral density and periodontitis. Osteoporosis and osteopenia are characterized by reduction in bone mass and may lead to skeletal fragility and fracture. Postmenopausal osteoporosis is closely associated with estrogen deficiency that resThe mechanisms by which systemic bone loss may lead to more severe periodontal destruction are decreased local bone mineral density caused by systemic bone loss, altered local tissue response to periodontal infections, genetic factors and changed life style patterns like smoking alcohol consumption etc. These may put an individual at risk for both osteoporosis and periodontal disease.To assess the relationship between bone mineral density and periodontitis in premenopausal (control group) and postmenopausal women (study group).To ascertain that the severity of alveolar bone loss could be a risk indicator for systemic bone loss.To establish that periodontitis may be used as a routine screening procedure for osteoporosis in postmenopausal women.Twenty women aged between 45-55 years were randomly selected from out patients attending the Department of Periodontics, Tamil Nadu Government Dental College and Hospital.Age Group 45-55 YearsPatients should have at least 15 natural teethPatients who need antibiotic prophylaxisParathyroid diseaseMetabolic bone diseaseMalignancyEarly onset of menopausePatients on long term steroid medication, hormone replacement therapy (HRT) and calciumThe use of contrast agents or participation in nuclear medicine studies seven days prior to bone mineral density (BMD) assessment.The patients were categorized into two groups, namely, the study and control group. The control group consisted of 10 premenopausal women in the age group of 45-55 years who exhibited healthy periodontium with no attachment loss. The study group consisted of ten postmenopausal women aged between 45-55 years constituted the study group, who exhibited ≥ 2mm clinical attachment loss in > 30% of sites. Informed consent was obtained from all the patients. The following clinical parameters were recorded:Plaque indexProbing depthClinical attachment levelInterproximal alveolar bone loss was determined from six intra oral periapical radiographs and two posterior bitewing radiographs. The radiographs were scanned and digitized. A grid cThe bone mineral density values of anterior-posterior lumbar spine and dual femur were assessed using a dual energy X-ray absorptiometer (DEXA) and 3. D2Bone mineral density –the bone mineral density of the focused area which is expressed in units of grams/cmT-score- represents the difference from the peak bone mass for the population expressed in standard deviation (S.D).Formulae for T-Score assessment:T-score = (BMD-YN)/S.D.BMD - Bone mineral density of the focused area.YN - Young normal women around 30 years.Reports were analyzed and fracture risk indications were determined by using World Health Organization (WHO) diagnostic guidelinesThe data so collected were statistically analyzed. The statistical package SPSS PC+ was used for statistical analysis.Mean values were compared by student’s independent t-Test. Proportions of T-score abnormality was compared by chi-square test / Fishers Exact test (2-tailed) appropriatelyThe parameters used for statistical analysis were age, number of teeth, BMI, plaque index, probing depth, clinical attachment loss, interproximal alveolar bone loss, bone mineral density of lumbar spine and femur.P-values of clinical parameters of control and study groups respectively.Tables P<0.0001) of clinical parameters of study group than control group whereas age, BMI and no. of teeth had no significant P value. P<0.0001) and femur (P<0.003) which were significantly lower in study group than control group. The results show an increased proportion of osteopenia and osteoporosis cases in lumbar spine and femur in postmenopausal women with periodontitisOsteoporosis means literally “porous bone,” a condition of there being “too little bone” to provide mechanical support. Osteopenia is a reduction in BMD below a pre defined level. Osteoporosis is characterized by a reduction in bone mineral density to level below what is required for mechanical support. A consensus development conference defined osteoporosis as a systemic skeletal disease characterized by low bone mass and microarchitectual deterioration with a consequent increase in bone fragility and susceptibility to fracture.Osteoporosis may be a primary disorder or secondary to other diseases or conditions. Primary osteoporosis includes idiopathic and involutional form. Idiopathic forms of osteoporosis are rare and affect men and women equally. Involutional osteoporosis includes two patterns type I and type II (age related) osteoporosis.Type I osteoporosis occurs in postmenopausal women. Bone loss in premenopausal women is slow and approximately equal to that of men (0.3 to 0.5% per year). With the onset of menopause in females, an accelerated rate of cortical bone loss of two to three per cent per year for about eight to ten years. Type I osteoporosis related to estrogen deficiency associated with menopause, leads to a cascade of accelerated bone loss by decreased secretion of parathyroid hormone, increased secretion of calcitonin and decreased calcium absorption which further aggravates bone loss.In addition, patients with type I osteoporosis and high bone turnover have increased production of IL – 1 from stimulated monocytes as compared with age matched controls, which also contributes to increased bone resorption.Type II (age-related) osteoporosis appears to affect virtually the entire population of aging men and women.Periodontitis is an inflammatory disease characterized by loss of connective tissue and alveolar bone. Like osteoporosis, it is a silent disease, not causing symptoms until late in the disease process when mobile teeth, abscesses and tooth loss may occur. While the etiologic agent in periodontitis is a pathogenic bacterial plaque in a susceptible patient, periodontitis and osteoporosis have several risk factors in common. They include an increased prevalence with age, smoking and influence of disease or medications that may interfere with healing.The possible mechanism by which postmenopausal osteoporosis lead to more periodontal destruction may be the presence of less crestal alveolar bone per unit volume, this bone of lesser density may be more easily absorbed. Estrogen acts by blocking the production of cytokines that promote osteoclast differentiation and osteoclast apoptosis.Estrogen withdrawal following menopause is associated with increased osteoclast numbers due to enhanced osteoclast formation and activity and reduced osteoclast apoptosis. Elevated IL-1 and IL-6 and TNF-α induce osteoclast activity and increased bone turnover rates and finally the systemic factors of bone remodeling may also modify local tissue response to periodontal infection. Persons et al,[In an earlier study by Wactawski Wende et al, conducteThe risk factors for osteoporosis as given by WHO study group 1994 include et al.[et al.[In a previous study, X-ray exet al. Dual eneet al. the metal.[et al.Femoral neck and vertebral fractures are related to postmenopausal osteoporosis. Bone mineral density of lumbar spine (L2) was used for analysis in the present study because it is the vertebrae least affected by artifacts. The assessment of alveolar process density in dentate subjects is limited anatomically to small inter radicular regions preclude the use of DEXA.Regions of bone that consist predominantly of trabecular structure like vertebrae are the preferred sites for the assessment of bone mineral density because of earlier detection of change in bone mineral content.et al,[et al.[et al,[Numerous investigators utilized dental radiographs to compare the alveolar bone loss with the bone mineral density of skeletal sites.–16 In thet al,. Interprl,[et al. The measl.[et al, because P<0.0001) than the control group and not in concurrence with previous study.[As far as the dental parameters are concerned, statistically, the probing depth in the study group was significantly higher (us study.P<0.0001) and dual femur (P<0.003) in the study group than control group. The mean interproximal alveolar bone loss is higher (5.42 mm) than mean probing depth (3.91mm) and clinical attachment loss (4.20mms) in the study group. This implies the importance of indirect systemic effect of osteopenia on periodontal disease as stated by Wactawski Wende.[Statistically, bone mineral density showed significantly lower value for the lumbar spine density is concerned; and 100% normal in control group and 40% normal and 60% osteopenia cases in the study in the study group, as far as dual femur density is concerned which is not observed in the previous study.The incidence of osteopenia and osteoporosis in percentage calculation is significantly higher in lumbar spine (L2) when compared to dual femur (60% osteopenia). This shows that the trabecular bone is found in greater amounts in the vertebral bodies compared to ends of long bones. The trabecular bone in postmenopausal woman is lost earlier and more rapidly than cortical bone due to estrogen deficiency.P<0.001) in study group compared to control group and the bone mineral density is significantly lower in study group (P<0.001 and P<0.003) compared to control group. Based on these findings, the present study, proved positively the association of periodontitis with systemic bone mineral density in post menopausal women.The periodontal clinical parameters such as probing depth, clinical attachment loss and interproximal alveolar bone loss were significantly higher (The occurrence of osteopenia and osteoporosis of the lumbar spine (L2) and femur in postmenopausal women with periodontitis suggests that there is association between bone mineral density and periodontitis and that the severity and extent of alveolar bone loss in postmenopausal women may be a risk indicator for systemic bone loss. Routine periodontal screening will go a long way in the early detection of bone changes, disease status and treatment modalities, so compulsory referral from the medical side to the periodontist for the status of the alveolar bone in post menopausal women is a must.

The overall conformation of the mol­ecule is influenced, in part, by electron delocalization and by an intra­molecular bifurcated O—H⋯ hydrogen bonds. The O atoms of the nitro group, one of which serves as an H bond acceptor, are disordered over two sets of sites with refined occupancies of 0.56 (3) and 0.44 (3).In the title compound, C Å b = 7.0616 (19) Å c = 17.043 (5) Å β = 101.233 (3)°V = 1720.9 (8) Å3 Z = 4 Kα radiationMo −1 μ = 0.24 mmT = 296 K 0.31 × 0.18 × 0.16 mm Bruker APEXII CCD diffractometerSADABS; Sheldrick, 1996T min = 0.930, T max = 0.963Absorption correction: multi-scan (14642 measured reflections3927 independent reflectionsI > 2σ(I)2563 reflections with R int = 0.033 R[F 2 > 2σ(F 2)] = 0.044 wR(F 2) = 0.141 S = 1.03 3927 reflections241 parametersH-atom parameters constrainedmax = 0.22 e Å−3 Δρmin = −0.26 e Å−3 Δρ APEX2 used to solve structure: SHELXS97 (Sheldrick, 2008SHELXL97 (Sheldrick, 2008SHELXTL (Sheldrick, 2008SHELXTL.Data collection: 10.1107/S1600536809019631/lh2824sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809019631/lh2824Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

The data presented herein support the North American orthopoxviruses (NA OPXV) in a sister relationship to all other currently described Orthopoxvirus (OPXV) species. This phylogenetic analysis reaffirms the identification of the NA OPXV as close relatives of “Old World” (Eurasian and African) OPXV and presents high support for deeper nodes within the Chordopoxvirinae family. The natural reservoir host(s) for many of the described OPXV species remains unknown although a clear virus-host association exists between the genus OPXV and several mammalian taxa. The hypothesized host associations and the deep divergence of the OPXV/NA OPXV clades depicted in this study may reflect the divergence patterns of the mammalian faunas of the Old and New World and reflect a more ancient presence of OPXV on what are now the American continents. Genes from the central region of the poxvirus genome are generally more conserved than genes from either end of the linear genome due to functional constraints imposed on viral replication abilities. The relatively slower evolution of these genes may more accurately reflect the deeper history among the poxvirus group, allowing for robust placement of the NA OPXV within Chordopoxvirinae. Sequence data for nine genes were compiled from three NA OPXV strains plus an additional 50 genomes collected from Genbank. The current, gene sequence based phylogenetic analysis reaffirms the identification of the NA OPXV as the nearest relatives of “Old World” OPXV and presents high support for deeper nodes within the Chordopoxvirinae family. Additionally, the substantial genetic distances that separate the currently described NA OPXV species indicate that it is likely that many more undescribed OPXV/NA OPXV species may be circulating among wild animals in North America. Poxviridae family of viruses is divided into two sub-family groups based on the hosts they infect, vertebrates (Chordopoxvirinae) and invertebrates (Entomopoxvirinae). In general, poxviruses are complex double stranded-DNA viruses with a characteristic brick, or ovoid-shaped virion apparent through electron microscopy. The Chordopoxvirinae are universally distributed and capable of infecting a wide range of avian, reptilian and mammalian species. Some appear to have a limited host range, (Molluscum contagiosum and Variola virus) while others are found to infect multiple animal species. Many of these poxviruses can cause serious infections in livestock species, including sheep, goats, cattle, crocodiles, caimans, chickens, turkeys and ostriches. Consequently, these pathogens can have devastating effects on livestock production resulting in substantial economic losses. In addition, Chordopoxvirinae species frequently emerge as zoonoses in humans. Sources of human infection include international trade in exotic animals (e.g. Monkeypox virus), livestock management (e.g. Vaccinia virus and Orf virus), and even contact with domestic animals (e.g. Cowpox virus). When introduced into non-endemic regions, enzootic chordopoxviruses can threaten native and endemic species previously protected by isolation. Squirrelpox virus, presumed to have been imported to the British Isles with the North American grey squirrel (Sciurus carolinensis), is thought to have contributed to the rapid decline of red squirrels (Sciurus vulgaris) in many areas of the larger islands The Orthopoxvirus (OPXV), which includes Variola virus, the causative agent of smallpox, and Vaccinia virus, the principal source of smallpox vaccine. Additionally, several OPXV species are zoonotic, including Cowpox virus, Monkeypox virus, and some vaccinia-like virus species. The distribution of most described OPXV species is outside of North America. Those viruses presumed to be endemic to North America currently include only Raccoonpox virus, Skunkpox virus, and Volepox virus. The host range, geographic distribution, and precise taxonomic position of these North American orthopoxviruses (NA OPXV) remain largely undetermined.One of the best studied chordopoxvirus genera is Cowpox virus species are known to be carried, and hypothesized to be transmitted to humans and domestic animals, by rodent species including bank voles (Myodes glareolus) and striped field mice (Apodemus sylvaticus). Several other OPXV species are known to be associated with rodents, but the specific nature of these associations remains unknown. Ectromelia virus was described from captive colonies of lab mice (Mus spp) and some strains are highly lethal to this rodent species, however almost nothing is known regarding its natural distribution Monkeypox virus was initially isolated from captive non-human primates in Denmark Monkeypox virus was obtained from a Thomas's rope squirrel (Funisciurus anerythrus) collected in Zaire (currently Democratic Republic of Congo) in 1985 Taterapox virus was described in 1975 as an OPXV isolated from a “healthy” naked-soled gerbil (Tatera kempi) captured in Benin Oryzomys sp.) and found to belong to a larger clade of vaccinia-like viruses which cause disease in cattle and humans throughout the dairy producing regions of Brazil The natural reservoir host(s) for many of the described OPXV species remains unknown. However, the ecology and host systems of cowpox viruses have been extensively studied Volepox virus has been definitively associated with rodents, being isolated initially from a scab from a California vole . OPXV antibodies were found in several other geographically separated populations of this species over a period of two years, suggesting a long term association between the virus and host Peromyscus truei) in the same area of the initial isolation site near San Francisco Bay Raccoonpox virus and Skunkpox virus were originally each isolated from their namesake mammalian species. A wildlife study conducted across 35,000 acres of Aberdeen Proving Grounds, Maryland, reported the recovery of two Raccoonpox virus isolates and a seroconversion rate of 23% in wild raccoons found in the region Raccoonpox virus in a domestic cat Raccoonpox virus and raises the possibility of transmission of these poorly characterized viruses to domestic cats, as well as to other domestic or wild animals and perhaps even to humans. A limited infection was reported upon human exposure (needle stick) to a recombinant Raccoonpox virus vaccine vector, though natural human infection has yet to be reported Skunkpox virus was isolated from a noticeably ill and presumed (but not) rabid skunk in Colfax, Washington in 1978 and is the only NA OPXV isolated from an overtly ill animal. To further our understanding of the poxviruses circulating in North America, we compare nine genes from across the conserved central region of the poxvirus genome among the eight genera of Chordopoxvirinae. Skunkpox virus, Volepox virus and Raccoonpox virus are included in the analyses to establish the relationship of the North NA OPXV species relative to the currently recognized Orthopoxvirus family.Of the NA OPXV, only Raccoonpox virus (RACV) forms a monophyletic group with a Skunkpox virus/Volepox virus sister grouping. The relative branch lengths between the NA OPXV and leading to other orthopoxviruses illustrates the considerable distance between the two clades (NA OPXV and other OPXV) and that the NA OPXV have much greater distances between species than is seen among the recognized African and Eurasian OPXV species. Outside of the OPXV clade a monophyletic Yatapoxvirus clade is sister to a larger non-OPXV clade. This non-OPXV/non-Yatapoxvirus clade consists of two clades. Deerpox virus (DPV) isolates are sister to a Capripoxvirus clade which is consistent with previous analyses Sheeppox virus (SPPV) sister to a monophyletic clade including Lumpy skin disease virus (LSDV) and Goatpox virus (GTPV). The second clade consists of Swinepox virus (SWPV), Rabbit fibroma virus (RFV), Myxoma virus (MYXV), Molluscum contagiosum virus (MOCV), Crocodilepox virus (CRV), Bovine papular stomatitis virus (BPSV) and Orf virus (ORFV) which form a ladder configuration beginning with LSDV as the first to split from the others and ending with BPSV and ORFV in a sister grouping.The phylogenetic tree derived from the selected genes was constructed by Bayesian inference and is shown in Ectromelia virus) are presented in Variola virus) (patristic distance  = 0.033874). Comparatively, the average patristic difference between ECTV_Mos and NA OPXV species (0.160133) is nearly five times the distance between ECTV_Mos and VARV_IND3_1967. Similarly, the two closest NA OPXV species, Volepox (VPXV) and Skunkpox virus (SKPV), lie at a patristic distance (0.070158) twice that of ECTV_Mos and VARV_IND3_1967. The results of the Shimodaira-Hasegawa test which analyzed the log likelihood scores of alternative tree topologies (with each NA OPXV constrained into the Old World OPXV clade) indicate that the original tree, with a monophyletic NA OPXV, has a significantly (P<.05) better topology.Pairwise genetic distances and branch lengths between NA OPXV species and their nearest Old World cousin, ECTV_Mos (Molluscum contagiosum (MOCV_st1), Crocodilepox virus (CRV_ZWE), and the parapoxviruses are unusually GC-rich compared to the rest of the PoxviridaeLeporipoxvirus (43.6% and 39.5% for MYXV and RFV respectively) Molluscum contagiosum virus and Orf virus have been presented in a similar topology in previous studies Leporipoxvirus clade and moved Suipoxvirus from a sister position with Leporipoxvirus to a sister relationship with Deerpox virus. The large non-Orthopoxvirus clade is still formed by Yatapoxvirus, Leporipoxvirus, Deerpox virus and Capripoxvirus added in a stepwise manner from the deepest node. The relationship between Suipoxvirus, Deerpox virus and Capripoxvirus has been shown to be close in previous work Orthopoxvirus clade structure is presented in Bratke and McLysaght The genomes of Volepox virus, Cowpox virus, vaccinia-like viruses, and Taterapox virus are all believed to infect rodent species with little obvious disease in the host although, with the exception of Cowpox virus, only limited data are available Camelpox virus and Taterapox virus), or zoonotic (Monkeypox virus) OPXV species described as endemic to the African continent, and the genomic divergence between these viruses is relatively slight. Most of the African OPXV ecological surveillance studies have used serological assays that cross react between members of the OPXV genus and are not able to distinguish between exposures to different OPXV species. This, along with the low number of ecology studies relative to the size and ecological diversity of the African Continent, make it likely that there are several more African OPXV species that have not yet been described.Members of the OPXV genus infect several mammalian taxa as both enzootic and zoonotic pathogens, and in at least some cases are present asymptomatically. In terms of isolates obtained from wild animals, rodents are the most often associated mammalian taxon regarding the isolation of the currently described OPXV species. Raccoonpox virus and Volepox virus) have not been linked to any obviously pathogenic disease in animals or humans. Ecological studies of these two viruses indicate widespread and possibly long-term associations between the viruses and the mammal species from which they were isolated Skunkpox virus was isolated from a sick animal, it is not clear if the virus was the cause of the illness. The recent occurrence of Raccoonpox virus in a domestic cat in Canada illustrates the possibility of cross-species transmission of these viruses. Reports of Cowpox virus in domestic cats and humans have been occurring with increased frequency in Europe Cowpox virus infections may be attributable to the decrease in number of persons vaccinated for smallpox and the loss of cross-protection against other poxvirus species. These conditions also exist in North America and could lead to an increase in the transmission of NA OPXV to humans from the reservoir species or domestic animals.The topology and the relatively large patristic distances between NA OPXV and the other OPXV species indicate that the NA OPXV species are the most divergent members of OPXV currently described and are some of the least studied. All of these are mammal-associated and two of the three , also one of the larger genomes, is consistently sister to the remaining non-NA OPXV Orthopoxvirus group in this and other analyses It has been suggested that cowpox viruses represent the ancestral state of OPXV species in that they possess every gene present in every other OPXV Cowpox virus isolates do not form a monophyletic clade. CPXV_GRI is most closely related to the vaccinia virus group, while CPXV_BR diverges from a deeper node on the tree. The phylogenetic and taxonomic incongruence of “cowpox virus”, despite some similar virological properties including chorioallantoic pock morphology, is likely the result of multiple OPXV species which cause a rash illness in cows. The traditional common names assigned to poxviruses are often confusing, as the disease presentation is superficially similar for many of the pathogenic species. Cows are susceptible to both Vaccinia virus and the multiple Cowpox virus clades. Lineages of these similar viruses may explain some of the historic confusion regarding cowpox, horsepox and vaccinia with regard to the condition and the causative viral agents Vaccinia virus. All of the vaccine and sylvan isolates form a monophyletic clade which justifies the classification of all members of this clade under the species Vaccinia virus.As seen in previous studies Vaccinia virus, while initial studies demonstrated little to no hemagglutination inhibition (0 to 160) between vole sera and Vaccinia virus or Raccoonpox virusVaccinia virus, Variola virus and Cowpox virus) of the OPXV. Further studies are needed to clarify the classification of the group based on biologic criteria.The data presented herein support a monophyletic NA OPXV clade in a sister relationship to all other currently described OPXV species. The genus OPXV has been defined traditionally by some combination of: the presence of cross-neutralizing antibodies within members of the genus, genomic similarities, biologic phenotypes, similar immunodiffusion patterns, and hemagglutination inhibition activity. Hemagglutination-inhibition antibody titers were reported at 640 and 1280 for three samples (3.3%) of raccoon sera against The current, gene sequence based phylogenetic analysis reaffirms the identification of the NA OPXV as the nearest relatives of “Old World” OPXV and presents high support for deeper nodes within the Chordopoxvirinae family. Two of the three NA OPXV species are known only from isolates obtained from carnivores. If these Carnivore species represent the natural host(s), then either these viruses have a very taxonomically broad host range or the origins of the genus OPXV could be much more ancient than previously thought, dating back to the common ancestor of the Rodentia and Carnivora. Given the relatively high genetic divergence within the NA OPXV clade it is conceivable that the hosts could be as taxonomically distant as rodents and carnivorans. However, it is also readily conceivable that the carnivoran species could have been infected by contact with rodents as with cowpox viruses in the Old World. Future ecological investigations are needed to refine the understanding of the ecological parameters which result in the maintenance of these NA OPXV viruses in the environment. Two scenarios could explain the observed relatively high genetic diversity within the NA OPXV. First, if one suggests that these are the only OPXV viruses currently native to North America, one must posit that there have been substantial virus extinction events during the course of NA OPXV evolution leaving behind a very small number of highly divergent relic species. Alternatively,the substantial genetic distances that separate the currently described NA OPXV species could indicate that many more undescribed extant OPXV/NA OPXV species may be circulating among wild animals in North America.All analyzed strains represent low passage (1–2 passages) isolates that are as close to the “wild” type viruses as possible. The isolates chosen for analysis were, when possible, from the original specimen described for the species. Genes from the central region of the poxvirus genome are generally more conserved than genes from either end of the linear genome due to functional constraints imposed on viral replication abilities. The relatively slower evolution of these genes may more accurately reflect the deeper history among the poxvirus group, allowing for robust placement of the NA OPXV within Chordopoxvirinae. Sequencing of three NA OPXV genomes was carried out using standard protocols of the Roche GS-20 pyrosequencing platform and confirmatory Sanger sequencing. Sequence data for nine genes were compiled from these strains plus an additional 50 genomes collected from Genbank. A list of strains, isolates, and sources is available in http://toolkit.tuebingen.mpg.de/probcons). The RevTrans 1.4 Server (http://www.cbs.dtu.dk/services/RevTrans/) was then used to translate the amino acid alignment back into the original DNA sequence Nine coding sequences were selected from the central region of the genome: A7L, early transcription factor/VETF large subunit (82 kDa); A10L, major core protein; A24R, RNA polymerase 132; D1R, messenger RNA capping enzyme, large subunit; D5R, DNA independent NTPase (DNA replication); E6R, hypothetical protein; E9L, DNA polymerase; H4L, RNA polymerase associated protein; J6R, RNA polymerase 147. Gene designations refer to the VACV-COP genome. Seven of these coding regions make up a subset of the ‘core families’ used to estimate a poxvirus phylogeny by Bratke and McLysaght Phylogenetic analysis was carried out on the concatenated DNA alignments using Bayesian inference as executed by MrBayes using four “chains” run over five million generations In order to examine the validity of the monophyletic NA OPXV we constructed 3 constrained trees in which each of the NA OPXV species were separately excluded from the monophyletic cluster and forced into monophyly with the “Old World” OPXV see . The Shi

A 32-year-old Caucasian primigravida was admitted for elective Caesarean Section at 36 weeks and 6 days with the diagnosis of preeclampsia.Traction of the umbilical cord after delivery of a healthy baby resulted in uterine inversion. The placenta was found to be densely adherent to the posterior uterine wall. Piecemeal excision of the placenta as close as possible to the uterine lining was then performed.In this way we were able to control a massive post partum hemorrhage and preserve the fertility of the patient. Placenta accreta is defined as abnormal adherence, either in whole or in part of the afterbirth to the underlying uterine wall. Placenta accreta and other pathological placentations are rare complications of pregnancy with potential life threatening and fertility threatening consequences. The incidence of placenta accreta has increased ten times over the last fifteen years, which reflects the increase in the rate of Caesarean Sections (CS) . PlacentA 32 year old, primigravida, was admitted in a District General Hospital for elective Caesarean section at 36 weeks and 6 days with the diagnosis of preeclampsia. She had two antenatal ultrasound examinations showing a healthy fetus and posterior fundal placenta.The patient had lower segment CS of a healthy male infant under spinal anesthesia. The placenta was found to be densely adherent to the posterior uterine wall. Traction of the umbilical cord was applied and subsequently resulted in uterine inversion.The placenta was removed by 'piecemeal' excising as close as possible to the uterine lining. About 80% of the placental tissue was removed until the uterine inversion was corrected. The uterus was closed in two layers. Two intra-abdominal drains were sited. The estimated blood loss was 2.5 litres and five units of blood were transfused together with 2 units of FFP during intra-operative and post-operative period. In addition, the patient was treated with intravenous oxytocin infusion, pr misoprostol and antibiotics.On the second post partum day, vaginal Doppler ultrasound scan showed significant amount of placental tissues with increased vascularity measuring 2.7 × 6.6 × 6.8 cms within the endometrial cavity .In this case, the placenta was clamped as close to the uterine cavity as possible and cut. The base of the placenta was overrun with haemostatic sutures and this was repeated until as much of the placenta as possible was removed Figure . PlacentDespite the many conditions associated with uterine inversion risk assessment is often lacking making the condition usually unexpected at the time of presentation. The association between abnormal placentation such as placenta accreta and uterine inversion is well supported . TherefoFor women who want to preserve their fertility the placenta should be left intact if possible after caesarean delivery as this approach lowers the risk of subsequent hysterectomy from 85% to 15%. For women who have completed their family, hysterectomy with placenta left in situ is preferable to lower the maternal morbidity rates .This case report involved conservative management. Peripartum hysterectomy was avoided and the aim was to preserve fertility. Prophylactic antibiotics, post partum oxytocics and the use of misoprostol post operatively helped to prevent further post partum hemorrhage.When a patient isinitially opted for conservative management, the possibility of recurrence should be discussed . FurtherConservative treatment for placenta accreta may be an alternative procedure in some selected cases.We suggest an alternative approach for managing uterine inversion caused by placenta accreta that involved conservative management. This way hysterectomy was avoided and fertility was preserved.CS: Caesarean Section; FFP: Fresh Frozen PlasmaWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor – in Chief of this journal.The authors declare that they have no competing interests.All authors have made substantial contribution to concept this case report.

Genomic sequences of multiple individuals from evolved populations were used to detect competing beneficial mutations.In large asexual populations where beneficial mutations may co-occur and recombination is absent, the fate of beneficial mutations can be significantly affected by competition . Theoretical models predict that clonal interference (CI) can slow adaptation, alter the distribution of fixed beneficial mutations, and affect disease progression by impacting within-host evolution of pathogens. While phenotypic data support that CI is a significant determinant of adaptive outcome, genetic data are needed to verify the patterns and to inform evolutionary models. We adapted replicate populations of the bacteriophage φX174 under two levels of CaCl2 was abundant, but no evidence of CI where CaCl2 was scarce, even though rates of adaptation and population sizes among the treatments were similar. The sequence data revealed that observed mutations were limited to a single portion of one gene in the harsh treatment, but spanned a different and larger region of the genome under the benign treatments, suggesting that there were more adaptive solutions to the benign treatment.There were several competing genotypes in most of the populations where CaClBeneficial mutations with relatively large selection coefficients can be excluded by CI. CI may commonly determine the fate of beneficial mutations in large microbial populations, but its occurrence depends on selective conditions. CI was more frequent in benign selective conditions possibly due to a greater number of adaptive targets under this treatment. Additionally, the genomic sequence data showed that selection can target different types and numbers of phenotypes in environments that differ by only a single continuous variable. In asexual populations, adaptive evolution is fueled by novel beneficial mutations that arise and sequentially fix due to selection. However, not all of these beneficial mutations may reach fixation; when they co-occur, competition for fixation ensues ,2. ThoseTheoretical studies of adaptation in large populations of asexual organisms show that the strength of interference is positively correlated with population size and mutation rate because mutations have a higher probability of co-occurring under these conditions ,13,15,16b), the multiple mutation model predicts that the both the speed of adaptation and variation in fitness increase logarithmically with N and with μb.A more recent study of adaptation in large asexual populations distinguishes between a one-by-one fixation regime under clonal interference and a multiple mutation regime where competing genotypes may have more than one mutation . In contE. coli and vesicular stomatitis virus have shown that adaptation rates plateau, and that higher population fitness is achieved as population sizes and mutation rates increase , which is equivalent to the 1+ s formula used in population genetics). We use the terminology 'selection coefficient' when referring to the single mutants, but the calculations were done in the same way as those for relative fitness. As a measure of selection strength, we estimated the mean selection coefficient (S) of mutations from each endpoint population as follows: [∑(relWk × ni)j]/Nk, where n is the frequency of mutation i, N is the total number of unique mutations, k denotes the endpoint population, and j is the summation set from 1 to j. As a second measure of selection strength, we calculated the proportional contribution of increased fitness to total fitness measured at the end of the evolution trajectory (relW/wend).Our measure of fitness is logMid- and endpoint populations were serially diluted and plated on a lawn of sensitive hosts to allow plaque formation. Ten plaque isolates were arbitrarily selected for genome sequencing . Genome sequencing was carried out as previously described .t-tests in JMP . We tested whether the number of adaptive mutations was similar between harsh and benign environments by a Mann-Whitney U-test . We examined the frequency of clonal interference by a Fisher Exact Test [We analyzed relative fitness and selection strength data using general linear models (ANOVA and nested ANOVA) and act Test .KMP carried out the experiments and analyzed the data. KMP and HAW conceived the study and wrote the manuscript. Both authors have read and approved the final version of the manuscript.

The Internet has recently made possible the free global availability of scientific journal articles. Open Access (OA) can occur either via OA scientific journals, or via authors posting manuscripts of articles published in subscription journals in open web repositories. So far there have been few systematic studies showing how big the extent of OA is, in particular studies covering all fields of science.The proportion of peer reviewed scholarly journal articles, which are available openly in full text on the web, was studied using a random sample of 1837 titles and a web search engine. Of articles published in 2008, 8,5% were freely available at the publishers' sites. For an additional 11,9% free manuscript versions could be found using search engines, making the overall OA percentage 20,4%. Chemistry (13%) had the lowest overall share of OA, Earth Sciences (33%) the highest. In medicine, biochemistry and chemistry publishing in OA journals was more common. In all other fields author-posted manuscript copies dominated the picture.The results show that OA already has a significant positive impact on the availability of the scientific journal literature and that there are big differences between scientific disciplines in the uptake. Due to the lack of awareness of OA-publishing among scientists in most fields outside physics, the results should be of general interest to all scholars. The results should also interest academic publishers, who need to take into account OA in their business strategies and copyright policies, as well as research funders, who like the NIH are starting to require OA availability of results from research projects they fund. The method and search tools developed also offer a good basis for more in-depth studies as well as longitudinal studies. During the past two decades, scientific journal publishing has undergone a veritable revolution, enabled by the emergence of the World Wide Web. This revolution contains two interconnected phases. The first, and to date most visible, is the rapid shift from print only journals to parallel print and electronic publishing The second stage in this revolution is access to articles without any restrictions posed by subscriptions, commonly referred to as Open Access Open Access journals provide one solution to the problem of restricted access to results of publicly funded research. The other is supplementing the dominant subscription-based literature by free copies of the manuscripts, posted by the authors or their institutions on different types of web sites. In the early days the home pages of the authors or their departments was the typical place, and often the only place, to put such copies. Today digital copies are increasingly posted in subject-specific repositories such as the renowned arXiv, which started out focused on physics papers but has since expanded its disciplinary scope, or alternatively in repositories maintained by individual universities for providing archiving and access to the output of their faculty. A majority of international publishers actually allow the posting of some versions of published articles, sometimes after a delay, in such repositories. This latter solution to the access problem is often by OA activists called the “green route” as opposed to the “gold route” of direct OA journal publishing Over the past fifteen years there has been a lot of debate about the economics of OA versus subscription based publishing A central question many policymakers ask is consequently how common Open Access is today and how fast the share of OA is increasing? What proportion of journal articles are OA and to what extent do researchers post OA copies in repositories? Accurate answers to such questions would be very valuable for instance for research funders, university administrators and publishers. The purpose of the study reported on in this paper is to provide answers to this type of questions.Although some estimates of OA prevalence have been published over the last few years, there is a clear need for rigorously conducted and up-to-date studies. So far the volume of OA has been studied for instance in the following ways.For gold OA publishing it has been possible to establish an overall share of OA journals by comparing the number of OA journals listed in the DOAJ index to the total number of active peer reviewed scholarly journals listed in the Ulrich's Periodicals directory.For green OA there are directories listing repositories and statistics of how many documents these contain.For particular limited disciplines it is possible to take the content in a few leading journals and check the availability of OA copies using web search robots and manual checking for full-text copies Broader studies can be conducted using discipline-specific or global samples using article titles taken from indexing services which are then searched for using popular web search engines For larger masses of articles the availability of full text versions OA can be checked by web crawling robots All these methods suffer from limitations. On average OA journals publish far fewer articles per annum than subscription based ones Our objective in this study was to make a rigorous assessment of the overall share of the peer reviewed article literature, which is available as OA, either published directly or made available as copies in different sorts of repositories. Furthermore, the variations in the OA availability based on the scientific discipline was also of interest, as well as the breakdown of the available OA copies into types of gold or green publishing and also based on the quality of the copy for green.Our methodology was based on making random samples of articles and then testing for the availability of OA copies using the most widely used web search engine (Google). The research set-up was in line with an earlier study we carried out in the winter of 2008 The central research question was: Given a set of peer reviewed journal articles fulfilling some given criteria, what proportion can be found openly on the web, either published directly in open access journals, in journals practicing delayed or selective OA publishing, or via copies posted on the web.Central to our research design was measuring OA prevalence on an article basis, not on calculating the share of journals which are OA. In the first instance the set of journal articles comprised all peer reviewed articles published globally in a given recent year. Obviously the definition of a scholarly journal article lacks in clarity, but usually there is an assumption that the article reports on original research, has undergone anonymous peer review of some sort, is shorter in length compared to monographs and is published in an issue of a regularly appearing serial publication. For practical reasons we have to use the lists of journals provided by indexes such as Ulrich's, Web of Science, Scopus and DOAJ as a basis for any comparison. These indexes do not have 100% coverage of all the journals that would fit our definition, especially for journals published in other languages than English, but the task of finding data is simplified enormously.A prerequisite for carrying out this type of study is the availability of information on the web, either available freely or via subscriptions. A second important border condition is the availability of information in indexes of different sorts which facilitate and speed up the analysis. Firstly, this concerns in particular basic information about journals, and secondly meta-information about scholarly articles.Our main data sources have been the following:Ulrich's Periodicals Directory is the standard source of information about periodicals of all sorts, containing basic information about more than 200000 journals. Using its search features it is possible to extract data about approximately 25000 journals meeting the requirements of scholarly/academic, active and refereed.ISI's Web of Science contains bibliographic information about all the articles published in around 8000 peer reviewed journals. Although only about one third of the journals in Ulrich's are indexed by the ISI, the coverage of the number of articles published is much bigger, since Web of Science includes most high quality and high volume journals Scopus is a rather new service produced by Elsevier, which offers the same types of features as Web of Science. For our purposes Scopus is very useful since its coverage of journals (around 15000) is more comprehensive than that of the Web of Science. Additionally, SCImago is a free service on the web, which based on data in Scopus calculates citation indexes for journals in the much the same way as JCR .The Directory of Open Access Journals (DOAJ) contains basic information about Open Access scholarly journals. It currently contains information about almost 5000 journals, of which around 2/3 are also included in Ulrich's.Early on in the project a decision was made to construct a master journals database, using relevant information extracted from all the aforementioned sources. Criterion for inclusion was that the journal was active and peer reviewed, and that it was listed in at least one of the four databases . Using these principles, a database containing information in excess of 30000 journals was built. For about half the journals, those indexed in Scopus, the database also included information about the number of articles published per year as well as measures of the frequency with which articles in the journal are cited in other journals.The base year, which we studied, was 2008. A delay of slightly over one year after publication was important because many publishers using delayed OA use a 12 month embargo period. Also some publishers allowing green OA posting have a one year delay. We did the majority of the article searching during September–October 2009.The full body of literature of interest consisted of all the peer reviewed articles in all the different fields of science. In constructing the samples there were two contradictory considerations; getting big enough samples for reasonable statistical significance, and keeping the sample sizes small enough to save time in the time-intensive article searches. An additional constraint was that the indexing services used are set up in such a way that the number of downloadable search result items is severely limited, and no assurance of the randomness of the results which are output can be given.For the purpose of this study, the problem of obtaining random samples was solved by using the advanced search facility of Scopus, which allows searching for articles based on the first or the last page number of the article. One problem with the samples we obtained in this way, is that journals publishing issues that always start from the number one, rather than having numbering that continues throughout the year, would have a higher probability of being included. In addition some journals may have several volumes in the same year. Also some rare journals might have multiple short articles on the same pages. One way to avoid the first problem was to choose relatively high numbers (over 100) as parameter values. On the other hand the page numbers used cannot be much higher than 100 since this would imply a clear bias towards high volume journals. Due to the fact that some articles might be classified under multiple subject areas (a feature of Scopus), we used different first pages for different subjects, to avoid the same article accidentally being included in several samples. In the end we obtained a few journals with multiple articles in the samples. Duplicate journal entries were deleted so that each journal only was represented once in resulting sample.Since each journal consequently had an approximately equal chance to get into the sample these do not well represent the population of articles as a whole. To compensate for this we weighted the results with the yearly number of articles published by the journals in question, this data could be found for almost all journals in the SCImago database. Thus the adjusted results are representative of the overall mass of articles. Provided that sufficiently large samples were constructed, this should lead to getting approximately the same results as by having a fully randomised sample of articles from the start. But with relatively small samples the influence of a few sampled articles from big volume journals with over 1000 articles published per year became disproportionate. For this reason, additional articles were included for the 26 largest volume journals so that more reliable results, particularly concerning the availability of green copies from the journals in question, could be obtained.The differences between disciplines were handled by construction of sufficiently large samples of articles for each scientific discipline using the Scopus breakdown. Scopus was first queried for a distribution of the articles published in 2008 according to discipline. Since the database allows the classification of individual articles as belonging to several disciplines at the same time the total number of articles obtained via discipline-specific searches (1.97 M) exceeds the number of unique articles (1.27 M) by 54%. Despite this we felt that we could use this split to determine the overall proportions of the global article output by discipline.Scopus has a breakdown of 28 disciplines, some of which are rather small in their overall article counts. For our purposes we merged some of the categories, for instance several small subdisciplines of medicine. Our aim was to obtain large enough samples for each of our disciplines to make meaningful comparisons across disciplines. In order to obtain samples of approximately equal sizes we varied the number of allowable first pages from discipline to discipline. Our grouping of disciplines and the sample sizes we obtained are shown in There are two larger disciplines, Medicine and “Engineering in broad”. Areas related to Medicine could equally well have been merged with Medicine. Mathematics is a rather small area, but difficult to group with others. We kept it separate because of previous knowledge that it is rather interesting from an OA perspective.Since the searching for OA copies and establishing the type of the found copy is very labour-intensive, we decided to use the results obtained using the discipline-specific breakdown to also construct the global averages. We could not just merge the samples into one, since smaller disciplines would have become overrepresented. Instead, we used the proportions of the disciplines in the overall output of 2008 see as weighThe logical way of researching the OA prevalence is to do searches in some web search engine based on the titles of individual published articles. This in fact mimics what most readers would do if they find an interesting citation to an article, but without a direct hyperlink to click on. Other researchers have used a combination of different search engines . Norris, Oppenheim and Rowland (2008) Since several people took part in the searching we were concerned about the integrity and uniformity of the collected data. As a consequence, an easy-to-use data collection tool was developed in the Visual Basic for Applications macro language.The main functionality consisted of linking the web browser with the bibliographical data so that an automated web search could be triggered by selecting a specific article in the search tool. An important consideration was to have the tool take up as little screen space as possible in order to avoid flipping back and forth between windows, a screenshot of the tool together with an ordinary web browser can be seen in The search term was the full title of the article, and clicking through results restricted to the first ten hits on Google. Our experience indicated that if the article was to be found at all, it usually showed up in the 5–6 first hits and the later search results were usually references to the original article included in other articles.Most of the articles were only accessible via subscription, and in some cases an article was not accessible at all due to the journal having no online content. These articles were classified as not found. Some cases for which open full texts were found they were discarded from the sample altogether, if it was obvious that the item was not a peer reviewed scholarly article or that it was misclassified by the source database and clearly belonged to another discipline.For original articles found at the publisher's official site or at a site like High-Wire Press, which hosts the electronic versions of journals, we classified the article into direct OA, delayed OA and article-specific OA. In some cases articles were found which were OA on subscription sites, but which were sample free copies or openly accessible only by accident, clearly against the site policy. We classified these as not found, since we were only looking for individual articles which if OA were likely to stay so for the foreseeable future. This is the case for paid OA in schemes such as Springer's Open Choice and Oxford Open. In some cases several hits to OA full text versions were found. We instructed the searchers to include information about only one copy, in the following order of preference if several were found: OA journal site, Subject-based repository, Institutional repository and Other web site.We also studied the type of copy found in the repositories and on other web sites. In addition to direct copies of the article as published, a separate category was identified as so-called authors manuscripts which are accepted for publishing, but still need to have the final copyediting and page layout completed . “Preprint” versions which are earlier versions of a submitted manuscript, were also accepted since they are considered very important in some fields of science (for instance working papers in economics). A preprint version was accepted only if it had exactly the same title as the published article. Often conference articles and working papers are earlier versions of later peer reviewed and published articles, but use slightly different titles.The articles in each sample file were searched for and the results were classified by one researcher. After that the findings were cross-checked by another researcher (often the research leader), with focus in particular on the classifications of found OA copies. This led to only minor changes in the observations.As reported above our method was not a fully random sampling method with the disciplines. Due to the complexity of the method it is not possible to calculate exact confidence intervals for the OA-shares. What we can do is to calculate confidence intervals for a few of our results, under the assumption that we had been able to use fully random samples, thus ignoring the complexities of the first page search and normalising by journal size. In the following table we have calculated confidence intervals for 95% confidence level for a few cases.margin of error is defined as the radius of the confidence interval. Denoting the margin of error by c, we can compute an estimate for the minimum margin of error that can be attained under a fixed sample size n, estimated value p, and level of confidence We note that the The weighted average OA availability over all disciplines was 20,4%. This further splits up into 8,5% in OA journals and 11,9% copies in repositories and web sites.Since many previous and parallel studies have been based on samples from ISI indexed journals, we tested our results by dividing our material into two groups: Articles indexed in ISI journals, and articles not indexed in ISI (but found in Scopus) ‘For practical reasons we used the subject classifications derived from Scopus to weight the results. The results are shown in The overall OA-results are relatively similar for the ISI and non-ISI subsets. The results indicate also that the proportion of gold OA is clearly lower in the ISI subset. This could be explained by the fact that it has been more difficult for relatively new journals to get accepted into ISI, than into Scopus. On the other hand, the proportion of green copies is much higher in the ISI subset. A plausible explanation could be that authors are more likely to put copies of their higher quality articles in repositories. The split of the OA journal articles into categories is shown in the For green copies there are two breakdowns of interest, the type of repository and the type of copy. These are shown in In the subject-based repository category the most frequently encountered repositories were arXiv and PubMedCentral. Institutional repositories were of an archival calibre, often implemented by using either the D-Space or the E-prints software. Copies of papers uploaded by the authors to web pages at their own departments, often using non systematic addressing, were classified as other web site. Typically, this kind of web pages were authors' homepages consisting of for example CVs and links or samples of published research papers.The availability of gold and green OA copies by scientific discipline are shown in There is a clear pattern to the internal distribution between green and gold in the different disciplines studied. In all the life sciences, gold is the dominating OA access channel. The picture is reversed in the other disciplines where green dominated. The lowest overall OA share is in chemistry with 13% and the highest in earth sciences with 33%.Our results concerning the overall OA share are well in line with the results of the study we did of 2006 articles The difference is within the confidence intervalThe two studies used partly different methodsThe share of OA is changing with time and two years had lapsed between the studies.The most thorough study we have found to compare our results with is Matsubayashi et al (2009) Their material included both peer reviewed articles and news items etc. They reported an OA percentage of 26,3 for peer reviewed articles (70% of their sample), and if the overall share of OA articles requiring registration is subtracted the number comparable to our study would be 25,9%.Due to the high number of articles analyzed, their confidence interval should be rather narrow and their results rather reliable from a statistical viewpoint. Currently Pubmed offers a search facilty in which one search term is “link to free full text”. We did a search for all “journal articles” published in 2005 with no restrictions (636162 hits) and then repeated this with the further restrictions of “link to free full text”. The OA percentages obtained this way were 23,1 for 2005 and 23,3 for 2008. The figure should include all OA journals (full and delayed) as well as full text deposited in Pubmed Central (either as exact replicas of author manuscripts).It should be noted that Matsubayashi et al (2009) The difference between their results and our results could be caused by a number of factors:Use of Pubmed vs. Scopus as a source for article dataDifferent base year and time delay from publishing to searching for copiesDifferent search strategy. We only used Google. Matsubayashi et al used four different databases and search engines to identify full text copies. They also checked the 20 first results in Google and Google Scholar whereas we only checked the first page.The method of obtaining the sample (a search based on the pagination of articles) was the same but we compensated for the possible bias towards small journals by multiplying by the number of articles published per year.In a study concerning the journal output from 2003, Mc Veigh (2004) Bhat (2009) In a study of the citation advantage of OA Norris, Oppenheim and Rowland (2008) Way (2010) The study with the biggest sample of articles was Hajjem et al (2005) The clear majority gold articles that we found in our study were in pure gold journals (62%). Articles in delayed OA journals only summed up to 14%. Studying the prevalence of delayed OA articles is much more difficult than pure OA ones, since the journals containing the latter tend to be listed in DOAJ, whereas just about the only site where more aggregate information about delayed OA journals can be found is the Highwire Press website, listing around 200 of the journals they host as offering delayed OA.We found that 24% of gold articles were individually paid OA articles on subscription sites. This seems to be in line with the few reports available on the actual uptake of this option by authors. For instance The overall breakdowns of green copies according to type of repository and type of copy should also be of interest. Since the overall “hits” in each category are rather small we decided not to publish the figures per discipline since they would be very unreliable from a statistical point of view. We can just note that in a few disciplines subject-based repositories dominated, in medicine PubMedCentral and in physics arXiv.It may come as a surprise that only one out of four green copies was found in institutional repositories. A lot of effort has recently been put into starting such repositories and issuing university guidelines encouraging and requiring academics to post copies there. But compared to the leading subject-based repositories these have had a shorter lifespan so far. Other web sites, in particular the authors' home pages were still the most popular places for placing copies (40%).Morris and Thorn (2009) Fry et al (2010) The high share of exact copies we found was slightly surprising, considering the types of copyright restrictions the major publishers pose. In fact, a number of clearly illegal copies were found, where the publishers' files had been copied, usually without proper attribution. Usually these were on the authors' or their departments' home pages. It was also very noticeable that preprints were mainly posted in a few disciplines; mathematics, economics and physics in particular. These areas are known to have traditions of making manuscripts available in the form of preprints or working papers We will not attempt a more detailed discussion about the possible reasons for the differences between disciplines (for good discussions see Uneven spread of available OA journals across disciplinesUnequal possibilities for financing author chargesAvailability of well established subject based repositories in some disciplinesTraditions of making preprints available in some subjectsAll in all we believe our results should be of interest to science policy makers and scientists alike, providing one of the most comprehensive cross-disciplinary OA studies to date. There are numerous ways to extend the method we have used, for instance comparing more in detail the quality of OA articles compared to non-OA articles. A comparison of the OA availability of articles originating from different countries would be of great interest, since OA has been seen as a great way for authors of developing countries to get their research results better known.

In this study, we used genetic data that we collected in Central Asia, in addition to data from the literature, to understand better the origins of Central Asian groups at a fine-grained scale, and to assess how ethnicity influences the shaping of genetic differences in the human species. We assess the levels of genetic differentiation between ethnic groups on one hand and between populations of the same ethnic group on the other hand with mitochondrial and Y-chromosomal data from several populations per ethnic group from the two major linguistic groups in Central Asia.Our results show that there are more differences between populations of the same ethnic group than between ethnic groups for the Y chromosome, whereas the opposite is observed for mtDNA in the Turkic group. This is not the case for Tajik populations belonging to the Indo-Iranian group where the mtDNA like the Y-chomosomal differentiation is also significant between populations within this ethnic group. Further, the Y-chromosomal analysis of genetic differentiation between populations belonging to the same ethnic group gives some estimation of the minimal age of these ethnic groups. This value is significantly higher than what is known from historical records for two of the groups and lends support to Barth's hypothesis by indicating that ethnicity, at least for these two groups, should be seen as a constructed social system maintaining genetic boundaries with other ethnic groups, rather than the outcome of common genetic ancestryOur analysis of uniparental markers highlights in Central Asia the differences between Turkic and Indo-Iranian populations in their sex-specific differentiation and shows good congruence with anthropological data. Central Asia is located on the Silk Road, where numerous ethnic groups characterised by different languages and historical modes of subsistence co-exist. These include the Tajik populations, who speak an Indo-Iranian language and are sedentary agriculturalists, and several Turkic populations, who speak an Altaic language and are traditionally nomadic herders ,2. HowevHowever, the level at which Central Asian groups are genetically differentiated, in particular for the Y chromosome, remains unclear. Indeed, it remains to be understood whether the genetic variation differentiates primarily ethnic groups or whether it differentiates primarily populations within ethnic groups . More generally, the underlying question is whether ethnicity is the major determinant of genetic differences between populations. We are also interested in understanding better the processes leading to the emergence of ethnic groups, and in understanding the extent to which constituted ethnic groups are endogamous. One focus of this study was to assess the levels of genetic differentiation between ethnic groups on one hand and between populations of the same ethnic group on the other hand in order to understand better how ethnicity shapes the genetic diversity of human populations, and to give insights on the processes leading to the formation of ethnic groups. To address this question, we sampled several populations per ethnic group (from 2 to 6 populations per ethnic group) from the two major linguistic groups in Central Asia.An additional aim of this study was to use genetic data to understand better the history and formation of particular Central Asian ethnic groups. Indeed, parts of their history remain controversial. Among the Turkic groups, the Karakalpaks, Uzbeks and Kazakhs are thought to be subgroups of the same Uzbek confederation that emerged during the fifteenth century following the collapse of the Golden Horde after the dissolution of Genghis Khan's empire. The Karakalpak group emerged more recently and resulted from a split from the Kazakh confederation in the seventeenth century. However, the origin of the Kyrgyz living in Kyrgyzstan is still a matter of debate in the scholarly literature. Late in the eighth century the Kyrgyz state was a major rival of the Great Turkic Empire and later defeated the Uighur in the ninth century. The prevailing current opinion is that part of this Kyrgyz population moved from South Siberia to Kyrgyzstan in the fifteenth century and included some nomadic groups that inhabited the region for several centuries. Turkmen tribal genealogies trace their origin to the Oghuz who lived in the area in the sixth century. The agriculturalist Tajik sedentary populations speak a western Indo-Iranian language that entered the area through the Muslim invasion in the tenth century, and are perhaps descendants of former eastern Indo-Iranian speakers who have lived there for more than two millennia. For all historical references see ,2. In thWe investigated how the genetic variance, based on mtDNA haplotype frequencies (HVS-I sequences) was distributed in a hierarchical mode using an AMOVA analysis . The oveTABLE 1When taking into account all populations, no correlation between genetic and geographical distances was detected at the global level . This lack of correlation remains if we test separately for each language family.With respect to the Y chromosome, the AMOVA analysis performed using the 20 populations showed that about 5.6% of genetic differentiation is due to differences among ethnic groups (P < 0.02) and that the overall differentiation between populations is RST = 0.186 (P < 0.001). When populations were grouped by language affiliation/mode of subsistence -- Turkic versus Tajik -- ~9.1% of the genetic variability was due to differences between these two groups. In addition, the analysis at the intra-group level revealed a high degree of differentiation both for Tajik and Turkic populations except for the two Uzbek populations. List of suage. 1: , 4: 14]List of sClick here for file

Expression microarrays are increasingly used to obtain large scale transcriptomic information on a wide range of biological samples. Nevertheless, there is still much debate on the best ways to process data, to design experiments and analyse the output. Furthermore, many of the more sophisticated mathematical approaches to data analysis in the literature remain inaccessible to much of the biological research community. In this study we examine ways of extracting and analysing a large data set obtained using the Agilent long oligonucleotide transcriptomics platform, applied to a set of human macrophage and dendritic cell samples.2 units ( 6% of mean). The common practise of working with ratios of Cy5/Cy3 signal offers little further improvement in terms of reducing error. Comparison to expression data obtained using Arabidopsis samples demonstrates that the large number of genes in each sample showing a low level of transcription reflect the real complexity of the cellular transcriptome. Multidimensional scaling is used to show that the processed data identifies an underlying structure which reflect some of the key biological variables which define the data set. This structure is robust, allowing reliable comparison of samples collected over a number of years and collected by a variety of operators.We describe and validate a series of data extraction, transformation and normalisation steps which are implemented via a new R function. Analysis of replicate normalised reference data demonstrate that intrarray variability is small , while interarray variability from replicate array measurements has a standard deviation (SD) of around 0.5 logThis study outlines a robust and easily implemented pipeline for extracting, transforming normalising and visualising transcriptomic array data from Agilent expression platform. The analysis is used to obtain quantitative estimates of the SD arising from experimental intra- and interarray variability, and for a lower threshold for determining whether an individual gene is expressed. The study provides a reliable basis for further more extensive studies of the systems biology of eukaryotic cells. The application of microarray technology to study the expression of thousands of genes in biological samples has become commonplace. The diversity of technologies initially explored has been replaced by a landscape dominated by a small number of proprietary platforms, which differ principally in the type of probe used for hybridisation. Each platform has advantages and disadvantages, and knowledge of technical reproducibility and sources of data variability is crucial to optimising experimental design and data analysis. The reproducibility and comparability of several different platforms has been rigorously examined in the MAQC project, and overall the different platforms give reassuringly similar results, with similar accuracy and sensitivities .We have collected a large number of array data sets from Agilent human genome arrays . The latAlthough there are now many published studies using the Agilent arrays, there is a paucity of studies systematically investigating the reproducibility and sources of variation in this microarray platform. There is also relatively little software for implementation of data preprocessing for this platform. Using a set of data generated from this array platform, we dissect the major contributors to experimental variability within the data. We develop a new R package (agilp) to extract data from Agilent raw data files, and implement a robust Loess normalisation to a mean of multiple experiments. This reduces variability to a level which allows accurate and informative comparisons between array data sets collected at different times and by different operators. We also demonstrate that the low level expression detected by the Agilent arrays for the majority of genes in any one cell type likely corresponds to a genuine high degree of transcriptomic complexity, and is unlikely to arise from weak non specific cross-hybridisation. The results of the study thus give confidence to studies which use this technology and quantify important performance parameters which can be used to optimise the design and interpretation of future transcriptomic experiments.We initially examined a set of 77 data sets independent of magnitude, and improve the fit to a Gaussian normal distribution. Both these assumptions were therefore tested on the set of reference arrays.2 transformed data is shown in fig 2 = 0.87). Log2 transformation substantially stabilises the SD (fig 2 = 0.22).The relationship between SD and mean magnitude of signal across the arrays for each array feature, using raw and log0.55)fig . Further2 transformed data were analysed. Log2 transformed data were therefore used for all further analysis.The normality of the distribution of the signal across the arrays was tested using the Shapiro Wilk test for each probe individually. The fit varied widely for different probes. However, the proportion of probes whose distribution did not differ significantly from normality (p > 0.05) increased from 55% to 78% when Log2 units for the Cy5 signal, and 0.16 log2 units for the Cy3 signal provides a good measure of intra-array variation. This variation can be evaluated using 263 oligonucleotides which are replicated 10 times in different positions of the 4 × 4 Human genome Agilent arrays, and a "negative control" oligonucleotide (3 × SLv1) which is present 153 times. The average SD for each set of 10 replicates for each of these 263 probes (including the negative control) was calculated. The calculation was repeated for data from five randomly chosen arrays. The average SD was 0.20 logWe next examined the variation which arises from experiments involving different arrays. In order to isolate the variation arising from technical variables from variation arising from differences in the biological samples being tested, we first analysed variation in the Cy3 signal, which represents hybridisation of an identical biological sample 77 times Table .In order to reduce variability by correcting for systematic differences between arrays we normalised the data by simple linear or LOESS local linear regression against the mean signal of all the samples (i.e. a model in which the mean and the slope is held constant).2 = 0.93). The normalisation of this array by subtraction of the regression model provided appropriate correction of the signal values , and a local linear regression model (LOESS ) gives a better overall fit across the whole set of arrays. Using the normalised data, we calculated the average SD for each probe (the genewise SD) across the set of arrays , the stimulation index in the green channel is positively correlated to the stimulation index observed in the red channel. This effect is only seen at high stimulation indices, and the correlation is lost once the difference in signal is less than 3 logThe phenomenon is illustrated in fig One feature of Agilent arrays is a very large number of probes have a low signal value, close to, but significantly above background. This is illustrated by a comparison between the signal distribution obtained from one representative sample compared to the distribution of the signal from the "negative control" probe provided by Agilent fig .These data might support a hypothesis that a large number of genes are being transcribed in any one cell type. However, the conclusion is reliant on the the negative control supplied by Agilent. We therefore tested the hypothesis independently. In view of the very large evolutionary distance between Arabidopsis and humans, and the process of Agilent selection of probe sequences so as to avoid repetitive elements or highly conserved common sequences, we predicted that the plant RNA samples should show very little true hybridisation to the arrays. In contrast, if the low level signals were as a result of random low stringency interactions, this should occur to a similar extent using the plant as the human samples. The log signal frequency distribution for the average of three Arabidopsis samples was compared to the signal distribution for human samples fig . The majThe data from the Arabidospis samples could be used to calculate an upper limit for "false positive" detection, and hence estimate the proportion of probes showing real positive signals with the human samples fig . In orde2 transformed and Loess normalised as detailed above were analysed using classical multidimensional scaling (MDS), a powerful unsupervised approach to identify relationships between sets of arrays. Since the distance matrices are based on Euclidean distance metrics this analysis is mathematically equivalent to Principal Component Analysis.Having established the basic parameters of error/variability, we examined whether global patterns of gene expression were reproducible and robust when comparing data collected over a time period of several years, and by different operators. The same data set of arrays logk for different numbers of dimensions to look for an obvious "step" in the slope fig . There aions fig :(2)i is the ith eigenvalue. A value of around 0.8 (at which around 80% of the SD has been accounted for) has been proposed as a good cut-off for adequately representing the original data . Ten dWe first examined the distribution of arrays from the point of view of cell type fig . The ranWe next examined the distribution in relation to stimulus fig . The denWe carried out two additional sets of hybridisations to test the reproducibility of the arrays over time. Two old samples of macrophage RNA (LPS stimulated ) were relabelled in Cy3, and hybridised to new arrays together with old stored Cy5 labelled samples . The old and new arrays cocluster, irrespective of dye labelling or long term storage fig . In partIn addition, we analysed a set of 12 newly prepared Mutz-3 derived dendritic cell arrays fig includinIn this study, we have developed a pipeline for processing and analysis of data obtained using the Agilent human 44 K expression array platform. We have assessed commonly adopted preprocessing computational procedures, tested reproducibility of the method and the determinants of variability. Interestingly, investigation of the true background signal intensity, suggested that there is low-level transcriptional activity across most of the genome even in highly differentiated macrophages and dendritic cells. Finally, we have illustrated the application of multidimensional scaling to interrogate complex relationships between individual expression profiles in a large data set.2 transformation did not completely standardise variance vis a vis intensity, and in situations where this becomes critical, additional more complex alternative transformations can easily be incorporated e.g. [We confirmed that logarithmic transformation of the raw data facilitates downstream data processing by significantly reducing the dependence of the SD on the signal intensity, and by improving approximation to a normal distribution for many probe signals. Logted e.g. .A large number of different approaches to data normalisation have been explored in order to improve the reproducibility of array data, particularly with the objective of comparing data generated from different experiments -12 . ManThe use of two colour ratio normalisation, which is possible with the Agilent platform but not Affymetrix, is in fact implemented in the proprietary normalisation supplied by Agilent. The advantage of this normalisation, over global array normalisations, is that it can theoretically correct for probe specific systematic errors. However, as shown in equation 1, ratios decrease variance only when correlation between channels is high, and noise in the "reference" channel is small. Previous studies have in fact suggested that the Agilent normalisation protocol is sub-optimal. In fact, as illustrated in Table 2 unit should be detectable even with rather low sample sizes. However, future studies using spike-in controls, and including comparisons to q-PCR data will be required to validate the analysis given here, and to determine the true discriminatory power of the data. More precise modelling, using probe specific variances computed from the large set of reference arrays, or more sophisticated Bayesian inference [In summary, the preprocessing steps implemented in this study significantly reduce the variation due to experimental, rather than biological variation. This value provides a good estimate of the overall SD of the signal attributable to the various sources of intrinsic "experimental error". Given the Gaussian nature of log signal variation for most probes, differences between experiments of one lognference may furthThe presence of a very large number of probes showing low level hybridisation prompted us to try and distinguish background from low level gene transcription. Hybridisation of the Arabidopsis samples established a realistic background cut-off to determine the boundary at which genes may be considered to be ON or OFF, and showed transcriptional activity for approximately 70% within human macrophage samples. This degree of transcriptional diversity suggests transcription is going on across the majority of the genome even in a single cell type, and is in accord with recent estimates of cell transcriptional complexity obtained from deep sequencing ,16, and In general, the power of genome-wide arrays lies in its ability to define a global transcriptomic response, made up of complex patterns of interacting genes. In order to analyse the extent to which these patterns remained reproducible and robust in the face of experimental error and variation, we used MDS which is equivalent to principal component analysis for continuous Euclidean distance measurements and retains more of the information than conventional hierarchical clustering.MDS analysis of the macrophage/dendritic cell data set confirmed that the key underlying structure of the data set is robust, and that sample relationships are conserved even when samples are collected at different times, and by different operators. For example, the distinction between macrophages and dendritic cells, between normal and leukaemic dendritic cells, and between resting and LPS stimulation were all very robust to underlying experimental variation. Of interest, the biologically meaningful variables such as those described above, usually segregated from the "artifactual" variables into a different dimension. Since the MDS axes are orthogonal this suggests that the biological and artifactual variables are often determined by non-overlapping sets of gene probes, and the identification of these genes is the subject of on-going analysis.Agilent long oligonucleotide expression arrays represent a robust and increasingly affordable tool for mapping transcriptional activity within the majority of human open reading frames. With correct data processing and normalisation, the genewise variability can be reduced to a few % of the average signal intensity. The pipeline of protocols for data collection, processing and subsequent analysis developed in this study fig allows rSample collection. The methods for human cell sample collection, array hybridisation and sample collection have all been described previously ,19. A suThe reference sample is the Stratagene Universal Human Reference reagent, which consists of a mixture of RNA from ten different human cell lines .Seeds of Arabidopsis thaliana (L.) Heynh. were obtained from the Nottingham Arabidopsis Stock Centre. Plants were grown on 0.8% agar with 0.25 × MS salts, adjusted to pH 5.6 with NaOH, under conditions described previously . At 19 dLabelled cRNA samples were generated from RNA samples using the Low RNA Input Fluorescent Linear Amplification Kit according to the manufacturer's instructions . cRNA was synthesised from the double-stranded cDNA using T7 RNA polymerase, incorporating Cyanine 5-labelled CTP fluorescent dyes . Labelled cRNA samples were cleaned using the 'RNA Cleanup' protocol for RNeasy columns (Qiagen) performed at 4°C and eluted using two 30 μL volumes of nuclease-free H2O. Mean dye incorporation for labelled cRNA was 19.53 pmol dye μg-1 cRNA.http://www.agilent.com. Array images were acquired with Agilent's dual-laser microarray scanner G2565BA (5 μ resolution) and signal data were collected with dedicated Agilent Feature Extraction software (v9.5.1).Hybridisation of the Agilent 4 × 44 K whole human genome cDNA microarrays according to manufacturer's instructions http://www.ebi.ac.uk/arrayexpress, accession number E-TABM-942). A summary of the samples is given in supplementary Table S1.The original scanner output files and the normalized microarray data (see below) have been submitted to the ArrayExpress database http://cran.r-project.org/web/packages/.The R code for the extraction of raw data from scanner files, removal of duplicates, and Loess normalisation, is available (as function "AAProcess" in package agilp) from the R CRAN repository. http://bioinformatics.mdanderson.org/Software/OOMPA/, and the function cmdscale from the stats package.The statistical analysis was mostly carried out in R. The functions Shapiro.test and ks.test were used to test for normality. Multidimensional scaling was carried out using the functions distanceMatrix (using Euclidean distance) from the package ClassDiscovery, part of the OOMPA suite of libraries HB and JH provided the Arabidopsis labelled RNA samples, and contributed to revision of the manuscript. JR, JT and WP prepared all the other RNA samples, and carried out all the hybridisations. MN supervised the RNA preparation, labelling and hybridisation. BC carried out the data analysis, wrote the R scripts, and prepared the first draft of the manuscript. The study was carried out under the joint direction of BC and MN. All authors read and approved the final version of the manuscript.Table S1: The details of all the arrays analysed in this study. An Excel file containing the basic experimental annotation for each array analysed, together with a data base identifier.Click here for file

Infantile colic is a common problem among young infants. Cow’s milk allergy has been suggested as one of the causes. We aimed to investigate the value of the cow’s milk skin test for the diagnosis of cow’s milk allergy in exclusively breast-fed infants with infantile colic.Exclusively breast-fed infants with infantile colic were enrolled in this study. On the first visit, the average hours of crying of the infant in a 24-h period were recorded and the cow’s milk skin test was performed. If the infant had a positive skin test, elimination of cow’s milk from the mothers’ diet was advised. Infants with negative skin tests were divided into case and control groups. Cow’s milk was eliminated from the diet of mothers in the case group. After 2 weeks, the number of hours of crying were recorded again. The reduction in the crying hours was compared between the two groups using the chi-square test.Skin tests were positive in 3 of 114 cases (2.6%) of infantile colic. All three cases recovered completely following elimination of cow’s milk from the mother’s diet. Among the 111 patients with negative skin tests, 77 patients completed the study: 35 in the case group and 42 in the control group. The reduction in crying hours in infants in the case group was not significantly different from that in the control group.Elimination of cow’s milk from the mothers’ diet is not beneficial for infants with a negative skin test. Infants with a positive skin test may benefit from this management. Infantile colic affects up to 28% of infants in the first few months of life.19The role of cow’s milk allergy in infantile colic is controversial.1113This single-blind randomized clinical trial was done on exclusively breast-fed infants with history of infantile colic. All suspected cases of infantile colic between the ages of 3 weeks and 3 months were seen by a pediatrician, who diagnosed infantile colic on the basis of a complete history and thorough physical examination. Other probable etiologies were ruled out. Diagnosis of infantile colic was made on the basis of Wessel criteria, i.e., severe crying in infants between 3 weeks and 3 months old, occurring at least 3 days per week and lasting 3 hours per day.15For each infant, the parent(s) were asked about the average number of hours of crying in 24 hours and this was recorded. After explaining the nature of the study to the parents and obtaining written informed consent, SPT was performed for all the infants. SPT was done on the volar aspect of the forearm by an expert nurse, under the close supervision of a pediatric allergist, with cow’s milk extract , fresh cow’s milk, histamine dihydrochloride (as a positive control), and glycerol (as a negative control). All necessary precautions for management of any possible adverse reaction were taken. Reactions were read after 15 minutes, and a response was considered positive if the mean diameter of the wheal was at least 3 mm more than the negative control.Infants with a positive SPT were excluded. The rest were divided randomly into case and control groups. For infants in the control group, no change in the mother’s diet was suggested and the parents were instructed to bring their babies for follow-up 2 weeks later. Mothers of infants in the case group were asked to avoid cow and goat milk as well as dairy products for 2 weeks. These mothers were prescribed calcium supplements and were instructed to take a calcium-rich diet. The infants in the case group were also seen again at follow-up 2 weeks later.P=.05 indicated statistical significance.On the second visit, the same parents were asked about the average number of hours of crying per day, and the infants were reexamined by a pediatrician who did not know the group allocation of the infants. Those infants whose crying hours were decreased by 1–2 hours per day were labeled as partial responders, and decrease in crying hours by more than 2 hours per day was considered a complete response. No difference in number of crying hours or a decrease of less than 1 hour per day was labeled as no response. Infants whose parents did not follow all of the instructions and those who were not brought for follow-up after the first visit were excluded from the study. The responses of the case and control groups were compared using the chi-square test. Figure 1. The change in the number of crying hours in the case and control groups were compared using the chi-square test, but no statistically significant difference was seen between the two groups (Table 1).Of 153 exclusively breast-fed infants with colic, the parents of 114 cases allowed us to do the SPT. Among these infants, three cases had a positive SPT (2.6%). For these three cases, elimination of cow’s milk products from the maternal diet resulted in complete recovery. The 111 SPT-negative cases were randomly divided into case and control groups. Of these infants, 35 infants of the case group (mothers asked to avoid cow and goat milk and other dairy products) and 42 infants of the control group (regular diet) returned for follow-up after 2 weeks. The different stages of the study are detailed in In this study, the effect of cow’s milk allergy was evaluated in infantile colic through two methods: elimination diet and SPT. SPT with cow’s milk was performed for 114 cases with infantile colic and was positive in 2.6% of cases. Previous studies have demonstrated that SPT has a high specificity and low sensitivity for immediate-type food reactions in infants under the age of 1 year.In this study the elimination of cow’s milk and dairy products from the diet of mothers of exclusively breast-fed infants with negative SPT had no effect on the attacks of colic. The effect of a low-allergen diet on infantile colic has been studied in multiple studies and has shown different results. Hill et al studied the effect of a low-allergen diet on colic among breast-fed infants.Evans and coworkersOur study had several limitations. There was a high dropout rate and the number of positive SPTs was low. Because of the nature of the intervention, the study could not be conducted as a double-blind trial. Furthermore, although the gold standard method for detection of food allergy is a double-blind placebo-controlled challenge test, because of the self-limiting nature of colic, the challenge test was not conducted in these infants.

In the crystal, extensive O—H⋯O hydrogen bonding results in the formation of 12-membered {⋯HO}6 synthons and one-dimensional supra­molecular chains with further O—H⋯S inter­actions providing additional stability to the linear chain with base vector [01The title compound, [Cd(C Acta Chim. Sin.65, 2868–2874].For background to supra­molecular polymers of zinc-triad 1,1-dithiol­ates, see: Tiekink 2003; Lai et al. 2002; Chen et al. 2006; Benson al. 2007. For the al. 2007. Note ad5H10NO2S2)2(C10H8N2)] = 0.053wR(F2) = 0.116S = 1.135262 reflections310 parameters4 restraintsH-atom parameters constrainedmax = 0.56 e Å−3Δρmin = −0.98 e Å−3ΔρCrystalClear used to solve structure: PATTY in DIRDIF92 (Beurskens et al., 1992SHELXL97 (Sheldrick, 2008ORTEPII (Johnson, 1976DIAMOND (Brandenburg, 2006publCIF (Westrip, 2009Data collection: 10.1107/S1600536809049678/hb5241sup1.cifCrystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809049678/hb5241Isup2.hklStructure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF reportAdditional supplementary materials:

The mechanisms involved in the disappearance of the DAPC are not completely understood. The muscles of mdx mice express normal amounts of mRNA for the DAPC components, thus suggesting post-transcriptional regulation.In mdx compared to wt mice, we demonstrated that miR-222 specifically binds to the 3′-UTR of β1-syntrophin and participates in the downregulation of β1-syntrophin. In addition, we documented an altered regulation of the 3′-UTR of β1-syntrophin in muscle tissue from dystrophic mice.We investigated the hypothesis that DAPC reduction could be associated with the microRNA system. Among the possible microRNAs (miRs) found to be upregulated in the skeletal muscle tissue of These results show the importance of the microRNA system in the regulation of DAPC components in dystrophic muscle, and suggest a potential role of miRs in the pathophysiology of dystrophy. Dystrophin is a cytoplasmic protein belonging to a large oligomeric complex that associates with other proteins, including sarcoglycans, syntrophins, dystroglycans, syntrobrevin, and sarcospan mdx mouse. In these animals, all the muscles lack dystrophin, however, mdx mice show a much milder phenotype than DMD patients mdx mice are affected to a different extent, physical exercise worsens the pathology, similar to that observed in the human disease Different animal models are available to study the different dystrophies. The most commonly used laboratory animal model of DMD is the mdx mice and in the muscular explants obtained from patients with DMD or BMD, it has been suggested that the degradation system is involved in inhibiting DAPC proteins expression in dystrophy Studies using these animal models of different myopathies revealed that the DAPC is tightly regulated. A deletion or mutation in the gene of one of the components of the DAPC leads to destabilization of the entire complex and a strong reduction in the intracellular concentration of the other proteins mdx mice and DMD patients. Here, 11 miRs were found to be dysregulated in both types of samples and were suggested to be involved in the pathways implicated in the response to muscle damage.In recent years, mounting evidence has shown the pivotal role of small, non-coding RNAs, such as microRNAs (miRs), in the negative regulation of gene expression mdx and transgenic mice (α-and β-sarcoglycan knockout mice) normal levels of mRNA for the different components of the DAPC were detected, in spite of the absence of the corresponding proteins, thus ruling out transcriptional regulation of the specific mRNAs mdx mouse model of DMD. We analyzed both mRNA and protein levels of syntrophins and dystroglycans, and focused our study on evaluating the regulation of β1-syntrophin. By analyzing the 3′ untranslated region (3′UTR) of β1-syntrophin, we found that three miRs could target this protein, and we established that one of these, miR-222, is upregulated in the muscles of mdx mice and is involved in the downregulation of the β1-syntrophin isoform in dystrophic muscles.To date, no information is available regarding the function of these dysregulated miRs in the different myopathies. We addressed the potential role of miRs in the pathogenesis of DMD, considering that, in muscle tissue obtained from mdx dystrophic mice.It has been previously reported that when one of the DAPC components is genetically absent, other proteins of the complex are likewise reduced, and complex formation is ultimately impaired. To confirm this phenomenon, we monitored the mRNA levels, protein expression and immunolocalization of four DAPC components in different muscles obtained from normal and Dag) encodes for a single polypeptide that is post-translationally cleaved into two subunits, α-dystroglycan (α-dag) and β-dystroglycan (β-dag) dag mRNA level, was observed in the gastrocnemius muscles of young mdx mice compared to those of wild type (wt) animals. With increasing age, a 50% decrease in dag mRNA level was observed in the dystrophic muscles compared to the muscles of wt adult animals , suggesting that a reduction in β1-syntrophin protein level is a general phenomenon.mdx muscles could not be explained by a decrease in gene transcription. Therefore, our studies focused on post-transcriptional mechanisms implicated in the regulation of β1-syntrophin.These data showed that the levels of dystroglycans and α-syntrophin were not significantly modified in dystrophic muscles. In contrast, the level of β1-syntrophin was clearly decreased, and this reduction in mdx mice and wt mice, and whether this phenomenon was dependent on the 3′-UTR of β1-syntrophin. To this end, the 3′-UTR of the mRNA encoding β1-syntrophin was cloned into the pEGPF-C1 expression vector, allowing us to assess 3′-UTR regulation by examining GFP expression. First, we verified that the construct pEGFP-3′-UTR-β1-synt was expressed in transiently transfected COS1 cells, and that introduction of the 3′-UTR of β1-syntrophin into the plasmid did not constitutively induce GFP expression (data not shown).The 3′-untranslated regulatory regions (3′-UTRs) of mRNAs play an important role in the regulation of mRNA translation. Therefore, we investigated whether the expression of β1-syntrophin was differentially regulated in skeletal muscles between mdx mice. The electroporation procedure induced minimal tissue damage, evaluated by histological observation of the electroporated muscles (data not shown). The results revealed that GFP was consistently detectable in muscle fibers when the empty vector pEGPF-C1, or the pEGFP-3′-UTR-β1-synt construct were transfected into the muscles of wt mice were identified by the different databases utilized.2C12 cell lines, and in skeletal and heart muscle tissues obtained from five-month-old wt mice. Northern blot analysis revealed that all the three miRs were expressed in pooled samples of skeletal muscle tissues, as well as in proliferating C2C12 myoblasts and differentiated myotubes (data not shown). Next, we investigated whether the differential expression of these miRs occurred in the muscles of mdx mice compared to those of wt animals. RNA was prepared from wt and mdx skeletal muscle tissues at different ages to follow the disease progression.As the first step, we determined whether the three selected miRs were expressed in myogenic cells, such as primary mouse satellite cells and Cmdx mice compared to those from wt mice. In particular, a 50% increase in miR-222 levels was observed in the muscles of 20- and 30-day-old mdx mice, and a maximum of three-fold increase was evident in the muscles of five-month-old mdx animals . MiR-222 expression was significantly elevated in the gastrocnemius muscles from animals . Thus, t−8M) caused a decrease of 50% in luciferase activity, in agreement with the inhibitory effect observed in other cellular systems by the same miR To determine whether the β1-syntrophin mRNA is the real target of miR-222, the activity of a luciferase reporter construct containing the 3′-UTR of β1-syntrophin RNA was evaluated in the presence of miR-222. To perform this experiment, the 3′-UTR of β1-syntrophin was cloned into the pGL3 vector, and the construct was transiently transfected into COS1 cells cultured in the absence or presence of different concentrations of miR-222. At the end of the incubation time, the cells were lysed and processed to measure the luciferase activity of the synthesized enzyme. The results showed that luciferase activity was dose-dependently decreased by miR-222 and no luciferase activity was detected when a “scrambled” negative control or an anti-miR specific to miR-222 was used in its place . The hig−8M of miR-222. As shown in The 3′-UTR of β1-syntrophin contains two putative consensus sites for miR-222 binding. To confirm the target specificity of miR-222, two pGL3-3′UTR β1-syntrophin constructs, carrying deletions of the complementary sequences that could potentially be involved in the binding of miR-222, were used. Luciferase activity was measured in the cells transfected with the vector mutated in binding site 1 (mut1), or in binding site 2 (mut2), in the presence of 5×10As shown by the luciferase activity assays, miR-222 efficiently targeted the 3′-UTR of β1-syntrophin. To address the role of miR-222 in regulating β1-syntrophin expression, we investigated the effect of overexpressing or silencing miR-222 on endogenous β1-syntrophin levels in cells. β1-syntrophin is expressed at different levels in several tissues, with the highest expression level observed in the liver mdx mice. When miR-222 was overexpressed in satellite cells from wt mice, a 40% reduction in β1-syntrophin level was observed; this reduction was abolished when miR-222 activity was blocked by the corresponding antagomir and the ethical guidelines for animal care of the European Community Council (directive 86/609/ECC).mdx mice were obtained from the Charles River Laboratories Italia s.r.l. and were housed in the animal facility of the Department of Histology and Medical Embryology under a 12-h light-dark schedule at a constant temperature and with food and water ad libitum. Animals were sacrificed by carbon dioxide asphyxiation. To minimize unnecessary suffering, before gene delivery into tibialis muscles, the mice were anesthetized by an intra-peritoneal injection of a solution of 80 to100 mg/kg ketamine +10 mg/kg xylazine .C57BL/6J mice and After the animals were sacrified, skeletal muscle tissues were collected and divided into three pieces: two were frozen in liquid nitrogen for RNA and protein extractions, and one was frozen in liquid nitrogen cooled isopentan, for immunological studies. All samples were stored at −80°C.http://microrna.sanger.ac.uk; http://www.targetscan.org; http://www.microrna.org.We used the target prediction programs: the Miranda package and targetscan, available at the following website location: mdx mice of different ages. Four different RNA samples were prepared, each from tissue pools obtained by combining muscles from multiple mice . Total RNA was extracted using the Trizol reagent according to the manufacturer's instructions. RNA expression was determined by northern blot analysis and/or qRT-PCR + membrane . Blotted membranes were fixed by UV crosslinking and heating at 80°C for 1 h, and processed for hybridization. Hybridization was carried out overnight at 38°C in a hybridization buffer containing 5X SSC , 20 mM Na2HPO4 pH 7.2, 7% SDS, 50% formamide, 50 µg/ml salmon sperm DNA and 106 cpm/ml of radiolabed probe. The probes were oligonucleotides synthesized on the basis of sequences complementary to the corresponding miR or the TaqMan MicroRNA Assay kit according to the protocol for use in the Applied Biosystems 7500 Fast Real-Time PCR System. For quantification analysis the comparative threshold cycle (Ct) method was used. The Ct values of each gene were normalized to the Ct value of GAPDH or Sno142 in the same RNA sample. Gene expression levels were evaluated as fold change using the equation 2The primers used are reported in The 3′-UTR of β1-syntrophin was synthesized by RT-PCR. The mRNA sequence of β1-syntrophin was retrieved from GenBank (U89997). Based on this sequence, oligonucleotide couples flanking the 3′-UTR were designed, synthesized and used as primers for RT-PCR. The PCR product was cloned into a PCR-TOPO vector , sequenced and, subsequently, subcloned into a luciferase reporter plasmid, pGL3basic for luciferase assay. The same 3′-UTR DNA fragment was subcloned into pEGFP-C at the 3′-end of the EGFP construct in which GFP expression is driven by the CMV promoter. Mutations in the 3′-UTR of β1-syntrophin, were introduced using the Quick Change site-directed mutagenesis kit . Oligonucleotide primers for cloning and mutagenesis are listed in Transfection was performed using the Lipofectamine 2000 reagent according to the manufacturer's protocol.To assess luciferase activity, COS-1 cells were cultured in DMEM supplemented with 10% fetal calf serum. One day prior to the transfection, the cells were plated onto 12-well plates at a density of 80,000/well. The next day, the cells were co-transfected with 1 µg of the pGL3 constructs, and appropriate amounts of miR and Lipofectamine 2000. The cells were cultured for 4 h in DMEM without serum or antibiotics. Afterwards, the medium was changed, and the cells were incubated in medium supplemented with serum. After 24 h, the cells were collected and homogenized in 70 µl of lysis buffer . The cell lysates were centrifuged for 5 min at 12,000 g. Luciferase activity was detected using the luciferase reporter assay system (Promega) and measured by a luminometer. Protein concentration was determined by the BCA assay .−8 M miR-222 or antimiR-222 . After an incubation of 4 h in medium without serum or antibiotics, the cells were incubated for another 36 h in medium supplemented with serum. At the end of the incubation time, the cells were collected and homogenized in 70 µl of Laemmli buffer. The following cell lines were used: C2C12 and Hep2 .For western blot analysis, the cells were plated at a density of 70,000/well and transfected either with or without 5×102C12 cells were transfected with miR-222 or antimiR-222 and the expression levels of miR-1, miR-133, miR-206 were measured. One day prior the transfection, the cells were plated at a density of 10,000/cm2. The next day the cells were co-transfected with 5×10−8 M miR or antimiR and Lipofectamine 2000. The cells were cultured for 4 h in DMEM without serum or antibiotics. Afterwards, the medium was changed, and the cells were incubated in medium supplemented with serum. After 24 h, the cells were collected, and RNA was prepared using the Trizol reagent as indicated above.In another series of experiments, Cmdx mice in total) were minced by a razor blade and then digested by collagenase/dispase. The resulting cellular suspension was plated for a few hours to remove contaminating fibroblasts, and the unattached muscle cells were collected and plated on collagene-coated dishes in DMEM supplemented with 10% serum. The cultured cells were later processed for transfection experiments and western blot analysis.Primary cell cultures were performed according to Matthew et al. mdx mice were homogenized in lysis buffer supplemented with proteinase inhibitors, boiled for 5 minutes and centrifuged at 12,000 g for 10 min mdx mice.)Frozen muscle tissue samples from wt and Protein aliquots ranging from 30–40 µg were separated by electrophoresis on a 10% SDS-acrylamide gel and transferred onto a nitrocellulose membrane. The blotted membranes were blocked in TBS-T containing 5% nonfat dry milk for 30–60 min at room temperature, and then incubated with specific antibodies diluted in the same buffer, overnight at 4°C. The membranes were washed several times with TBS-T and then probed with secondary antibodies coupled to horseradish peroxidase. The immunoreactive bands were visualized by chemiluminescence . Densitometric analysis was performed using the AIDA 2.2 image software. The optical density (OD) of each signal was normalized to α-actin. The following antibodies were used: mouse anti-α syntrophin , goat anti β1-syntrophin , rabbit anti-β1-syntrophin , mouse anti α-β syntrophins , mouse anti-α and anti-β-dystroglycan , and mouse anti-actin and anti-tubulin .mdx mice were lysed in RIPA buffer and aliquots containing 1 mg of protein extracts were incubated overnight at 4°C with an antibody anti α-β-syntrophins . The protein-antibody complex was recovered by incubation with protein G-sepharose, separated on SDS-PAGE and probed with an anti-β1-syntrophin antibody.Immunoprecipitation analyses were performed following a standard protocol as previously described . Images were obtained with a Zeiss AxioCam HRc using the Axiovision software.To determine the localization of different proteins, immunofluorescence analysis, was performed as documented The following antibodies were used: α-dystroglycan clone VIA4-1 , β-dystroglycan clone 43DAG1/8D5 , α-syntrophin RA16-1 , β1-syntrophin clone C20 .mdx adult mice were used.For this analysis, a total of n = 3 wt mice and n = 3 mdx mice (n = 5) or 5-month-old mdx mice (n = 2) In vivo experiments were performed on 30-days-old wt (n = 3) and Several 7-µm thick cryostat sections, upstream and downstream of the injection site were prepared, GFP expression was examined using a Zeiss Axioskop2 plus fluorescence microscope . As a control for gene delivery, PCR and RT-PCR analyses were performed on genomic and RNA samples, respectively. Oligonucleotide primers for GFP are listed in P values of less than 0.05 were considered statistically significant.Data are presented as mean ± standard deviation (SD) or standard error (SE). Statistical significance between groups was determined using the GraphPad Prism software. The non parametric-Mann-Whitney test was done for the analysis of RNA expression, protein expression and luciferase activity when sample groups were small. The unpaired t-test was performed to assess the significativity of gene delivery experiments. Figure S1mdx mice of different ages and were resolved by SDS-PAGE and transferred to nitrocellulose membrane. The membrane was probed with α and β-dystroglycan antibodies. Representative western blots are shown. The graph values represent the mean ± SD of the densitometric analyses from three independent experiments; the data are presented as the percentage of protein in mdx mice compared to that in wt mice, normalized to endogenous tubulin expression level. B: The gastrocnemius muscle sections from wt and mdx adult mice were probed with α and β−dag antibodies and visualized using secondary antibody coupled to a fluorescent marker, Texas red or FITC.Dystroglycan protein expression. A: Total protein extracts were obtained from the gastrocnemius muscle tissues of wt and (7.35 MB TIF)Click here for additional data file.Figure S2β1-syntrophin protein expression. A representative experiment of immunoprecipitation is shown. Whole homogenates obtained by RIPA buffer extraction were immunoprecipitated with an antibody against syntrophins. The immunomplexes were separated on an SDS-PAGE and probed with a β1-syntrophin specific antibody. The experiment was performed twice with similar results.(0.28 MB TIF)Click here for additional data file.Figure S32C12 cells transfected with miR-222 (5×10−8M) or anti-miR-222 (5×10−8M) were assessed by qRT-PCR; relative gene expression was calculated by the comparative Ct method (2−ddCt). The Ct values of each miR were normalized to the Ct value of sno142 in the same RNA samples. RNA levels in cells treated with miR-222 or anti-miR-222, are expressed as fold change compared to those in the untreated cells. A representative of the two performed experiments is shown. All values represent the mean ±+ SD from triplicate samples.miR-222 modulation of myogenic miRs expression. RNA levels of miR-206, miR-1, and miR-133 in C(2.02 MB TIF)Click here for additional data file.

Xenopus, manipulated to be of comparable size, exhibited stagespecificantibody expression. The production of adult-type higher-affinity anti-DNPantibodies proved to be independent of the age and size of the individual and isconcomitant with the completion of metamorphosis. The appearance of new antibodyspecificities at such a time suggests that their expression occurs with the cell turnoverand renewal during a period of morphological changes.Tadpole and adult

Mechanisms for improving photodynamic therapy (PDT) were investigated in the murine RIF1 tumour using meso-tetrahydroxyphenylchlorin (m-THPC) or bacteriochlorin a (BCA) as photosensitisers and comparing these results with Photofrin-mediated PDT. The 86Rb extraction technique was used to measure changes in perfusion at various times after interstitial PDT. Non-curative combinations of light doses with m-THPC and BCA PDT markedly decreased vascular perfusion. This decrease was more pronounced for both new photosensitisers than for Photofrin. Comparison of tumour perfusion after PDT with tumour response revealed an inverse correlation for all three photosensitisers, but the relationship was less clear for m-THPC and BCA. In vivo/in vitro experiments were performed after Photofrin or m-THPC PDT in order to assess direct tumour kill (immediate plating) vs indirect vascular effects (delayed plating). For both photosensitisers, there was little direct cell killing but clonogenic survival decreased as the interval between treatment and excision increased. When m-THPC PDT was combined with mitomycin C (MMC), light doses could be decreased by a factor of 2 for equal tumour effects. Lower light and m-THPC doses could be used compared with Photofrin PDT in combination with MMC. BCA PDT with MMC did not result in a greater tumour response compared with BCA PDT alone. Reduction in both light and photosensitiser does for effective PDT regimes in combination with MMC offers substantial clinical advantages, since both treatment time and skin photosensitisation will be reduced.

The present work addresses the use of zootherapy in folk veterinary medicine (ethnoveterinary) by the residents of the municipal district of Cubati, microregion of Seridó, Paraíba State, Brazil. It sought to identify the principal animals used as medicinal sources for zootherapeutics and to contribute to the preservation and sustainability of this traditional knowledge.© Excel 2007 software, and the species were identified by photographic registration and subsequent bibliographical surveys.Field research was undertaken on a weekly or biweekly basis during the period November, 2006, to January, 2007. Free, semi-structured, and open interviews were made with local residents of the municipal district of Cubati as well as with venders in public markets. A total of 25 individuals of both sexes were interviewed (with ages varying from 26 to 78 years) although only 16 were finally chosen as informants as these people demonstrated the greatest degree of knowledge concerning zootherapeutics. Graphs and percentages were generated using MicrosoftOvis aries), pigs (Sus scrofa), cattle (Bos taurus), and foxes (Cerdocyon thous) were mentioned by 62.5, 43.75, 37.5, and 31.25% of the informants, respectively, as being used in folk veterinary medicine. Additionally, chameleons (Iguana iguana), chickens , and rattlesnakes were mentioned by 75, 43.75, and 31.25% of the informants, respectively. Relatively simple animal illnesses, such as furuncles, or injuries resulting from embedded thorns or skin eruptions are responsible for the largest number of zootherapeutic treatment, while, diseases of greater complexity, such as rabies and brucellosis, were not even mentioned. Fat from various animals constituted the most frequently cited resource used for its medicinal-veterinary properties.Mammals constitute the main medicinal zootherapeutic source for folk veterinary medicines in the studied area, both in terms of the total number of species used and the frequency of their citation. Sheep (The examination of folk knowledge and health practices allows a better understanding of human interactions with their local environment, and aids in the formulation of appropriate strategies for natural resource conservation. There were neither doctors nor veterinarians or nothing" (a 74 year old man)Humans have utilized animals to produce drugs for treating illnesses and injuries since ancient times ,2. HowevIn the last few years, folk knowledge of traditional populations has been recognized as being of significant importance in several areas of the natural sciences – as the study of ethnoscience – with the prefix "ethno" referring to the knowledge systems of traditional cultures . The stuThe present work examines the ethnoscientific knowledge linked to the use of animals (zootherapeutics) as sources of medicines in folk veterinary medicine (ethnoveterinary). This term was firstly used by McCorkle in the mid 1980's to designate the "people's knowledge, abilities, methods, practices and beliefs concerning animal health care". Mathias emphasizEthnoveterinary is a valuable tool with great potential, if used in a sustainable manner . In poorHowever, very little ethnoveterinary knowledge has been documented in Brazil in spite of its great local importance. In many areas (such as the interior of Paraíba) this folk knowledge is rapidly disappearing – with traditional medicine being set aside in favor of modern medical practices, and veterinary drugstores are now frequently found in formerly isolated areas.The decline of popular veterinary medicine in different parts of the world has been described by authors such as Jacob et al. and Math2 tried different things and what they learned they passed on to us" .Experiences transmitted through generations are known by memes – recognizable fragments of cultural information that are transferred from person to person within a culture . CognitiCrotalus durissus) and foxes (Cerdocyon thous) reported as used here, and it will be important to make the local residents aware of the necessity of preserving the animals that inhabit the caatinga biome and to avoid over-exploiting these otherwise renewable natural resources beyond their recovery capacities.Brazilian laws prohibit hunting wild animals, such as the rattlesnakes ("We cannot capture armadillos or foxes because the agents from IBAMA prohibit it. The fines are too high (...). Formerly we had a lot of armadillos to eat and to make medicine. Today only a few remain. .World Conservation Union (IUCN).This does not imply that natural resources should not be used, however, for with well-managed conservation efforts these animals could continue to be viable sources of low-cost veterinary pharmaceutical substances for the local population within the concept of the "Sustainable use (whether extractive or non-extractive) is a dynamic process in which an effort is made to maintain biodiversity and to reinforce ecological and socio-ecological services, recognizing that the larger the patrimony and the more the government participates, the greater will be the probability of reaching these objectives for present and future generations" for us as it is for the animals" (a 74 year old woman).In the present work, a disease is considered any type of anatomical or physiologic alteration of an animal as compared to its normal state. Among the fifteen zootherapeutics cited Table , there iSus scrofa), cows (Bos taurus), and sheep (Ovis aries) are commonly raised in the area, while rattlesnakes , chameleons (Iguana iguana), and the teju lizards (Tupinambis merianae) are reptiles frequently encountered in the local caatinga vegetation. Mammalian species were mentioned 36 times , while reptiles were cited 24 times (32%) , mentioned by 75% of the interviewees (N = 12), produces a type of body fat that aids in wound healing and is used to promote the natural expulsion of foreign bodies from cows, horses, and chickens.As can be seen in Table tissues ; while s"When there is a thorn embedded in a cow just put chameleon fat on top of it. After about 3 days it pulls the thorn out" (a 70 year old woman)."Chameleon fat is a very good medicine. I use it for removing thorns from cows and donkeys" (a 66 year old man).Ovis aries) was mentioned by 62.5% of the interviewees (N = 10), who cited its use for treating several health problems in animals, including problems with their horns, wounds, embedded thorns, and furuncles, among others. Table Mastitis, an inflammation of the mammary glands, is the most common and expensive disease of dairy cows in most of the world affecti. The sueThe frequent use of sheep suet as therapeutic resource for treating animal diseases may be related to the regional abundance of this animal. The reason why the suet must come from a castrated animal was explained in different ways by different individuals:"Because un-castrated sheep don't have fat, do they? But a castrated sheep does. It is thicker" (a 74 year old man)."Because it works for medicine; because when it melts it becomes a fine oil, while the suet of a normal sheep becomes a thick oil when it melts" . The use of human urine was mentioned by 18.75% (N = 3) of the interviewees as a therapeutic agent. Cattle poisoned by feeding on cassava (Manihot utilissima Pohl.) are forced to drink it. The preparation is quite simple, requiring only mixing a cup of urine in 3 liters of water. The confirmed use of this treatment indicates that humans, too, can be considered a zootherapeutic resource."If a cow eats cassava it has to be given people's urine to drink as quickly as possible, because it could die quickly" (a 26 year old man).Lyssavirus) [Brucella abortus) [Babesia bovis, Babesia bigemina, and Anaplasma marginale) [Aphthovirus) – as there is an annual governmental vaccination program and the cattlemen are obligated to vaccinate their herds.Medicines prepared by the local residents were observed to have widespread applications, often serving not just for a single species, but for many of the animals that they raise. It was noticed during the visits and interviews that certain pathologies such as rabies (savirus) , brucellabortus) , and bovrginale) do not hIn terms of the number of different kinds of zootherapeutics used to treat a given illness, 7 folk medicines were mentioned for treating furuncles, followed by 6 zootherapeutics used in the treatment of embedded thorns and sores (not furuncles); only single zootherapeutic uses were mentioned as treatments or cures for rheumatism, edemas, peri-ocular irritations, food intoxication, torsions and snake bites demonstrated a wide knowledge of natural products used as medicinal resources for themselves as for their domestic animals, and zootherapy plays a principal role in the prevention or cure of illnesses in that region.The inhabitants of Cubati who deal with ethnoveterinary medicine often employ zootherapeutics in treating similar ailments that affect their domestic animals that are otherwise used to treat human diseases or illnesses, following an intuitive similarity between humans and other mammals.Mammals supply the largest number of veterinary medicines in terms of their citation frequencies, followed by reptiles, birds and, infrequently, insects. However, only relatively simple to moderately complex illnesses or diseases are treated with zootherapeutics. The simplest infirmities, such as furuncles, embedded thorns, sores, and wounds, had the largest number of zootherapeutic treatments cited , while moderately complex medical problems, such as uterine prolapse, arthritis, rheumatism, and bovine gangrenous coryza had few zootherapeutic treatments or cures . The preservation of popular medicinal knowledge is important to enhance our understanding of the relationships between society and nature, and to elaborate more effective strategies for conserving natural resources.

Breast feeding has long term effects on the developing immune system which outlive passive immunization of the neonate. We have investigated the transfer of milk immune cells and examined the result of transfer once the recipients were adult.Non-transgenic mouse pups were foster-nursed by green fluorescent protein (GFP) transgenic dams for 3 weeks and the fate of GFP+ cells was followed by FACS analysis, immunohistochemistry and RT-PCR for GFP and appropriate immune cell markers. Pups suckled by non-transgenic dams served as controls.Despite a preponderance of B cells and macrophages in the stomach contents of the pups, most cells undergoing trans-epithelial migration derived from the 3–4% of milk cells positive for T lymphocyte markers. These cells homed to the spleen and thymus, with maximal accumulation at 3–4 weeks. By sensitizing dams with an antigen which elicits a T cell-mediated delayed-type-hypersensitivity (DTH) response, we determined that nursing by a sensitized dam (compared to a non-sensitized dam) amplified a subsequent DTH response in females and yet suppressed one in males.These results suggest that clinical evaluation weighing the pros and cons of nursing male versus female children by mothers with genetically-linked hypersensitivity diseases, such as celiac disease and eczema, or those in regions of the world with endemic DTH-eliciting diseases, such as tuberculosis, may be warranted. Breast milk is a complex biological fluid providing essential nutrients for the development of newborns The role of breast milk immunoglobulins in the passive transfer of immunity is well accepted and immunoglobulins from the milk of many animal species have been shown to be transported across neonatal intestinal epithelium into the circulation via the milk T cell function is poorly developed at birth, demonstrated both by an infant's poor ability to reject tissue grafts, and lower proliferation of T cells when challenged with a mitogen ad libitum.A breeder pair of C57BL/6 (B6) mice that express a transgene coding for GFP under the control of the human ubiquitin C promoter (UBI-GFP/BL6GFP), which will be referred to as GFPtg, and a breeder pair of control B6 mice were obtained from the Jackson Laboratories . The GFPtg mice express GFP in all tissues, with B and T cells expressing higher levels. In addition, levels of GFP expression are uniform from cell to cell within a particular lineage, changing little during development Mice were coordinately mated and wildtype B6 pups were fostered by GFPtg dams. The snouts of the dams were painted with vanilla extract prior to exchanging pups to prevent pup rejection. Organs from fostered pups were collected at weeks 1, 2, and 3 of nursing and one week post weaning (week 4) for RT-PCR, immunofluorescent staining, and flow cytometry. Additionally, fostered pups were allowed to age to 4 months and were themselves mated with each other to examine lactating mammary glands from fostered females as well as small intestines from the resulting pups.Organs were collected from fostered pups at 1, 2, 3, and 4 weeks, and 4 months of age and frozen in liquid nitrogen. For intestinal samples, the lumen was thoroughly flushed with Dulbecco's PBS (DPBS) prior to freezing in liquid nitrogen to ensure removal of any unincorporated maternal cells. Samples were pulverized using a mortar and pestle in liquid nitrogen. Total RNA was then isolated from the samples using Tri Reagent .12–18 Primer and M-MLV Reverse Transcriptase (Invitrogen) for 1 hour at 37°C. Primers for GFP, Oct-4, β-Casein, or GAPDH were used for PCR amplification using the AccuPrime Taq DNA Polymerase System (Invitrogen). Thirty cycles of PCR were used for GFP using the primers 5′ GCC-GAC-AAG-CAG-AAG-AAC-G 3′ (forward) and 5′ TCC-AGC-AGG-ACC-ATG-TGA-T 3′ (reverse), for Oct-4 using the primers 5′ GGG-ATG-GCA-TAC-TGT-GGA 3′ (forward) and 5′ AGC-TTG-GCA-AAC-TGT-TCT-AG 3′ (reverse), and for β-Casein using the primers 5′ ATC-CTC-GCC-TGC-CTT-GT 3′ (forward) and 5′ TGT-GGG-ACG-GGA-TTG-C 3′ (reverse) and 26 cycles for GAPDH using the primers 5′ CCT-TCC-GTG-TTC-CTA-CCC 3′ (forward) and 5′ GGT-CCA-GGG-TTT-CTT-ACT-CC 3′(reverse) at 94°C for 30 sec, 55°C (54°C for β-casein) for 30 sec, 68°C for 30 sec, followed by extension at 72°C for 7 min. Amplification products were separated on a 2% agarose gel, stained with ethidium bromide, and photographed. Each experiment was repeated at least 3 times, from at least 3 different fosters, and each repetition gave similar results.RNA concentrations were determined spectrophotometrically and equal amounts of total RNA (5 µg) were reverse transcribed using Oligo(dT)Organs were fixed in 4% formaldehyde in DPBS for 2 h at room temperature. Organs were then transferred into 30% sucrose in DPBS and kept at 4°C overnight before freezing in Tissue Tek OCT compound . Twenty micron sections were made and post-fixed in acetone and blocked with 5% FBS, rabbit IgG , and mouse IgG, Fc Fragment in DPBS. For CD4, CD8, B220, and F4/80 staining, 5% rat serum was also added to the blocking solution. For macrophage staining using tomato lectin, 0.1% Triton-X 100 was added to the blocking solution. Sections were then stained with Alexa-conjugated rabbit anti-GFP, and purified rat anti-mouse CD4 monoclonal antibody , purified rat anti-mouse CD8a monoclonal antibody , purified hamster anti-mouse TCR γδ monoclonal antibody , purified rat anti-mouse CD45R/B220 monoclonal antibody , biotinylated-lycopersicon esculentum (tomato) lectin , or biotin anti-mouse F4/80 antigen antibody . For the purified hamster anti-mouse TCR γδ monoclonal antibody a secondary biotin anti-hamster cocktail was used. For the purified rat anti-mouse CD45R/B220, CD8a, and CD4 antibodies, secondary biotin polyclonal anti-rat Igs were used. The antibodies were visualized using Streptavidin-conjugated fluorophores . Slides were mounted with ProLong Antifade (Molecular Probes) and analyzed using the Pathway HT Confocal Microscope . At least 3 different fostering experiments were performed and immunofluorescent staining of slides was conducted on tissue sections from 6 different animals. For each animal, two 20 µm sections were examined and 6 fields approximated as representative of the whole section, were visualized by confocal microscopy at 1000× magnification. Positively stained cells per field were counted and percentages were calculated.Coagulated milk from GFPtg dams was obtained from the stomach of fostered pups. This was then pressed through a 70 µm cell strainer . Cells were washed with DPBS twice to remove milk solids and lipids. Spleen and thymus were made into a single cell suspension by pressing the organ through a 70 µm cell strainer (BD Biosciences). For spleens, red blood cells were lysed using red blood cell lysing buffer (Sigma). Cells were counted and Fc receptors were blocked using mouse IgG, Fc Fragment . Cells were then surface stained with Allophycocyanin (APC)-conjugated rat anti-mouse CD8a monoclonal antibody , Alexa Fluor 700-conjugated rat anti-mouse CD4 monoclonal antibody and Phycoerythrin (PE)-conjugated hamster anti-mouse γδ T cell receptor monoclonal antibody . Additionally, milk cells were stained with Pacific Blue-conjugated rat anti-mouse B220 antibody , APC-conjugated hamster anti-mouse CD3e monoclonal antibody , and Biotin-conjugated rat anti-mouse F4/80 antibody . The secondary antibody Streptavidin-PE was used for F4/80 staining. Cells were stained intracellularly with anti-GFP, rabbit IgG fraction, Alexa Fluor 488 antibody and Pacific Blue rat anti-mouse/rat Forkhead box P3 . Prior to intracellular staining, cells were first treated with the Cytofix/Cytoperm Kit (BD Pharmingen) as suggested by the manufacturer. Cells were fixed in 1% paraformaldehyde and were washed and resuspended in FACS buffer (5% FBS in PBS) prior to analysis. Cells were analyzed using the FACSAria Cell Sorting System (BD Biosciences) and FACS Diva Software (BD Biosciences). Wildtype B6 and GFPtg control spleens were used as compensation controls. Cells from wildtype B6 organs were used as background staining controls and this background fluorescence was subtracted from all samples. Staining results for spleen and thymus presented are the average of at least 8 different samples from at least 4 different fosters. In each case, >30,000 events were recorded. Staining of milk cells is the average of 11 different samples.Candida albicans into both flanks at least 5 days prior to being coordinately mated. B6 pups were then foster nursed by either sensitized or non-sensitized GFPtg dams. When the foster nursed pups reached the age of 8 weeks, they were challenged with Candida albicans protein antigen in the footpad. In a second set of experiments conducted with the same dams (3 months post-sensitization at time of fostering), 8 week old foster-nursed pups were sensitized with an intradermal injection of fixed Candida albicans into both flanks and then received a second injection 7 days later with Candida albicans protein antigen in the footpad. Footpads were measured prior to the second exposure and 24 hours post-challenge (peak footpad swelling) using a micrometer .Female GFPtg mice were sensitized with an intradermal injection of fixed t test with corrections for multiple comparisons against a single control group, where appropriate. Data are expressed as means±SEM and p<0.05 was considered statistically significant.For delayed type hypersensitivity (DTH) experiments, statistical significance was determined by the Mann Whitney test. For all other experiments, statistical significance was determined using the two-tailed Student's via the milk under normal conditions of nursing, we first determined whether the GFP+ milk cells were viable after extraction from the stomach of the pups. Although we expected viable cells at the 1 week time point, we were surprised by the fact that greater than 80% of the cells in the milk were viable at 2 weeks. To determine the likelihood of cell transfer from mother to pup We then examined whether the GFP+ cells in milk traversed the small intestinal epithelium of the pup. Results were considered positive if at least two out of three methods utilized were conclusive. GFP+ cells were found incorporated into the epithelium of the small intestine in recipient pups continually foster-nursed by GFPtg dams at 1 and 2 weeks of age, as determined by both RT-PCR and immunofluorescent staining . The numThe next issue of importance was characterization of the cell types being transferred. Co-staining revealed that the GFP+ cells crossing the epithelium were not macrophages, as determined by both tomato lectin in red, and F4/8Further immunofluorescent staining showed the transferred cells to be CD4+ and CD8+After confirming the transfer of immune cells and determining the majority phenotype, we next sought to ascertain whether these cells migrated to other organs or regions. The liver, kidney, large intestine, mesenteric lymph nodes, Peyer's patches and lung were investigated by RT-PCR for GFP, but no evidence of the migration of GFP+ cells to these organs was observed during the four week time course examined (data not shown).GFP+ cells temporarily migrated to the spleen as concluded from the result of FACS analysis and RT-PCR for GFP at 3 weeks of age and the FACS analysis interestingly and clearly showed that CD4+ cells preferentially migrated to the spleen . CD8+ ceTissues from older animals (four months old), foster-nursed by GFPtg dams, were examined to determine the longevity of transferred cells. In only one of six animals examined for this purpose, the ileum with Peyer's patches and no other tissue contained GFP+ cells. Long term survival is therefore possible, but not representative. In an additional experiment, four month old recipient mice were mated with each other. The lactating mammary glands from the females were then examined for the presence of GFP+ cells by RT-PCR. The small intestines of the pups resulting from these matings were also examined. No positive GFP RT-PCR signal was detected in either case (data not shown).Candida albicans. Sensitized or non-sensitized GFPtg females were mated and then their non-transgenic foster pups were challenged with purified Candida antigen. There was no evidence of transferred sensitization with this protocol (data not shown). In a second set of experiments, the same dams (sensitized or not) were re-mated and at 8 weeks of age, the pups were themselves sensitized and subsequently challenged. In this experiment, there was a distinct difference in the response of pups from sensitized versus non-sensitized dams. If female, the DTH response of those fostered by sensitized dams was enhanced and if male, the DTH response was reduced where we The gender-specific modulation raises the important question of whether this occurs in the human population. For example, is there any evidence to suggest that mothers with genetically-based type IV hypersensitivity diseases (such as eczema and celiac disease) should be advised to nurse male and not female children, and conversely whether mothers exposed to organisms which elicit a type IV hypersensitivity response (such as the tubercle bacillus) might be advised to nurse female and not male children. In this regard, an important study in the human population shows the presence of tuberculin-reactive T cells in breast fed infants of tuberculin positive mothers, but essentially none in the breast fed infants from tuberculin negative mothers The mechanisms governing gender modulation of immune responses are very complex. For adult DTH responses for example, females have a more robust response, but this does not seem to be a simple function of the major steroid hormone since both testosterone and 17β-estradiol have been shown to be suppressive In conclusion, we have demonstrated trans-epithelial transfer of immune cells at one and two weeks of nursing and the subsequent appearance of these cells in the spleen and thymus. The majority of cells crossing the intestine were CD4+ and CD8+. Only CD4+ cells migrated to the spleen, while only CD8+ cells definitively migrated to the thymus. Accompanying this transfer was a long-lived modulation of a T cell-mediated response resulting in an enhanced response in females and a reduced response in males. These gender-related results may have important implications in regard to breast feeding when there is accompanying type IV hypersensitivity-related disease.

The perception of entrapment can emerge when defeated individuals want to escape but are incapable. Studies have shown relationships of entrapment to depression, and suicidal tendencies. The aim of this study was a psychometric evaluation and validation of the Entrapment Scale in German (ES-D). 540 normal subjects completed the ES-D along with other measures of depressive symptoms, hopelessness, and distress. Good reliability and validity of the ES-D was demonstrated. Further, whereas entrapment originally has been regarded as a two-dimensional construct, our analyses supported a single-factor model. Entrapment explained variance in depressive symptoms beyond that explained by stress and hopelessness supporting the relevance of the construct for depression research. These findings are discussed with regard to their theoretical implications as well as to the future use of the entrapment scale in clinical research and practice.The construct of Assuming a certain degree of adaptivity of behavior and emotion, evolutionary theorists have suggested various functions of moodiness and depression. Whereas adaptive mechanisms may become functionally maladaptive , 2, therarrested flight. For example, in lizards, being defeated but able to escape has proven to be less problematic than being defeated and being trapped. Those who are in caged conditions, where escape is impossible, are at risk of depression and even death = 7.34, P < .01, d = .63), felt more entrapped , and more stressed than participants of the PP-sample. The two samples did not differ regarding hopelessness . Further, the PP and the OL sample were split according to the cutoff of the CES-D which is considered indicative of dividing subjects with clinically relevant depressive episodes from healthy subjects = 9.43, P < .05, ϕC = .16). At baseline, (t1) subjects taking part at the retest 3 months later (t2) did not differ from persons not taking part in the retest with respect to depressiveness, perceived stress, or hopelessness, but differed regarding entrapment .As stated above, the retest-sample (RT) was a subsample of the OL-sample. The 100 retested persons were significantly older than the subjects not taking part in the retest assessment (δ = 0). Data was suitable for an EFA according to Bartlett's test and Kaiser's measure of sampling adequacy , so that the items could be considered apt for factor analyses. The Kaiser-Meyer-Olkin measure (KMO) also indicated that sample size was adequate in both samples . A principal-axis EFA was conducted for both samples using the covariance matrix and oblimin rotation (N = 170), the single-factor solution explained 60.72 % of the variance. For the online sample (N = 370), the single-factor solution explained 58.52% of the variance. In both cases, all items correlated significantly (P < .01) with the main factor .Following the study of Taylor et al. , the algα of the ES-D was .95 for both the PP and the OL samples. These values were similar to those found in studies using the original ES. Split-half reliability of the ES-D was r = .92 (Spearman-Brown) in both samples. Cronbach's To examine the construct validity of the ES-D, entrapment scores were correlated with total depression scores, with hopelessness scores, and with perceived stress scores in both samples see . Entrapmf2) for change in ΔR2 due to the addition of entrapment were small in both samples . Incremental validity of the ES was operationalized by a significant increment in the explained variance in the prediction of depressive symptoms. The assumptions for multiple linear regressions, including measures for collinearity, were not violated by our data, and no multivariate outliers or influential cases were identified. n = 100). As expected, in the RT-sample mean values for entrapment, depressive symptoms, perceived stress, and hopelessness remained unchanged from t1 to t2 . In terms of stability, moderate correlations between values at t1 and t2 were found for entrapment , perceived stress , and depressive symptoms whereas hopelessness showed a comparably higher retest correlation . When comparing the correlations [ The sensitivity to change of the ES-D was assessed by analyzing the data of a retest (RT) after 3 months . Furthermore, the state of entrapment seems to be more stable than perceived stress, which may be influenced to a greater extent by external factors. Given the confirmed reliability and validity of the ES-D in this study, we therefore cautiously conclude that entrapment lies between hopelessness and perceived stress regarding stability.The state conceptualization of entrapment implies that the perception of entrapment may change over time. Therefore, we did not expect retest correlations as high as retest correlations for more trait-like constructs like hopelessness . Since tWhereas the high correlation between entrapment and depressive symptoms in this study may be interpreted as evidence of conceptual equivalence, an examination of the item wordings of two scales clearly suggest that these questionnaires assess distinct constructs. However, the causal direction of this bivariate relation is not clear. Theoretically, both directions are plausible. Entrapment may be a cause or a consequence of depressive symptoms, or even both. Unfortunately, studies examining the temporal precedence so far have yielded equivocal results and have methodological shortcomings in order to answer this question conclusively , 26. It The present study has notable limitations. This study used two nonclinical samples. It was not systematically assessed by clinical interviews, whether any of the participants were suffering from clinically relevant depressive episodes. However, a cutoff that is considered indicative of clinically relevant depression was applied . Future The assumption that individuals feeling trapped in a situation are still highly motivated to change their situation suggests possible implications for research and practice. First, further research needs to identify groups of people who are especially prone to entrapment . Second, further research has to investigate to what extent the feeling of being trapped can be changed by psychological interventions. If entrapment can be changed, clinicians may set out to find individual sources of entrapment for each patient. Depending on whether he or she deems these potential sources as changeable or stable, challenging and/or accepting them may be the appropriate intervention strategies to help the patient overcome the feeling of being trapped. Such “entrapment-focused interventions” could be integrated in existing programs for the psychotherapy of depression.

Mycobacterium tuberculosis multidrug-resistant (MDR-TB) and extensively drug-resistant strains (XDR-TB) is a severe public health problem. Currently, there is an urgent need for new drugs for tuberculosis treatment, with novel mechanisms of action and, moreover, the necessity to identify new drug targets. Mycobacterial phosphoribosylpyrophosphate synthetase (MtbPRPPase) is a crucial enzyme involved in the biosynthesis of decaprenylphosphoryl-arabinose, an essential precursor for the mycobacterial cell wall biosynthesis. Moreover, phosphoribosylpyrophosphate, which is the product of the PRPPase catalyzed reaction, is the precursor for the biosynthesis of nucleotides and of some amino acids such as histidine and tryptophan. In this context, the elucidation of the molecular and functional features of MtbPRPPase is mandatory. MtbPRPPase was obtained as a recombinant form, purified to homogeneity and characterized. According to its hexameric form, substrate specificity and requirement of phosphate for activity, the enzyme proved to belong to the class I of PRPPases. Although the sulfate mimicked the phosphate, it was less effective and required higher concentrations for the enzyme activation. MtbPRPPase showed hyperbolic response to ribose 5-phosphate, but sigmoidal behaviour towards Mg-ATP. The enzyme resulted to be allosterically activated by Mg2+ or Mn2+ and inhibited by Ca2+ and Cu2+ but, differently from other characterized PRPPases, it showed a better affinity for the Mn2+ and Cu2+ ions, indicating a different cation binding site geometry. Moreover, the enzyme from M. tuberculosis was allosterically inhibited by ADP, but less sensitive to inhibition by GDP. The characterization of M. tuberculosis PRPPase provides the starting point for the development of inhibitors for antitubercular drug design.The selection and soaring spread of Mycobacterium tuberculosis, which is the etiologic agent of tuberculosis (TB), was discovered in 1882 by the German physician Robert Koch. TB was already then considered one of the most dangerous infectious diseases but, continues to still be, unfortunately, a major cause of death in underdeveloped nations, and a re-emerging disease in developed countries. Moreover, TB is currently endemic in the regions of sub-Saharan Africa, where susceptibility of HIV-infected people in developing the disease continuously increases According to the World Health Organization (WHO), in 2006 there were 9.2 million new cases of TB, and 1.7 million deaths from the disease, of which 95% occurred in low-income countries For these reasons, an emergence of a global plan to stop TB is necessary and needs the designing of new drugs and the identification of new molecular targets M. tuberculosisRecent studies have shown that, because of the mycobacterial cell wall's importance as a virulence factor in pathogenicity, it is thus rich in promising drug targets et al.M. tuberculosis DprE1 activity, an essential membrane associated enzyme Recently, Makarov Within the DPA biosynthesis pathway, other enzymes could be considered potential antitubercular targets such as the phosphoribosylpyrophosphate synthetase (PRPPase).2+ ATP complex (Mg-ATP) to ribose 5-phosphate (R5P) in order to form 5-phosphoribosyl-1-pyrophosphate (PRPP) M. tuberculosis PRPPase (MtbPRPPase), which is encoded by the rv1017c (prsA) gene, is also involved in the biosynthesis of DPA PRPPase (EC 2.7.6.1) catalyzes the transfer of the β,γ-pyrophosphoryl group from the Mg2+ ions, are allosterically inhibited by ADP and, possibly, by other nucleotides, and exclusively use ATP or, in some instances, also dATP as diphosphoryl donors Methanocaldococcus jannaschii. This enzyme is activated by phosphate and uses ATP as a diphosphoryl donor. Conversely, it is devoid of the allosteric site for ADP Three different classes of PRPPase have been described so far with distinctive enzymatic properties, such as the requirement of phosphate ions for activity and allosteric regulation and specificity for the diphosphoryl donor. Most PRPPases belong to class I, and are also named “classical” PRPPases. These enzymes, which require phosphate and MgBacillus subtilis and human isoform 1 (class I) M. jannaschii (class III) PRPPase have been solved The crystal structures of Our laboratory is aimed at producing enzymes involved in the DPA synthesis, such as DprE1 M. tuberculosis H37Rv strain In this context, the PRPPase enzyme seems very promising being essential as shown by Himar1-based transposon mutagenesis in the M. tuberculosis PRPPase obtained in recombinant form is reported, as a basis for the identification of a potential antitubercular drug target.In this work, the biochemical characterization of the Escherichia coli DH5α grown in Luria-Bertani (LB) broth or on LB agar. The expression strain was E. coli BL21(DE3)pLysS. When necessary, antibiotics (Sigma) were added at the following concentrations: ampicillin, 100 µg/ml; chloramphenicol, 34 µg/ml; kanamycin, 50 µg/ml. All strains were grown aerobically at 37°C with shaking at 200 rpm.All cloning steps were performed in rv1017c gene (prsA) encoding MtbPRPPase, was amplified by PCR from the genomic DNA of M. tuberculosis H37Rv using Taq DNA Polymerase (Qiagen) with primers Rv101728aF and Rv1017R . The PCR reaction was performed by using the MJ Mini Personal Thermal Cycler (BioRad). The resulting amplified fragment (981 bp) was purified with a Wizard PCR Prep mini-column (Promega), digested with BamHI and HindIII restriction endonucleases, and cloned into pET28-a expression vector (Novagen) by means of T4 DNA ligase in order to form the pET28-a/rv1017 construct which carries a fusion of six histidine residues at its N-terminus The E. coli BL21(DE3)pLysS cells were electroporated with the pET28-a/rv1017 construct and grown on LB agar plates containing kanamycin (50 µg/ml) and chloramphenicol (34 µg/ml). Roughly 100 colonies were inoculated in 2 litres of ZYP-5052 autoinducing medium g for 10 min at 4°C), washed with cold PBS and stored at −20°C.MtbPRPPase activity were collected, concentrated and applied to a HiLoad 16/60 Superdex-200 column equilibrated in buffer B . The enzyme was eluted by buffer B and fractions containing MtbPRPPase activity were checked by 12% SDS-PAGE and pooled. Protein concentration was determined according to Lowry et al.In order to purify the enzyme, frozen cells were suspended in 250 ml buffer A , supplemented with a protease inhibitor cocktail (Sigma-Aldrich), sonicated at 800 W for 6 minutes, cleared by ultracentrifugation, and the supernatant was applied to a HisTrap HP column equilibrated in buffer A. Proteins were eluted with scalar concentration (20 to 500 mM) of imidazole in buffer A and fractions containing MtbPRPPase was subjected to an analytical gel filtration on a Superose 6 HR 10/30 prepacked column equilibrated in buffer B. For column calibration the following proteins were used: thyroglobulin (669 kDa), ferritin (440 kDa), catalase (240 kDa), aldolase (158 kDa), albumin (68 kDa), and ribonuclease (13.7 kDa).To determine the molecular mass of the native enzyme, the purified MtbPRPPase activity was assayed with a HPLC-based method developed in our laroratory (unpublished data), and following the AMP rate formation. The standard reaction mixture contained 50 mM potassium phosphate pH 8.0, 100 mM KCl, 2 mM Mg-ATP, 2 mM R5P, in a final volume of 100 µl. After incubation at 37°C, the reaction was stopped by adding 10% (w/v) ice-cold trichloroacetic acid, and neutralized with 200 mM K2CO3. After centrifugation, samples (10 µl) were loaded onto a Supelcosil LC-18 column . Isocratic separation was performed in 20 mM potassium phosphate pH 8.0 at a flow rate of 0.8 ml/min. Analytes were monitored at 254 nm.The nmoles of AMP produced were determined using a calibration curve obtained by injecting scalar amounts (0.06 to 20 nmol) of AMP, treated in the same way as that adopted for the enzyme assay. One unit is defined as the amount of enzyme catalyzing the production of 1 µmol of AMP per minute under conditions here described.max and apparent Km values. The Hill plot obtained by the Enzyme Kinetic Module 1.1 (SPSS Science Software) was used to determine the apparent S0.5 and nH values.Unless otherwise indicated, enzymatic activity was assayed at 37°C by using various concentrations of R5P and Mg-ATP under conditions identical to those described above except for substrates and effectors. The kinetic parameters were determined for R5P at 10 mM Mg-ATP and for Mg-ATP at 2 mM R5P. In all cases the reaction was initiated by adding R5P, and the enzyme activity was assayed at least with 12 different concentrations of substrate. All measurements were performed at least in triplicate. The plot of Lineweaver-Burk was used to determine VFor the assessment of the activation by phosphate or sulfate ions, the enzyme stored in buffer B was diluted in 50 mM Tris HCl pH 8.0 buffer, containing 2mM Mg-ATP, lowering the phosphate concentration to 0.25 mM. The enzyme activity was then immediately assayed at saturating concentrations of substrates, and using as assay buffer 50 mM Tris-HCl pH 8.0, 100 mM KCl, in the presence of different concentrations of potassium phosphate or ammonium sulfate.Thermal stability was measured by incubating the enzyme (100 µg/ml) at given temperatures in buffer B, in the absence and in the presence of ligands. Samples were removed at intervals and immediately assayed as described above.1/2 is the time required by the enzyme to lose 50% of its initial activity at a given temperature.Relative activity was expressed as percentage of the enzyme activity before the incubation. tm) were calculated from curves fitting.The thermal denaturation was also measured by circular dichroism spectropolarimetry. Thermal unfolding was followed by continuous measurements of ellipticity at 220 nm at the temperature range 50–90°C under a constant heating rate of 1°C/min, and with a Jasco J-710 spectropolarimeter equipped with a Neslab RT-11 programmable water bath and a 1 mm path-length cuvette. Protein concentration was 0.1 mg/ml in buffer B. The midpoint temperatures http://www.expasy.org/spdbv/) was employed for building and optimizing the model. The stereochemistry of the predicted structure has been assessed with the program PROCHECK MtbPRPPase structure can be superimposed with a r.m.s.d. of 0.5 Å based on 303 Ca pairs (the two enzymes share a sequence identity of 44%). The model of the MtbPRPPase-AMP complex was obtained by superposing the predicted M. tuberculosis structure onto the crystal structure of human template and pasting the AMP molecule into the M. tuberculosis modelled structure. Figures were generated with the program Pymol The three dimensional structure of MtbPRPPase was expressed in E. coli BL21(DE3)pLysS cells, and purified to homogeneity as described in the “Material and Methods” section. The typical yield was about 20 mg of purified MtbPRPPase from 1 litre of culture. The specific activity, under standard conditions, was 59.7 U/mg. No detectable activity was found with Mg-GTP used as substrate. As phosphate (Pi) has been reported to be indispensable in preserving protein stability of PRPPases, the MtbPRPPase was maintained in 50 mM phosphate, pH 8.0 i.The recombinant Oligomeric state—The enzyme migrated in 12% SDS-PAGE as a protein of apparent molecular mass of approximately 35 kDa in order to exhibit maximal activation . SO42− tivation . On the Activation by divalent cations—It has been reported that PRPPases are activated by free divalent cations. At subsaturating Mg-ATP concentrations, MtbPRPPase reached half-maximum activation at approximately 1 mM free ions , although the maximal activity reached in the presence of 5 mM Mg2+ resulted to be roughly 80% of that in the presence of 5 mM Mn2+ of 2.6.At saturating concentration of Mg-ATP, the enzyme exhibited hyperbolic response to R5P , with ans Mg-ATP , with an2+ in kinetics towards R5P did not alter the curve profile, whereas 5 mM Mn2+ raised the maximal activity to 120% led to kinetic parameters which were nearly identical to those obtained for the kinetics towards Mn-ATP value of 0.02 versus 0.4 and 0.8 mM of Fe2+ and Ca2+, respectively. The presence of Cu2+, Ca2+or Fe2+ at a concentration equal to their IC50 left the affinity for Mg-ATP unchanged or even slightly increased, as shown by the kinetics towards this substrate , whereas it was highly inhibited by ADP (IC50 0.4 mM). The degree of inhibition by ADP was higher at lower concentration of Pi , although the response towards Mg-ATP became hyperbolic with an affinity for the substrate similar to that displayed in the presence of Mg2+ without Mg-ADP , whereas no protection was observed in the presence of Mg2+ ion . Although the identification of possible peculiar structural features to be exploited for the design of specific inhibitors must wait for the determination of the X ray crystal structure of the MtbPRPPase, we carried out a prediction of its structure based on homology modelling. As expected, the overall structural organization of the mycobacterial and human enzymes appeared to be strongly conserved (MtbPRPPase a glutamic acid (Glu113) occupies the structurally equivalent position of Ala105 in the human enzyme; moreover a histidine residue (His109) replaces Asp101 in the human PRPP synthetase. Since MtbPRPPase shows a strong cooperativity for ATP binding, we cannot quantify the impact of these substitutions based on our predicted structure.We are acutely aware of the issue of selectivity of drug action for inhibitors targeting the onserved as demononserved . In partM. tuberculosis phosphoribosylpyrophosphate synthetase, which is the enzyme catalysing the second step of this metabolic pathway, is reported. Noticeably, PRPP, which is the product of the PRPPase catalysed reaction, is also a key metabolite for the nucleotides and for the amino acids histidine and tryptophan synthesis. The rv1017c gene, which encodes PRPPase, is thus essential for M. tuberculosis growth The biosynthesis pathway of decaprenylphosphoryl-arabinose has been proved to be an optimal target for antitubercular drugs MtbPRPPase was expressed as recombinant form, purified to homogeneity and biochemically characterized. Although the biochemical characterization of the MtbPRPPase was performed using the enzyme with a hexahistidine tag attached to its N-terminus, as shown in MtbPRPP as class I enzyme. SO42− mimicked the activation by Pi, although to a lower extent (56%). On the other hand, the inhibitory effect exhibited by Pi at high concentrations was negligible in the case of SO42−. In this respect, MtbPRPP turned out to be quite similar to the enzyme from B. subtilis and mammals The enzyme exhibited a hexameric quaternary structure, specificity for Mg-ATP as substrate and requirement of phosphate for its activity. These features allowed us to label 2+ ion as an essential activator and Mg-ATP as a substrate. Free ion may induce and properly stabilize the open conformation of the so-called flexible loop which binds Mg-ATP at the active site 2+, MtbPRPPase showed homotropic cooperativity towards Mg-ATP, which was the cause of a relatively low affinity for this substrate . The presence of free Mg2+ abolished the cooperativity versus Mg-ATP and lowered the apparent S0.5, suggesting that it activated the enzyme, behaving as an allosteric effector. Moreover, the kinetic properties displayed by MtbPRPPase in the absence and in the presence of the activator Mg2+ could fulfil the requirements of the K-type allosteric enzyme of the model described by Monod 2+, which resulted even more effective than Mg2+ , the presence of free Mg2+ ions did not lead to any increased protein stability , suggesting that the binding of the free activating ion did not induce large rearrangements of the protein. Thus, keeping in consideration previous data obtained from crystallographic studies on B. subtilis enzyme 2+ to its site would induce a local conformational change at the active site of the single subunits, stabilizing the open conformation of the flexible loop and abolishing the cooperativity of the Mg-ATP binding sites, but leaving the overall conformation of the enzyme unchanged. On the other hand, the binding of Mg-ATP to one subunit would lead to overall enzyme conformational changes, thus inducing the stabilization of the open active site conformation in the next subunits, and increasing their affinity for Mg-ATP.Thermal stability assays allowed us to evidence conformational changes caused by the presence of ligands . Whereas2+ and Cd2+, have been reported to inhibit PRPPase activity MtbPRPPase was inhibited by Ca2+ , but the effect of this ion resulted to be less effective than that observed in B. subtilis and human enzymes 2+ ions . However, in all cases, the reduction of the activity was accompanied by a decrease in the cooperativity towards Mg-ATP and a slight increase in the affinity for this substrate . In addition, in the case of Cu2+, the presence of either Mg2+ or Mn2+ resulted in apparent S0.5 values higher than those in the presence of the free activating ions alone. All in all, these results suggest that the inhibitory ion can bind to both the free cation site, leading to a partial enzyme activation , and the Mg-ATP site, lowering the Vmax. Interestingly, the effectiveness of divalent cations, either activatory or inhibitory, seems to be related to their ionic radius. Besides this, the behaviour towards Mg2+, Mn2+ and Ca2+ of MtbPRPPase differed from that of the B. subtilis and the human enzymes (both more activated by Mg2+ than Mn2+) and strongly inhibited by Ca2+B. subtilis and M. tuberculosis cation binding site, as deduced from the B. subtilis structure 180 (B. subtilis numbering), in the absence of cation, establishes a hydrogen bonding network with two aspartic acid residues (Asp174 and Asp223) devoted to the free Mg2+ binding, and moves away to a new aspartic acid residue (Asp133) in the presence of the ion. In the MtbPRPPase, Arg180, which is also conserved in the human enzyme, is substituted by an isoleucine, whereas two arginines are located one and three residues behind, respectively. These structural differences could very likely be the reason for a different free cation site topology, thus accounting for the different ion specificity.Divalent cations, such as Caubstrate . The inhMtbPRPPase acted as the enzymes of this class MtbPRPPase was more sensitive to inhibition by ADP than B. subtilis enzyme MtbPRPPase for half-maximal inhibition increased with increasing Pi concentration, thus supporting the conclusions of previous studies that indicate the presence of a regulatory site to which both inhibitory ADP and activatory Pi could bind MtbPRPPase was regulated by ADP in an allosteric manner resulted by the kinetic responses to substrates concentrations at two different concentrations of ADP. In fact , has been successfully approached for the discovery of inhibitors selective toward the M. tuberculosis enzyme by exploiting the PRPP binding site in structure based virtual screening MtbPRPPase, both our extensive biochemical investigation as well as a foreseen more robust structural characterization, may prove to be useful for the design of potent and highly specific inhibitors.In conclusion, the biochemical investigation on PRPPase from Figure S1Inhibition of Mtbi concentrations.PRPPase by ADP at different P Response of MtbPRPPase activity to Mg-ADP different concentrations, in the presence of 5 mM (▵) and 50 mM potassium phosphate (▴). All measurements were performed in 50 mM Tris-HCl pH 8.0, at 2 mM R5P and 1 mM Mg-ATP.(TIF)Click here for additional data file.Figure S2Characterization of the recombinant MtbPRPPase after the removal of the His-tag.MtbPRPPase, after the removal of the hexahistine tag, was kinetically characterized and compared with the kinetic properties of the enzyme provided with His-tag. Closed symbols indicate the enzyme with His-tag attached to its N-terminus, open symbols the enzyme without His-tag. (A) Steady state kinetics of enzyme as a function of R5P at fixed 10 mM concentration of Mg-ATP, in the absence of free divalent cations (•), and in the presence of 5 mM MgCl2 (▪); (B) Steady state kinetics of MtbPRPPase as a function of Mg-ATP at fixed 2 mM concentration of R5P, in the absence (•) and in the presence (▪) of 5 mM MgCl2. (C) Response of activity to CuCl2 (▴), CaCl2 (▾) and FeCl2 (▪) different concentrations, at 2 mM R5P and 5 mM Mg-ATP. (D) Response of activity to Mg-ADP different concentrations (▴), at 2 mM R5P and 1 mM Mg-ATP.(TIF)Click here for additional data file.Materials and Methods S1Expression and Purification of Recombinant MtbPRPPase Devoid of His-tag.(DOC)Click here for additional data file.

Ultrafine PM has been suggested to be inherently more toxic by virtue of its increased surface area. The purpose of this study was to determine if ultrafine PM (or nanoparticle) inhalation produces greater microvascular dysfunction than fine PM. Rats were exposed to fine or ultrafine TiO2+ ionophore A23187 was used to evaluate endothelium-dependent arteriolar dilation. In control rats, A23187 infusion produced dose-dependent arteriolar dilations. In rats exposed to fine TiO2, A23187 infusion elicited vasodilations that were blunted in proportion to pulmonary particle deposition. In rats exposed to ultrafine TiO2, A23187 infusion produced arteriolar constrictions or significantly impaired vasodilator responses as compared to the responses observed in control rats or those exposed to a similar pulmonary load of fine particles.By histopathologic evaluation, no significant inflammatory changes were seen in the lung. However, particle-containing macrophages were frequently seen in intimate contact with the alveolar wall. The spinotrapezius muscle was prepared for in vivo microscopy 24 hours after inhalation exposures. Intraluminal infusion of the Ca2, ultrafine TiO2 inhalation produces greater remote microvascular dysfunction.These observations suggest that at equivalent pulmonary loads, as compared to fine TiO The association between cardiovascular disease and exposure to airborne particulate matter (PM) is well established. Nanotechnology is already well-integrated into our daily lives, and appears to offer humankind novel benefits limited only by our creativity. While the scope of these benefits is essentially unrestricted, benefits that are specific to human health include: molecular imaging/diagnosis, drug delivery, anticancer therapy and gene therapy. However, if the unrestricted use of nanotechnology is rushed to societal integration, and the health effects of nanoparticles are not clearly identified, such technology runs the risk of causing unanticipated adverse health effects , and the2 nanoparticles initiate pulmonary responses such as airway inflammation rats (6–7 wks old) were purchased from Hilltop Laboratories and housed in an AAALAC approved animal facility at the National Institute for Occupational Safety and Health. Rats were housed in laminar flow cages under controlled temperature and humidity conditions and a 12 hr light/12 hr dark cycle. Food and water were provided ad libitum. Rats were acclimated for 5 days before use and certified free of endogenous viral pathogens, parasites, mycoplasms, 2 aerosols for rodent exposure × 100, where Dpass is passive diameter under ADO and Dc is the diameter measured during the control period (resting diameter). A tone of 100% represents complete vessel closure, whereas 0% represents the passive state. In order to evaluate arteriolar responsiveness between individual groups with subtle differences in resting diameter, arteriolar diameter was normalized. In this case, arteriolar diameter was expressed as a percentage of the maximum response and was calculated for each vessel as follows: Diameter (% of Maximum Response) = [(DSS - Dc)/(Dpass- Dc)] × 100, where DSS is the steady state diameter achieved during A23187 infusion. All data are reported as means ± SE, where "n" represents the number of arterioles evaluated and "N" represents the number of rats studied. This distinction was made because the experimental unit in the current study was the arteriole. One to three microvessels were studied per rat. Given the inherent microvascular heterogeneity in any given tissue [Arteriolar diameter was sampled at 10-second intervals during all control and infusion periods. Resting vascular tone was calculated for each vessel as follows: Tone = [, and in 16 of the 29 rats exposed to fine TiO2 were manipulated to produce identical calculated pulmonary depositions. Three groups of rats displayed identical levels of microvascular dysfunction after exposure to 30 μg ultrafine TiO2via different conditions and aerosol concentrations . At a deposition of 19–20 μg, fine TiO2 showed a trend towards an impaired dilation, while ultrafine TiO2 produced arteriolar constrictions that were significantly different from the responses in both the sham-control and fine TiO2 groups (Middle Panel). At a deposition of 36–38 μg, effects similar to the 19–20 μg lung burden occurred but the intensity of arteriolar constriction after exposure to ultrafine TiO2 was more pronounced (Bottom Panel). This suggests that at similar pulmonary burdens, ultrafine particles produce greater systemic microvascular dysfunction than fine particles.Because actual pulmonary mass deposition was determined, three pair-wise comparisons of arteriolar responsiveness can be made between rats exposed to fine and ultrafine TiO2 Figure . At a deThis is the first study to directly identify an impaired vasodilator capacity in the systemic microcirculation after nanoparticle inhalation. A second novel observation in the current report is that for the same pulmonary mass deposition, nanoparticles produce significantly greater systemic microvascular dysfunction than their larger, fine counterparts of the same composition.2+ concentration and subsequently stimulate nitric oxide production [2+ concentration [Nanoparticle inhalation attenuated systemic arteriolar dilation in a dose-dependent manner Figure . This waoduction . Alteredntration and ultintration . Alternantration ,37. FutuThe loss of microvascular vasodilator capacity can be a profound influence on normal homeostasis in any organ. In its most basic sense, this microvascular impairment would decrease tissue perfusion, and therefore, compromise function . Our curBrook et al. initiall2 has been shown to cause significantly greater airway inflammation than fine TiO2 [2 aerosols or exposure time (2–8 hrs), the intensity of microvascular dysfunction was not different among these groups 24 hrs after exposure are comThe physiological relevance of intratracheal instillation is frequently questioned. Intratracheal instillation is a commonly used exposure method because it is rapid, economical and consistent across multiple animals. Further, intratracheal instillation can produce a relatively uniform pulmonary particle distribution if exposure doses are kept low . HoweverIn the time since we first reported that systemic microvascular dysfunction follows PM exposure , nanotecc – Control diameter. Dpass – Passive diameter. Dss – Steady state diameter. i.p. – Intraperitoneal. N – Number of animals. n – Number of arterioles. PM – Particulate matter. TiO2 – Titanium dioxideA23187 – Calcium ionophore. ADO – Adenosine. ANOVA – Analysis of variance. ICP-AES – Inductively-coupled plasma-atomic emission spectroscopy. DThe author(s) declare that they have no competing interests.TRN performed intravital microscopy experiments. DWP performed ICP-AES experiments. AFH performed pulmonary histology. JLC, BTC and DGF performed inhalation exposures. TRN and VC conceived and designed the study. All authors read and approved the final manuscript.The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the National Institute for Occupational Safety and Health.Research described in this article was conducted under contract to the Health Effects Institute (HEI), an organization jointly funded by the United States Environmental Protection Agency (EPA) (Assistance Award No. R-82811201) and certain motor vehicle and engine manufacturers. The contents of this article do not necessarily reflect the views of HEI, or its sponsors, nor do they necessarily reflect the views and policies of the EPA or motor vehicle and engine manufacturers.Health Effects Institute Award #4730 and NIEHS ES015022 (TRN).

Despite free of charge biomedical treatment, the cost burden of Buruli ulcer disease (Bu) hospitalisation in Central Cameroon accounts for 25% of households' yearly earnings, surpassing the threshold of 10%, which is generally considered catastrophic for the household economy, and calling into question the sustainability of current Bu programmes. The high non-medical costs and productivity loss for Bu patients and their households make household involvement in the healing process unsustainable. 63% of households cease providing social and financial support for patients as a coping strategy, resulting in the patient's isolation at the hospital. Social isolation itself was cited by in-patients as the principal cause for abandonment of biomedical treatment. These findings demonstrate that further research and investment in Bu are urgently needed to evaluate new intervention strategies that are socially acceptable and appropriate in the local context. The cost burden of free of charge Buruli ulcer disease (Bu) hospital treatment is not sustainable for a majority of patients and their families in Central Cameroon. The long term nature of Bu taxes the patients' and their families' resources often to a breaking point, consequently often leading to the abandonment of patients by the family. In the study area, 62% of families ceased providing social and financial support to the patient, which resulted in the patient's isolation at the hospital. Significantly, social isolation was cited by in-patients as the principal cause for abandonment of biomedical treatment. Paradoxically, this phenomenon was observed in settings where hospital in-patient treatment, room and board were provided free of charge for the patient and caretaker. These findings show that despite the significant reduction in costs for medical care, in its current form, hospital treatment for Buruli ulcer often remains financially and socially unsustainable for patients and their households, leading to the abandonment of biomedical treatment or altogether avoiding it. Further investment and research are urgently needed to evaluate new intervention strategies that are both socially and financially acceptable and appropriate in local settings. Mycobacterium ulcerans, is an environmental mycobacterium endemic to restricted foci throughout the tropics and directly related to stagnant or slow-flowing water Mycobacterium ulcerans into the subcutaneous tissues likely occurs through penetrating skin trauma, though the mode of transmission is not entirely clear. The agent produces a potent toxin known as mycolactone which destroys cells in the subcutis leading to the development of large skin ulcers Buruli ulcer disease is the third most common mycobacterial disease in humans, after tuberculosis and leprosy In Cameroon, Bu was first documented in 1969 in 47 cases, all originating from the well-circumscribed rural area of Ayos and Akonolinga in Central Cameroon. The endemic region was later identified as an area stretching along the Nyong River and some of its tributaries for approximately 100 km in length and 10–30 km in width with a population of 98,500 people Aide aux Lépreux Emmaus Suisse and Médicins Sans Frontières respectively. Both offer free of charge medical treatment and supplementary aid. These services include free of charge medication and in-patient treatment; free meals served once or twice a day (depending on the institution); complementary accommodations for in-patients and their caretakers for the duration of their stays; extra schooling ; and, the free provision of basic materials for everyday needs such as soap and bandages, sheets, etc. However, the provision of these materials is often irregular as stock-outs are common, directly affecting patients' hospitalisation costs.Biomedical treatment Bu in the endemic region is provided at the Ayos and Akonolinga Hospitals which have specialised Bu programmes sponsored by The main objective of this article is to evaluate the economic and social impact of hospital treatment for Bu disease on the patient and the household in a setting where medical costs for hospital treatment and supplementary aid for everyday needs are subsidised by the local health care system and/or through foreign aid.The present study was conducted in the above-mentioned endemic region of Ayos and Akonolinga. It was an a focused ethnographic study using both qualitative and quantitative research methods. Field work was conducted in both community and clinical settings for a period of four months, three of which were spent at the Ayos and Akonolinga hospitals and one in the selected endemic communities of Eyess, Edou, Ebanda and Ngoulemakong, all belonging to the catchment areas of the respective hospitals. Considering the focalised character of Bu infection rates, Participant observation. Participant observation, or the observation of people's behaviour in its natural setting, is a fundamental and often neglected part of qualitative research. This technique consists of participating in everyday activities, working in the native language and observing events in their everyday context. Gaining patients' and household members' confidence through participant observation methods increases the validity of ethnographic data. In this study, participant observation was particularly important in establishing costs since patients and household members are unlikely to accurately recall all costs associated with this long-term illness. Participant observation also enabled us to contrast reported adherence to treatment, expenditures, frequency of visits to hospitalised Bu patients, and other behaviours with actual observed patterns. (ii) In-depth interviews. During field work, in-depth interviews were carried out with Bu patients and their households, extended family members, local traditional healers, community leaders and key informants . One or more in depth interviews were carried out with Bu patients and their households. All interviews were conducted by the authors, personally, and were not mediated by hospital, public health or other biomedical staff for fear that their presence would guide responses . (iii) Focus group discussions. Focus group discussions were held with medical staff at the Ayos and at the Akonolinga Hospitals and with extended family groupings in the various communities. Treatment, costs and health seeking behaviour were among the primarily topics during these sessions.During field work the following techniques were used: (i) Insights and established categories from an initial phase of qualitative research were used to assess preliminary data, and construct cost categories, which facilitated further systemisation and eliciting of costs from respondents, and were useful as secondary indicators to evaluate people's stated costs and economic coping strategies.half-open structured questionnaire realised with all patients at Ayos and Akonolinga Hospitals and carried out in the local communities. At the Ayos and Akonolinga Hospitals, 79 clinically confirmed hospitalised Bu patients were included in the sample, representing all patients in treatment during the four month period of the study from November 2005 to February 2006. The costs and cost burden presented in this article apply exclusively to the hospitalised patients. However, to gain a better understanding of Bu patients' and households' health seeking behaviour, the social and economic burden of the disease, and the relationship between local communities and the hospital setting, 73 patients and their households were further included for qualitative analysis at the community level, representing all active and inactive Bu cases living in the selected communities at the time of study. The costs accrued by the latter are outside the scope of this article.After this stage, data were more systematically gathered and standardised through (iv) a quantifiable All interviews and a record of field observations and important informal conversations were coded in NVivo Qualitative Analysis Software . NVivo enables the management and coding of large sets of qualitative data, and facilitates linking them to quantitative data management and analysis software. Further quantification and analysis was carried out in SAS .and receiving less than an average of 1 visit every 15 days. Both definitions were operational: The absence of a caretaker is a defining characteristic of abandonment and social isolation for children and adolescents in the study setting as were the supplementary number of visits used to define social isolation for adults and elderly. Qualitative data and secondary indicators affirmed the validity of the definitions in the local context.Costs for socially isolated and socially not isolated patients were included in the study after preliminary qualitative research. Social isolation was understood as a sudden or progressive loss of social relations, family or friends that form the patient's social network. For the category ‘Children & Adolescents’ social isolation was defined as being hospitalised without caretaker, and for ‘Adults & Elderly’ as having no caretaker For the definition and categorisation of costs, the conceptual framework proposed by Russell non-medical .In the present setting, the medical costs of Buruli ulcer disease in-patient treatment at the Ayos and Akonolinga Hospitals are largely covered; therefore the costs patients and households face are almost exclusively Irregular Medical Expenses and Hygiene Costs. These costs are related to Bu patients' personal hygiene when taking care of the ulcer (e.g. bleach and soap to wash bandages and clothing dirtied due to the ulcer); irregular expenses for extra medication (i.e. for pain relief) and unofficial fees during treatment. (ii) Feeding Costs. Feeding Costs include extra meals taken at local food stands by patients or caretakers; (iii) Transportation Costs. Transportation Costs refer to the costs of transport for the patient, caretaker(s) and other household members when travelling to and from the hospital to visit the hospitalised patient; (iv) Miscellaneous Costs. These include a variety of non-systematic costs such as extra rent in the location of the hospital for caretakers, extra phone calls, debts to community workgroups due to illness, gifts to hospitalised patients, etc. For all the preceding costs calculations, changes in the use of stream of resources were measured.Patient and households' ‘Direct Costs’ were understood as expenditures incurred by the patient or household members in the course of treatment. For analytic purposes, systematically included Direct Costs were divided in the following categories: (i) ‘Indirect costs’ refer to the value of lost productivity or earnings lost by the patient or household members in the course of treatment. Productivity lost was based on the calculation of the individual's (patient and/or caretaker) earnings per calendar year and the percentage of these earnings that was lost due to the morbidity time caused by the illness episode or caretaking. For children and youth, additional schooling lost due to Buruli ulcer disease was evaluated.Total Costs represent the sum of the Direct Costs and the Indirect Costs of the illness.Prices and Currencies and Illness Costs below).The ‘Cost Burden’ refers to the percentage of the total household earnings that was consumed by Bu treatment costs. For this study, the cost burden of the illness was calculated based on (i) each individual patient's ‘total illness costs’ during hospital treatment as a percentage of (ii) the yearly earnings of his or her household .Due to (i) the limited time period over which costs were calculated ; (ii) the difficulties of having reliable economic indicators adapted to the local setting; and (iii), the absence of extreme inflation , Patients were followed up during the four month period at the hospital and interviewed regularly to assess all costs of the illness during hospital treatment. All resources the patients and their households used were quantified using established variables and categories from initial qualitative analysis, which included (i) a table presenting the different kinds of commodities used by the patients and households; (ii) the respective prices of those resources (and secondary verification of purchased product prices) ; and, (iii) the quantity of resources used.For patients that were discharged before the end of the study, all costs were calculated from the beginning of their hospital treatment until the day of discharge; therefore, all costs were retrospective. For patients still in treatment after the four month study period, total costs were extrapolated to the median in-patient treatment time for patients at the Ayos and Akonolinga hospitals since the Bu programmes started in 2002, which equalled 157 days.Median values are preferable for cost burden research , consisting of various related households that nevertheless function independently. Despite the proximity of patrikin, the household is the basic economic unit when coping with the illness costs of its members. Secondly, because decisions about treatment are based on negotiations within the household , since the costs of illness reach beyond the sick to involve other household members who care for and accompany them to treatment and who ultimately are affected by the costs of illness which fall on the household budget and diminish the resources available for other household members In the present context, the household was operationally defined as a group of people who live together in a common residence, forming a unit of economic cooperation, and who are responsible for the socialisation of the children born of its members. The household was the preferred unit of analysis for assessing the economic costs and consequences of illness for two reasons. Firstly, local kinship relations are traditionally based both on patrilineal filiation (kinship through the father's line) and patrilocal residence patterns (adoption of the father's place of residence in marriage). Communities are consequently divided into different settlements of patrilocally nucleated extended family clusters that are harvested at different periods and can be more intensively exploited according to the necessities of general household spending. Earnings from slash and burn agriculture are often supplemented by earnings from cacao and/or café plantations , which require different agricultural techniques and can only be harvested at specific intervals each year. Furthermore, the proximity of the Nyong and its tributaries provides communities with fish while the tropical rainforest offers possibilities for hunting. Both resources are used for consumption and sale. Occasional formal and salaried employment and migration to urban centres or abroad represent additional complementary subsistence strategies, although the latter signifies the separation of the household.Earnings were compiled through in-depth interviews with the household providers and was calculated based on the combined earnings of all household members for the period of one calendar year. For most cases, households were entirely dependent on subsistence farming. For slash and burn farming, activities were systemised in an agricultural calendar specifying products' harvest times or intervals, product prices and the subsequent estimation of earnings. Earnings from fishing were calculated according to an activity calendar, incorporating the amount of fish, fish prices and number of days worked. Hunting is a more irregular activity and meat is consumed more often then sold. Nevertheless, extra earnings of sold bush meat were also incorporated into calculations. In cases where one of the household members had formal employment, his/her yearly earnings were calculated according to the official salary. Usually this person further participates in the household's slash and burn agriculture, the revenues of which contribute to the general household earnings. The yearly revenues for informal urban and semi-urban employment were also included in calculations for the patient and/or other household members.Time costs of visitors. Visitors' time costs were not included because they generally use days and hours with minimal work obligations to visit hospitalised patients and therefore lose less productive time making the value of this time loss too abstract to include in productivity loss calculations. (2) Extra irregular expenses. Patients, caretakers and visitors tend to make unquantifiable purchases on their way to and from the hospitals, such as food and drink for the journey that can not practically be incorporated into cost assessments. (3) Locally produced products. Food products harvested by farmers in their local communities and given to the patient on visits have not been included in cost calculations as these products do not represent a direct monetary expense for the family. Moreover, due to the irregularity of food provision for the patient and the frequent use of such products for purely consumptive rather than economic purposes, it is difficult to express this dynamic economically.The following costs have not been included: (1) Certain consequences of Bu cannot be expressed or directly converted into monetary values. These include some of the illness's long term consequences such as abandonment of schooling; disability and deformity; social exclusion, and psychosocial factors, the effects of which can not tangibly be measured, but that are, nonetheless, detrimental to the patient and the household. An example of such intangible costs during treatment is the increased social vulnerability due to reduced participation in local social security networks. The patient's and the household members' absence from the community results in enhanced vulnerability in times of crisis due to their inability to maintain participation in community work groups and savings clubs that require regular contributions. In this respect, absence from the community leads to increasing vulnerability and potential impoverishment since participation in those structures can assist in recovery during such periods.Earnings. The loss of earnings was calculated on the basis of the earnings of the patient when he/she stopped working due to Bu hospital treatment. However, the long term nature of the illness makes it impossible to measure indirect loss in terms of previously missed opportunities in schooling or work. In other words, it is impossible to assess the entire extent to which an individual's or household's income has been altered by Bu and its influence on patients' present occupations. This is especially relevant as a high percentage of patients had active Bu for over 5 years and 10% of patients for over 10 and up to 32 years before receiving treatment in a specialised Bu-programme. (ii) Recall period. Unlike illnesses with brief and intense episodes, such as malaria, the long-term nature of Buruli ulcer disease diminishes the accuracy of patients' recall of all costs incurred and the exact value of those included. Therefore, costs are likely an under-estimate of the real costs accrued when coping with Bu. (iii) Internal variance. The cost burden of Bu significantly varies according to a number of factors, including the stage of illness when patients arrive at the hospital, but also in relation to social and economic status, medical complications, the distance between the community and the hospital, the availability of funds in relation to the needs of other household members, etc. However, it is beyond the scope of this article to go into detail about costs related to each category. Rather, the article emphasizes the relationship between costs, cost burden, adherence and social consequences at the local level.The long term nature of the illness inevitably leads to the following methodological limitations in the calculation of costs: (i) The study was approved by the ethical committee of the Ministry of Health, Cameroon (No. 0123/ARRO/MSP/DPSPL). For the field work, all interviewers were requested to follow the Code of Ethics of the American Anthropological Association (AAA) During the study period, 34% of all patients registered at the Ayos and Akonolinga Hospitals since 2003 were classified as “healed” with a median hospitalisation time of 157 days (range 47–645 days). 39% of hospital patients were female and 61% male. 56% were children and adolescents (<20) while 44% were adults or elderly.Monthly household earnings of Bu hospital patients previous to their illness were calculated for all patients and households. The median value was €40,7 (26.400 FCFA). This was slightly higher than the median earnings for subsistence farming in the studied endemic communities, which was estimated during fieldwork at €33,8 (22.000 FCFA). These median values correspond with those of the World Bank Median total costs of hospital treatment were €126,7 (82.372 FCFA) .Median direct costs totalled €59,3 (38.563 FCFA). The distribution of the direct costs shows that 19% is spent on Medical & Hygiene costs , 29% on Transport, 25% on Feeding Costs, and 28% on Miscellaneous Costs. The distribution of median costs shows that 43% stemmed from expenses directly related to the costs of the patient's care while 57% derived from household members' involvement during the illness period.Indirect costs of household members' involvement: The median productivity time lost for household members' involvement (when applicable) equalled €106,9 (69.489 FCFA).The median indirect costs of the patient's care (including both productive and dependent members of households), was €64,4 (43.809 FCFA). The median cost of productivity time lost during the patient's care for adult patients was €158,4 (102.949 FCFA). For children and youth, additional schooling lost was measured. Of all hospitalised Bu patients, 88% of children had lost schooling due to their illness; 20% of these had completely abandoned school while 68% had lost a median of 1 year of schooling . The median cost burden of Bu amounted to 25% of household's annual earnings. Direct costs represented 8% of patients' and households' yearly earnings while indirect costs accounted for 17%. Therefore, 31% of the cost burden total costs were direct while 69% were indirect.During in-patient treatment, the most common coping strategies included the use of savings (39%); making claims from social networks (75%); borrowing (53%); reducing consumption of non-essentials (100%) and essentials (69%); patient informal employment (36%); informal employment of the caretaker (43%); the supplying of provisions from family relations in nearby villages (56%); and, the social isolation of the patient (63%). The coping strategies employed were generally cost prevention strategies, similar to those used for other long-term and chronic illnesses, examples of which are found in studies of TB illness costs where households engage in either cost prevention strategies (do not seek treatment or abandon treatment) or asset strategies to mobilise substantial sums of money The median total costs for household members' involvement for a patient that was not isolated totalled €105,9 (68.848 FCFA) while for an isolated patient the costs decreased dramatically to only €12,4 . These numbers signify that for patients who were not isolated the costs for household involvement during the healing process was 8,6 times higher than for isolated patients. Subsequently 63% of households did avoid these costly direct expenses, leading to the social isolation of the in-patients. In the words of isolated patients:- None of my brothers have come to visit me here, not even my children. I don't know if it's the costs of transport, whether that is too much for them or if they have neglected my person. They await me or my dead body. I have taken my heart away from the village. Now that I'm here I only think about the hospital. I don't know what's going on in my village. I no longer care. But when I'll return to the village I will still be me and I will live with them.- My son no longer comes to visit me, I don't know if he doesn't even consider me his father any more, because if he did he should be here.- I told my children not to come anymore, it's better for them to spend the money in the village. It's a ruin for them to visit me.hidden costs. Our research found that despite the availability of free of charge medical care, households of Bu patients in the study area faced an unbearable cost burden. The majority of households responded by withdrawing involvement in care, leaving patients socially isolated. This reality raises questions of how to increase accessibility to biomedical treatment and how to proceed with future programs.Growing awareness of the connection between ill health and impoverishment has placed health at the centre of development agencies' poverty reduction targets and strategies and strengthened arguments for a substantial increase in health sector investment. Subsequent research, however, has shown the difficulty in alleviating the cost burden of illness for poor households due to the presence of The median cost burden of Bu hospital treatment was estimated at 25% for costs directly covered both by the household and by the patient. In most illness studies mean direct costs are estimated between 2,5% and 7,0% of household earnings. However, many chronic illnesses, such as TB in Malawi, account for cost burdens between 8–20% of annual earnings; and in sub-Saharan Africa and Thailand, AIDS related treatment absorbed 50% or more of annual income and often is- avoided by households. This circumvention of costs was evident for 63% of in-patient children and 71% of the adults who had no caretaker present. These numbers signify that for patients who are not isolated the direct costs for their households during the healing process is 8,6 times higher than for isolated patients.With its 25% cost burden, Bu surpasses the cost burden threshold of 10%, which has shown to be catastrophic for the household economy Furthermore, qualitative research affirmed that the caretaker during hospital treatment is not a stable fixture; rather, a considerable percentage of caretakers leave during treatment, especially when they perceive the illness to no longer be ‘serious’. Subsequently, 63% of in-patients were socially isolated at the hospital setting. Furthermore, initial qualitative data showed that, according to hospital patients, social isolation is the principal cause for abandonment of in-patient treatment. In endemic communities, it was further stated that fear of social isolation is one of the major reasons for postponing or avoiding hospital treatment and why traditional healing is often preferred since it is usually locally provided or provided in the vicinity of the patient's community.distance from the community to the treatment centre: (1) Transportation costs. While transportation costs are an additional cost for the patient, they represent a debilitating burden for caretakers since they continue to have social obligations to other household members (i.e. other children), signifying repeated visits to the hospitalised patient. Accordingly, transportation costs account for 29% of median direct costs. (2) Feeding costs. The costs of food for the patient at the hospital setting can be minimised through the provision of agricultural products from the household's slash and burn cultivation. However, this coping strategy is only feasible in cases when regular visits are also feasible, such as when treatment is carried out in the general vicinity of the patient's community. This avoids extra expenses for paid meals for patients and caretakers . (3) Productivity loss. Though the productivity loss of Bu patients could arguably be comparable in the hospital and community settings, that of the caregivers is greatly affected by the location of patient's treatment. When the patient receives treatment in the community or within the vicinity the caregiver can combine his/her daily economic activities with the patient's care without a serious impact on productive activities (median indirect costs for caretakers represent one of the most taxing costs).With respect to the cost burden equation, the weight of certain variables such as transportation costs, feeding costs and productivity loss of caretaker(s) are proportionate to the The importance of the above-mentioned factors in relation to the economic and social impact of Buruli ulcer disease was also evident in patients' health seeking behaviour during field work. The fact that traditional healing minimised or largely avoided such costs was cited by respondents as a major reason why traditional treatment was often preferred to biomedical treatment. In this sense, decentralisation is expected to sidestep or drastically reduce the mentioned costs and to increase the sustainability of households' involvement during the patient's illness period, reducing patients' social isolation and create possibilities to increase adherence.From a socio-economic perspective, it can, therefore, be concluded that a decentralised system of treatment with minimal hospital stays could limit household impoverishment as the long term nature of the illness makes it impossible for a household to indefinitely sustain its involvement with the hospitalised patient. A multidisciplinary study to evaluate a decentralised system of care with minimal hospital stays is, therefore, essential.Alternative Language Abstract S1Translation of the Abstract into Spanish by Joan Muela Ribera(0.03 MB DOC)Click here for additional data file.

Epstein-Barr virus (EBV) presumably plays an important role in the pathogenesis of nasopharyngeal carcinoma (NPC), but the molecular mechanism of EBV-dependent neoplastic transformation is not well understood. The combination of bioinformatics with evidences from biological experiments paved a new way to gain more insights into the molecular mechanism of cancer.We profiled gene expression using a meta-analysis approach. Two sets of meta-genes were obtained. Meta-A genes were identified by finding those commonly activated/deactivated upon EBV infection/reactivation. These genes could be key players for pathways de-regulated by EBV during latent infection and lytic proliferation. Meta-B genes were obtained from differential genes commonly expressed in NPC and PEL (primary effusion lymphoma). We then integrated meta-A, meta-B and associated factors into an interaction network using acquired information. Our analysis suggests that NPC transformation depends on timely regulation of DEK, CDK inhibitor(s), p53, RB and several transcriptional cascades, interconnected by E2F, AP-1, NF-κB, STAT3 among others during latent and lytic cycles.In conclusion, our meta-analysis strategy re-analyzed EBV-related tumor data sets and identified sets of meta-genes possibly involved in maintaining latent or switching to lytic cycles of EBV in NPC. The results of this analysis may shed new lights to further our understanding of the EBV-led neoplastic transformation. BZLF1 gene, is a potent transactivator of multiple viral and cellular genes critical for switching from latent to lytic cycle. Epithelial cells generally do not express CD21 in vivo and can be infected in vitro by direct contact with virus-containing cells or supernatant. This suggests that epithelial tissues might be infected by being close to lytically infected B cells. It remains to be shown that the transforming potential of EBV might ultimately contribute to the pathogenesis of NPC.Nasopharyngeal carcinoma (NPC), whose onset can be found in the epithelial cells of the nasopharyngeal region, causes a high incidence of fatality in patients mostly in southern China and southeast Asia . Epsteint-test and ANOVA) have been applied to select candidate genes associated with tumorigenesis [Currently, NPC studies aim to achieve the following objectives: providing an early and sensitive diagnosis, and trying to understand the molecular basis underlying the disease formation ,6. The aigenesis ,9. With igenesis ,11. Manyigenesis -14. Moreigenesis ,16. The In this study, we have utilized a meta-analysis approach to identify meta-genes across different data sets. This is based on the belief that those significant genes shared by multiple data sets could be the ones which are more important to focus on. This allows us to turn our attention and resources to potentially high value targets as they are less likely to be derived from randomness of analysis. Using such strategy, we have identified two sets of meta-genes (meta-A and meta-B) and discussed the potential roles some of them might play in the course of EBV-related neoplastic transformation.+tumors (NPC and PEL) to find meta-genes commonly de-regulated by EBV. In phase two, gene clustering, pathway and network prediction were done in four steps: (i) Meta-genes were classified based on known functional categories and similar ontological terms; (ii) Over-represented transcription factor binding sites (TFBSs) were predicted; (iii) Literature mining was conducted to analyze transcription factors that are co-cited with the meta-genes and (iv), Tissue specificity and subcellular localization of the meta-genes were analyzed. Finally, we integrated all the above information into a gene interaction network and proposed our hypothesis.To overcome the weakness of conventional microarray-based data analysis, meta-analysis was applied to heterogeneous microarray data of various origins ,17. We d-/normal) and GSE2371 (EBV+/EBV-). In brief, of the 260 differentially up-regulated genes in GSE2371, 32 were also up-regulated and 14 others were found down-regulated in GSE2370. Of the 253 genes in the down-regulated group in GSE2371, 25 genes were up-regulated and 16 were down-regulated in GSE2370. A total of 87 differential genes were identified as likely targets by EBV during primary infection. Many of these genes have been discussed [The Venn diagram in Figure iscussed .Figure When cross-comparing these 116 differential genes expressed during EBV reactivation to the 87 differential genes found during primary infection, 23 meta-genes and 729 genes in GSE2149 (EBV+-PEL) were integrated in Figure DEK, DUSP1 and ITGA6.The 585 differential genes in GSE2371 (EBVp = 0.047), macromolecule metabolism (p = 0.021), phosphorylation (p = 0.037), biopolymer metabolism (p = 0.008), protein complex (p = 0.028), cellular metabolism (p = 0.042) and organ morphogenesis (p = 0.037) based on DAVID analysis. The 45 meta-B genes in NPC and PEL are related to organelle lumen (p = 0.044), cellular physiological process (p = 0.030), macromolecule metabolism (p = 0.050), ribonucleoprotein (p = 0.038), regulation of cell process (p = 0.048), cell adhesion (p = 0.012) and transferase activity (p = 0.018).23 meta-A genes listed in Table p < 0.05) revealed that HLF-01, ATF-01, MYCMAT-01, E2F-01, CREB-02, NFE2-01, MAX-01, CREB-01, TATA-01 and OCT-01 are over-represented within the proximal promoter region of many meta-A genes. We then looked for any common regulatory module by sifting through each of the promoter sequences. As a result, DUSP1, IMPDH2, RPS28, TOP1, PBPC1 and EMP3 found in our study share these two TFBSs: ATF and CREB.TELiS analysis EBV seems to have a preference of targeting differentially expressed genes than those expressed ubiquitously in NPC cells [(ii) Nonetheless, only a fraction of these genes (meta-A genes) stay differential during recurrent EBV reactivations and most other genes return to stable expression gradually. Those remain differentially expressed during recurrent reactivation worth more attention. They might be responsible for subsequent cellular transformation and possibly metastasis by spreading the virions through EBV's lytic proliferation and transforming more vulnerable host cells into NPC. (iii) The 45 meta-B genes shared by EBV-associated NPC and PEL would give important clue to understand the common pathogenesis of the EBV-led pathogenesis. The fact that both meta-A and meta-B gene sets share DEK, DUSP1 and ITGA6 in common indicates that all three cancer-related genes are more important to look at among all others.Four microarray data sets Table were choPC cells . This suBZLF1. A transcriptional circuit involving SP1, CD9, EGR1 and IMPDH2 connects three pathways led by LMP1 to the BZLF1 cascade through the inter-network between SP1 and STAT3 [With knowledge gathered by in-depth analysis, a detailed regulatory network was set up by joining newly identified meta-genes with related transcriptional factors. As shown in Figure nd STAT3 . It is wnd STAT3 , and SP1nd STAT3 ,24. Thisnd STAT3 ,26.DEK has been shown to be targeted and activated directly by E2F [DEK knockdown was accompanied by increased protein stability and transcriptional activity of the p53 tumor suppressor [In latent infection, CDK2 activity is needed to maintain cell cycle progression and to phosphorylate RB. The pairing of RB/E2F as a complex plays important role in cell cycle regulation, apoptosis, differentiation and EBV y by E2F . DEK, any by E2F , can they by E2F . It has y by E2F ,32. Cellppressor . When RBppressor .BZLF1 and BRLF1, the switches from latency to lytic infection, are the drivers of the EBV lytic replication [BZLF1 during recurrent reactivation. Expression of the Z protein, encoded by BZLF1, is known to arrest cell cycle progression in several epithelial tumor cell lines lacking the entire EBV genome. Such arrest is mediated by Z-induced expression of p53 and two inhibitors of CDK, namely p21 (CDKN1A/CIP-1) and p27 (KIP-1), followed by the accumulation of the underphosphorylated RB protein and the down-regulation of EBV immediate-early and early proteins [lication . Their elication -37. The lication ,39. We plication , may be proteins .DEK is much lower in reactivation state than in latent state. The lack of E2F released from the hypophosphorylated RB-E2F complex may have a causal effect on the down-regulation of DEK and thus promotes apoptosis in the presence of apoptotic factors such as p53. This suggests that DEK may have been down-regulated in response to BZLF1 activation to favor the lytic cycle. Comparing to latent cycle, the lytic cycle produces infectious virions up to 1000 folds and possibly leads to the infection and transformation of more host cells. The accumulative effect of this could ultimately leads to aggressive tumor growth and metastasis. The potent lytic inducer BZLF1 has been explored to treat EBV+ tumors [BZLF1, if over-expressed exclusively in tumor cells using a tumor-specific vector , could induce potent cell lysis and serve as a general strategy to treat many cancers.Expression level of + tumors ,43. BZLFOur meta-analysis approach re-analyzed four EBV-related tumor data sets and identified meta-genes using expression profiling and integrated bioinformatics. Based on this information, we constructed a gene network to better our understanding of EBV-regulated neoplastic transformation. It should be pointed out that we have not specifically addressed the false discovery rate directly and thus our statistical analysis might have unavoidably produced some false positive hits or missed some important genes. However, gene set intersection can somehow prevent a large number of random genes from entering into our selection. Like any other analytical approach, this process depends on data quality and completeness. It may not identify all the desirable inner networks if data is sub-optimal.This study has identified two sets of meta-genes, including 23 meta-A genes expressed differentially when switching to recurrent reactivation, and 45 meta-B genes expressed in both EBV-dependent NPC and PEL. The integrated meta-gene network suggests that NPC transformation is likely to depend on timely regulation of DEK, CDK inhibitor(s), p53, RB and several transcriptional cascades, interconnected by E2F, AP-1, NF-κB, STAT3 among others during EBV's life cycle. The result of this analysis demands for further investigation to validate and to justify. More data analyses are needed to support and to complement ours in order to explore thoroughly the molecular mechanism of NPC. It is hope that research like this could point to the right direction for conquering this deadly disease eventually. In the meanwhile, the causal effect of EBV for NPC remains for open discussion even though it is known for long that EBV is omnipresent in NPC. Future research should also pay attention to impacts of other factors as well since NPC is quite restricted to some local populations and geographic locations. These factors include environmental, dietary ones in addition to ethnic genetic susceptibility and polymorphism.Homo sapiens NPC cell line derived from a keratinizing squamous cell carcinoma; TW03 is derived from a lympho-epitheliomatous undifferentiated NPC; TW04 and TW06 are derived from two distinct undifferentiated carcinomas; and CGBM1 line is derived from bone marrow metastatic NPC tumor tissue. GSE 2370 used the five EBV- NPC cell lines (labeled with cy5) mentioned above against normal nasal mucosal epithelial (labeled with cy3) as a control. GSE2371 used the same five EBV- NPC cell lines and EBV+ cell lines (labeled with cy5) against common reference RNAs (labeled with cy3). Dataset GSE6472, supplied by Chia [n-butyrate (SB) and 12-o-tetradecanoylphorbol-13-acetate (TPA), respectively. Dataset GSE2149, supplied by Fan [+/EBV--PEL. More information of the four data sets is shown in Table Four data sets retrieved from the GEO database are listed in Table by Chia and baseThe raw data from each experiment was normalized using Lowess smoother for data sets GSE2370, GSE2371 and GSE6472, or using median over entire array for GSE2149 to minimize randomness of signals among microarrays and spots. To focus on high-quality and stronger hybrid signal spots, we excluded all data points whose signal intensities below 100. Filtering on flags, which we required all present calls only, was applied to GSE2370 and GSE2371. Filtering on expression level with threshold of standard error average× 4 were used for GSE6472. Probes with 20% data points missing were then filtered out for GSE2149.p < 0.05) of GSE2370 revealed that 1182 genes were differentially expressed, including 617 genes with greater than 1.765 fold-changes as an up-regulated group and 565 genes with less than -1.765-fold defined as a down-regulated group. Similarly, analysis of GSE2371 revealed that 513 were differentially expressed, including 260 genes showing greater than 1.25-fold as up-regulated group and 253 showing less than -1.25-fold as down-regulated group. The differential genes identified from analyzing GSE2370 and GSE2371 were designated as potential target genes of primary EBV infection.We utilized GeneSpring GX 7.3.1 to analyze two-channel data and BRB ArrayTools 3.5.0 (Dr. Richard Simon and Amy Peng Lam) to analyze one-channel data. GeneSpring GX was used to analyze GSE2370, GSE2371 and GSE6472 using cross gene error model . The folUp-regulated or down-regulated genes in GSE6472 were identified using an absolute threshold of 1.5-fold. Then, the differential genes of R1/P1/R15/P15 were cross-compared to those from GSE2371 to obtain meta-A genes which are targeted by EBV and subjected to EBV reactivation of various duration and frequency.+/EBV--NPC and EBV+/EBV--PEL respectively. We collected the common differential meta-B genes infected by EBV between the two tumors by cross-comparing the gene sets obtained after analyzing the two data sets using BRB ArrayTools. Genes showing an absolute 1.5 fold-changes (p < 0.05) in either direction were counted as either up-regulated or down-regulated.GSE2371 and GSE2149 come from EBVWe postulate that the differentially expressed genes we identified may be functionally related and not independent. Hierarchical clustering and K-means clustering ,49, two The differentially expressed genes related to NPC, which is a complicated disease, might be co-regulated by a regulatory module rather than any individual factor. Therefore, we searched for TFBSs using Transcription Element Listening System (TELiS) with a diHOP was usedTissue-specific/selective gene expression is believed to be of physiological importance . We compXC and SL conceived, designed the meta-analysis and drafted the manuscript. XC carried out the bioinformatics analysis. ZJL and TS assisted in analytic tools. WLM and WLZ initiated the project and supervised the graduate program. All authors read and approved the manuscript.34 lymph node-selective genes. This file shows the gene IDs, gene names and gene symbols of 34 lymph node-selective genes.Click here for fileFigure Click here for fileFigure Click here for file

A response to Jorge Esteves, Carolina Maurente da Rosa, Caroline Kaercher Kramer, Luiz Eduardo Osowski, Stéfano Milano and Luís Henrique Canani: Absence of diabetic retinopathy in a patient who has had diabetes mellitus for 69 years, and inadequate glycemic control: case presentation. Diabetology & Metabolic syndrome 2009, 1:13. We read with interest the case described by Jorge Esteves et al. It is a well-documented case of a 73-year-old woman who had type 1 diabetes mellitus for the past 69 years, with no evidence of diabetic retinopathy (DR), despite poor glycemic control and several risk factors for DR including the long duration of the disease, early age at diagnosis of type 1 diabetes mellitus and presence of hypertension and cardiovascular disease.The patient's case was regularly followed in the Department of Ophthalmology for the past 20 years. Recently, there were many reports of spontaneous regression of DR -3. It coThere are certain documented ocular and systemic factors which are known to protect a diabetic patient against the development of DR. These include high myopia, raised intraocular pressure and moderate carotid stenosis. The patient's intraocular pressure was always within normal range but there was no mention of her refractive status. If she was a high myope, this could have contributed to protection from DR. Also, since she was known to have significant macroangiopathy manifested by peripheral vasculopathy and cardiovascular disease , a carotid doppler examination could be planned at her next follow-up to rule out carotid insufficiency as a factor providing her protection against development of DR.TNF gene for association with retinopathy in a self reported diabetic cohort. We found a low risk allele ((GT)9) and a high risk allele ((GT)13) for DR in this gene [The authors have also drawn attention to the existence of locally protective genetic factors. They have referred to some studies on the genetics of DR in which the genes of aldose reductase, RAGE, VEGF, ACE, NOS, ICAM-1 and PPAR-d have been considered candidates for DR. We have also identified genetic factors implicated in the predisposition to DR or protection against the development of DR -9. RAGE,his gene . Later whis gene . RecentlAlthough there seems to be some biologically plausible mechanisms which offer some protection against DR, a study of a larger cohort of such subjects with diabetes, including systemic, local and genetic factors will provide better evidences.The authors declare that they have no competing interests.Authors RR and AG read the article, analyzed it and wrote the manuscript. Both authors read and approved the final manuscript.

Predicting whether a critically ill patient will survive intensive care treatment remains difficult. The advantages of a validated strategy to identify those patients who will not benefit from intensive care unit (ICU) treatment are evident. Providing critical care treatment to patients who will ultimately die in the ICU is accompanied by an enormous emotional and physical burden for both patients and their relatives. The purpose of the present study was to examine whether health-related quality of life (HRQOL) before admission to the ICU can be used as a predictor of mortality.We conducted a prospective cohort study in a university-affiliated teaching hospital. Patients admitted to the ICU for longer than 48 hours were included. Close relatives completed the Short-form 36 (SF-36) within the first 48 hours of admission to assess pre-admission HRQOL of the patient. Mortality was evaluated from ICU admittance until 6 months after ICU discharge. Logistic regression and receiver operating characteristic analyses were used to assess the predictive value for mortality using five models: the first question of the SF-36 on general health (model A); HRQOL measured using the physical component score (PCS) and mental component score (MCS) of the SF-36 (model B); the Acute Physiology and Chronic Health Evaluation (APACHE) II score ; general health and APACHE II score (model D); and PCS, MCS and APACHE II score (model E). Classification tables were used to assess the sensitivity, specificity, positive and negative predictive values, and likelihood ratios.A total of 451 patients were included within 48 hours of admission to the ICU. At 6 months of follow up, 159 patients had died and 40 patients were lost to follow up. When the general health item was used as an estimate of HRQOL, area under the curve for model A (0.719) was comparable to that of model C (0.721) and slightly better than that of model D (0.760). When PCS and MCS were used, the area under the curve for model B (0.736) was comparable to that of model C (0.721) and slightly better than that of model E (0.768). When using the general health item, the sensitivity and specificity in model D (sensitivity 0.52 and specificity 0.81) were similar to those in model A (0.45 and 0.80). Similar results were found when using the MCS and PCS.This study shows that the pre-admission HRQOL measured with either the one-item general health question or the complete SF-36 is as good at predicting survival/mortality in ICU patients as the APACHE II score. The value of these measures in clinical practice is limited, although it seems sensible to incorporate assessment of HRQOL into the many variables considered when deciding whether a patient should be admitted to the ICU. It is difficult for doctors to predict whether a critically ill patient will survive intensive care treatment. Mortality in patients admitted to intensive care units (ICU) remains high . An incrThe goal of the present study was to evaluate the predictive value for survival of the pre-admission HRQOL, alone and in combination with the APACHE II score, in critically ill patients.All patients admitted for more than 48 hours to the 10-bed mixed surgical-medical ICU of the Gelre Lukas hospital in Apeldoorn were eligible for the study. We included only patients with a ICU stay of longer than 48 hours because we aimed to evaluate the sickest patients, hypothesizing that those patients were more likely to die. We felt that proxies of patients who would die during the first 48 hours after ICU admission should not be burdened with study participation. Between September 2000 and April 2004, all admitted patients were screened for eligibility for study participation , a generic, widely used standardized health status questionnaire, was used to measure HRQOL. This measurement contains eight multi-item dimensions: physical functioning, role limitation due to physical problems, bodily pain, general health, vitality, social functioning, role limitation due to emotional problems, and mental health. Answers to the 36 items were transformed, weighed and subsequently scored according to predefined guidelines [The Short-form 36 , adjusted for age and sex.A Pearson's χTo analyze the potential of variables to predict mortality in patient subgroups, we used five statistical models. HRQOL was entered as the response to the single-item question, or as MCS and PCS. In the model A we included the general health item of the SF-36, age and sex. In model B we included both the PCS and MCS from the SF-36, and age and sex. In model C we included APACHE II score, age and sex. In model D we included the general health item of the SF-36, APACHE II score, age and sex. In model E we included both the PCS and MCS from the SF-36, APACHE-II score, age and sex.To estimate the ability to discriminate between survivors and non-survivors, odds ratios were calculated, receiver operating characteristic analysis was performed and the area under the curve (AUC) was calculated. Classification tables were used to assess the sensitivity for observed deaths being labeled by the models as predicted deaths, specificity for a predicted death being an observed death, and positive and negative predictive values and likelihood ratio. Data were analyzed using SPSS . All data are expressed as median (interquartile range), unless indicated otherwise.P < 0.05 was considered statistically significant.During the study period, 451 patients were included. At 6 months after ICU discharge, 159 patients had died. Forty patients were lost to follow up pre-admission HRQOL was derived from the patients themselves, whereas all other SF-36 scores were obtained from proxies.Of the 451 included patients, in a small proportion of patients (n = 451), sensitivity improved from 0.44 to 0.56 , respectively. Results for specificity were similar, improving from 0.84 to 0.82 . Similar results were also found when using the general health item was comparable to that for the APACHE II score and slightly better than that in model D (AUC = 0.760), in which both factors were combined Table and withP < 0.001), with respect to all, that is: excellent (3.6% of survivors versus 1.9% of those who died), very good (5.6% versus 4.4%), good (41.3% versus 18.9%), fair (38.1% versus 50.9%), or poor (11.5% versus 23.9%). Other possibly relevant variables such as the presence of severe sepsis, length of ICU and hospital stay, and ventilation days were included in the logistic regression analysis. However, because these variables did not contribute significantly to the prediction models, they were omitted from the final models, as described above.The scores on the single-item question pertaining to general health status before ICU admission were higher in survivors than in the patients who died and the APACHE II score. Incorporating HRQOL into prediction models does not improve the predictive capacity of established models such as APACHE II and is not useful in clinical practice for making decisions in individual cases.Mortality is difficult to predict for an individual patient because many factors determine survival from critical illness, such as age, sex, acute physiological deterioration and underlying illnesses. Several scoring systems aimed at predicting mortality have been developed that incorporate these factors. The APACHE II and III scores ,14., theThe advantages of using pre-admission HRQOL as a predictor of mortality are that it is easily obtained and available as soon as the patient, or a proxy (close family member), in the case of incapacity, can be questioned. In particular, a single item like the first question of the SF-36 is advantageous because of its simplicity and ease of administration in seriously ill patients. However, this benefit may be obtained at the cost of detail in the information provided. Multiple-item scoring systems such as the SF-36 have the advantage of providing a complete profile of HRQOL, although they are more laborious and carry the risk of asking potentially irrelevant questions . These tCan HRQOL be used as an indicator of final outcome? Several studies have addressed this question in dialysis patients -20, coroCurrently, HRQOL surveys are rarely used in ICU clinical practice, and they predominantly address the impact that critical illness has on HRQOL after ICU survival. Only a few studies have focused on the association between pre-admission HRQOL and survival in critically ill patients -26. YinnMore recently, Welsh and coworkers found thThe most recent work on this issue is that reported by Rivera-Fernandez and coworkers , who demWe conducted a long-term prospective study, which is an important strength of the data presented. Nevertheless, several limitations of our study should be mentioned. First, potential selection bias might have been present, because the HRQOL assessment could have influenced the decision to admit a patient to the ICU. However, we do not believe that this factor is important because the research nurse conducting the study did not communicate HRQOL findings to attending ICU physicians. Second, the APACHE II system was intended to be used to predict in-hospital mortality, not long-term mortality at 6 months or even later. However, repeating the analysis when omitting those patients who died after hospital discharge did not alter the results.A third limitation of our study was the necessary use of proxies to evaluate pre-admission HRQOL instead of a retrospective assessment at ICU discharge could also have hampered results. We believe that this approach did not affect the final results, in view of the findings of previous validation studies -11. MoreA fourth limitation is that we only included patients with an ICU stay longer than 48 hours, because we aimed to evaluate in particular the sickest patients surviving critical illness. Clearly, this selection makes definite conclusions regarding HRQOL as a predictor of mortality impossible. Nevertheless, the combination of the APACHE II score with HRQOL scores improved the correct prediction of survival. A final potential limitation of the study is that this was a single centre study and the results may not be generalizable to other ICU populations with different patient populations or staffing situations.Pre-admission HRQOL, as estimated using a single-item question, in critically ill patients is as good at predicting survival/mortality as the APACHE II score. Initial evaluation of HRQOL can be done with the single-item question, because the SF-36 (PCS and MCS) yielded comparable results. The value in clinical practice of using the pre-admission HRQOL and the APACHE II score to provide useful predictive information in order to inform decision making appears to be limited, because of limitations in these models' abilities to predict survival/mortality in individual cases. Incorporating HRQOL into prediction models does not improve the predictive capacity of established models such as the APACHE II score. Nevertheless, it appears sensible to incorporate assessment of HRQOL into the many variables that may be considered when deciding whether a patient should be admitted to the ICU.• Estimate of HRQOL before ICU admission is as good at predicting survival/mortality as the APACHE II score.• The value of HRQOL measures and the APACHE II score is limited in clinical practice for making decisions in individual cases.APACHE = Acute Physiology and Chronic Health Evaluation; AUC = area under the curve; HRQOL = health-related quality of life; ICU = intensive care unit; LASA = linear analogue self assessment; MCS = mental component score; PCS = physical component score.The authors declare that they have no competing interests.All authors contributed substantially to the study. JGMH analyzed and interpreted the data and drafted the manuscript. PES conceived of the study, contributed to the interpretation and analysis of the data, and revised the manuscript for important intellectual content. JHR conceived of the study, contributed to its design and the interpretation of the data, and revised the manuscript for important intellectual content. HFvS conceived of the study, contributed to the analysis and interpretation of the data, and revised the manuscript for important intellectual content. AJPS contributed to the interpretation of the data, and revised the manuscript for important intellectual content. JB contributed to the design and the interpretation of the data, and revised the manuscript for important intellectual content. All authors approved the final version submitted for publication.

Low levels of physical activity are characteristic in preschoolers. To effectively promote physical activity, it is necessary to understand factors that influence young children's physical activity. The present study aimed to investigate how physical activity levels are influenced by environmental factors during recess in preschool.Preschool playground observations and pedometry during recess were carried out in 39 randomly selected preschools . In order to examine the contribution of playground variables to physical activity levels, taking adjustment for clustering of subjects within preschools into account, multilevel analyses were conducted.2 and with shorter recess times. Only in boys a hard playground surface was a borderline significant predictor for higher physical activity levels. In girls higher step counts were associated with the presence of less supervising teachers. Playground markings, access to toys, the number of playing or aiming equipment pieces and the presence of vegetation or height differences were not significant physical activity predictors in both genders.During recess boys took significantly more steps per minute than girls (65 ± 36 versus 54 ± 28 steps/min). In both genders higher step counts per minute were significantly associated with less children per mIn preschool children physical activity during outdoor play is associated with modifiable playground factors. Further study is recommended to evaluate if the provision of more play space, the promotion of continued activity by supervisors and the modification of playground characteristics can increase physical activity levels in preschoolers. The childhood obesity epidemic is affecting even preschool children and reduced physical activity is an important contributor to this problem -4. The NAccording to the recent review of Davison and Lawson , the rolBesides the home environment, the preschool environment may play an important role in achieving adequate physical activity levels for young children since in many countries most children spend extensive time in preschools. However, Pate et al , Finn etIn most preschool programs, break times with unstructured free play are scheduled for more periods each day, making it an important environmental factor for the promotion of physical activity. While the terminology of break time at pre-school may differ across countries, in the present study the term "recess" is used. Recess is typically held outdoors and allows children to move freely. However it was shown that 4- to 5-year-old children spent the majority of recess break time in sedentary activities . In the The study was executed in Flanders, the Dutch speaking part of Belgium, located in the centre of Europe. In Flanders almost all elementary schools have a public preschool program , which allows children to participate from the age of 2.5 years old. The programs are free and virtually all children attend. Since they are organized in the elementary school settings, large and safe indoor and outdoor spaces to play are available for most preschool programs. Moreover, all preschool programs are lead by college educated teachers. A random sample of 45 preschools from 40 different municipalities in Flanders was asked to participate in the study. A sample of 40 schools agreed to participate. All parents (829) of the 4- and 5-year-old children of the 40 participating schools were informed about the study by an information letter. The evaluations were considered to be part of the psychological, medical and social counselling provided by the school, for which all parents signed a consent form. The study was approved by the Ethical committee of the Institutional Review Board at Ghent University.One school was excluded due to rainy weather on the three days of measurements attempts. Data for 27 children were omitted due to measurement errors or unrealistic data (< 15 steps recorded), possibly due to resetting. The final sample consisted of 415 boys and 368 girls , which is an unobtrusive instrument measuring 19 mm × 39 mm × 52 mm that uses a horizontal spring-suspended mechanical lever arm to measure vertical movement. Pedometry has been recommended due to children's intermittent pattern of physical activity and findFactors of the playground environment served as independent variables. All playground features were recorded by members of the research team, who visited the schools. The presence or absence of the following playground factors were recorded: markings, soft surface , vegetation, height differences, and availability of toys for a minimum of 10% of the children, The numbers of aiming equipments , the numbers of playing equipment and the numbers of teachers supervising during the PA registrations were counted by the researchers. The researchers measured all playgrounds to determine the play space per child. Playground features that were not accessible for the preschoolers during the measurements, were not included (e.g. none accessible field due to wet grass). Additionally, all playgrounds were photographed for verification by the first author.2, number of supervising teachers, recess duration, number of playing equipments, number of aiming equipment pieces, presence of a soft surface, markings, height differences, vegetation, and the access to toys) a single-predictor two-level (school-pupil) model was used. To test the significance of the variance at the school level Z-scores were calculated. Intra-school correlation was calculated to assess a measure of similarity between the same pupils in each of the schools. Intra-school correlations measure the extent to which step counts of pupils in one school resemble to each other as compared to those from pupils in different schools; it gives a measure of the percentage of variance in step counts that may be attributed to differences between schools. The alpha level was set at 0.05 for all analyses.Preliminary analyses consisted of descriptive statistics of sample characteristics using SPSS for windows (12.0). Univariate regression analyses were conducted using MLwiN version 2.02. As the dependent variable was skewed to the right, the square root was taken to improve the normality of this variable. To investigate the Univariate relationships between gender and step counts, taking into account adjustment for clustering of subjects within preschools, a single-predictor two-level model (pupil-school) was used. Because most studies in children showed gender differences in types of physical activity correlates ,27 analy2 was 0.15 . The average recess duration was 24.27 minutes . The mean number of aiming equipment pieces on the playground was 1.79 and schools had on average 2.53 pieces of playing equipment on the playground. Markings were present on 24 of the 39 playgrounds, 20 playgrounds had height differences, the playground surface was partly soft in 20 schools, in 23 schools toys were available for minimum 10 % of the children and in 21 preschools vegetation was present on the playground.The average number of children per mZ = 3.4, p < 0.07) and girls . Among boys, 27% of the variance in step counts was attributed to the differences between schools, among girls 35% of the variance in step counts was attributed to the differences between schools. Being a girl as compared to a boy was associated with significantly lower activity levels . In table 2 and recess duration . The presence of a soft playground surface was a borderline significant predictor . Among girls, step counts were significantly predicted by number of children per m2 , number of supervising teachers and recess duration . Lower numbers of children per m2 and shorter recesses were related to increased step counts per minute in both sexes. The presence of hard surfaces was related to higher activity levels among boys. Less supervising teachers on the playground was related to higher activity levels among girls. The number of playing equipments, number of aiming equipment pieces, presence markings, height differences, vegetation and the access to toys were not significantly related to step counts in both genders. Non-transformed data analyses gave identical results, except for a harder playground surface, which was significantly associated with higher step counts in boys (p ≤ 0.05).Variance at the school level was borderline significant among boys . Incorporating physical activity promotion in the training of future preschool teachers may enable them to implement the principles in their daily work and to enter into a professional career with a positive attitude toward physical activity promotion. According to the findings of Boldemann et al in envirA remarkable finding of the present study is the fact that the availability of toys, the presence of aiming or playing equipment, like swings or slides, and the presence of markings was not associated with more physical activity. Possibly the choice of toys (e.g. hoops), equipment pieces (e.g. swing) or markings (mainly field markings) were not optimal in the observed preschools and results may be different when focusing on certain types of toys, equipment or markings. Another explanation may be that toys and equipment often lead to standing in line to use the piece of toy or equipment. In the study of Zask et al equipmenA first limitation of the present study is that all data were collected during winter. Therefore physical activity levels possibly suffered from seasonal influence. However Belgium has a mild climate, measurements were only taken when the weather permitted outdoor playing and according to the findings of Fisher et al seasonalA second limitation is the use of pedometers, which may not capture or underestimate some activities among young children, like swinging or crawling. Strengths of the present study are the relatively large sample size, the use of an objective physical activity measure and observation of the playground environment, and the use of multilevel analyses to take into account adjustment for clustering of subjects within preschools.The present study contributed to the dearth of literature focusing on the correlates of physical activity in preschool children. It can be concluded from the present study that in preschool children physical activity during recess is associated with modifiable playground factors. Since many children attend preschool, there is a great potential to increase activity levels in preschoolers. Studying the effects of intervening on these factors is of interest. Meanwhile it seems plausible to recommend preschools to provide sufficient play space, to encourage supervisors to promote activity during recess, and to organize several recess periods during the day.The author(s) declare that they have no competing interests.GC, VL and IDB conceived the study and contributed to the planning and the design of the study. GC, VL and EVC collected the data and conducted data manipulation and analyses. LH contributed to the statistical analyses. GC wrote the manuscript. VL, IDB and EVC supplied comments. All authors read and approved the final manuscript.

The ep­oxy and hydroxyl groups are α-oriented. The cyclo­hexane rings adopt half-chair and chair conformations and the lactone ring is in an envelope conformation. The mol­ecular structure is stabilized by one O—H⋯O and three C—H⋯O intra­molecular hydrogen bonds.The title compound, C Å b = 7.239 (2) Å c = 11.434 (2) Å β = 94.201 (5)°V = 681.1 (3) Å3 Z = 2 Kα radiationMo −1 μ = 0.09 mmT = 292 K 0.20 × 0.09 × 0.08 mm Nonius KappaCCD area-detector diffractometerAbsorption correction: none6696 measured reflections1601 independent reflectionsI > 2σ(I)1495 reflections with R int = 0.042 R[F 2 > 2σ(F 2)] = 0.037 wR(F 2) = 0.108 S = 1.13 1601 reflections179 parameters1 restraintH atoms treated by a mixture of independent and constrained refinementmax = 0.17 e Å−3 Δρmin = −0.15 e Å−3 Δρ COLLECT used to solve structure: SIR97 (Altomare et al., 1999SHELXL97 (Sheldrick, 2008ORTEP-3 for Windows (Farrugia, 1997PLATON (Spek, 2009WinGX (Farrugia, 1999Data collection: 10.1107/S1600536809025124/pv2169sup1.cif Crystal structure: contains datablocks global, I. DOI: 10.1107/S1600536809025124/pv2169Isup2.hkl Structure factors: contains datablocks I. DOI: crystallographic information; 3D view; checkCIF report Additional supplementary materials:

Cost-Effectiveness and Resource Allocation (CERA) is now in its seventh year, and is an excellent example of how open access publishing can improve dissemination. Now the journal is through its infancy, it is time to reflect on its orientation and to define the strategy for the years to come. Firstly, the journal will pay particular attention to stimulating and publishing studies originating from low- and middle-income countries. Second, CERA will continue to solicit contributions originating from high-income countries, but with the caveat that such studies should be of interest to the broad international readership of the journal. Third, the journal encourages submissions on methodological work from any setting, that is generalisable between low-, middle-, and high income countries. Fourth, CERA recognizes the development of national health accounts and expenditure tracking as a first step to improved resource allocation, and solicit manuscripts of this nature. Finally, CERA recognizes that cost and cost-effectiveness analysis alone may not provide sufficient information to decision makers to guide their choices on the allocation of resources, and therefore encourages submission of studies that advance the broader field of priority-setting.The journal Cost-Effectiveness and Resource Allocation (CERA) is now in its seventh year. In this period, it has published 93 papers on various aspects of cost-effectiveness analysis, including conceptual or methodological work, economic evaluations, and policy analysis related to resource allocation at a national or international level. CERA is an Open Access online journal. The importance of this form of dissemination is well-recognized by research funders, such as the Medical Research Council and the Wellcome Trust, who insist that findings from research they fund is published in open access journals. CERA is an excellent example of how open access publishing can improve dissemination as illustrated by the large number of accesses to its articles: the 10 most popular articles have been accessed more than 8,000 times each, with the top-three accessed more than 21,000 times each. [Established in 2003, Now the journal is through its infancy, it is time to reflect on its orientation and to define the strategy for the years to come. This allows the journal to anticipate trends in cost-effectiveness and resource allocation in health, and to be an important journal in its field.CERA aims to bridge this gap and be a home for this type of information. As part of its new approach to stimulating studies from the developing world, CERA offers fee-waivers for submissions originating from low-income countries.Firstly, the journal will pay particular attention to stimulating and publishing studies originating from low- and middle-income countries. There will never be sufficient resources available to allow all possible means of improving health to be provided to all people who might benefit from them. Rigorous comparisons of the relative health improvements from alternative uses of scarce resources are critical for informed decision-making. While this is true in any setting, the resource constraints are much more severe in low- and middle-income countries. Of all peer-reviewed articles on cost-effectiveness analysis published by journals in 2007, only 7% were set in developing nations and just eight were in Africa . CERA aiacross different settings . Where the focus is on the developed world, we request authors to explain why the results might be of more general relevance as well.Second, CERA will continue to solicit contributions originating from high-income countries, but with the caveat that such studies should be of interest to the broad international readership of the journal. In the past few years, the journal has received an increasing number of pharmacoeconomic submissions relating to specific interventions that focus on small patient numbers, mainly in high-income countries. We invite researchers in high-income countries to submit empirical work that has strong relevance Third, we encourage methodological work from any setting, that is generalisable between low-, middle-, and high income countries. An example is the work by Mitton and Donaldson, on the principles, practice and challenges in health care priority setting. Another is the article by Bachmann and colleagues from South-Africa on the development of methods for analyzing cost effectiveness data from cluster randomized trials .Fourth, CERA recognizes the development of national health accounts and expenditure tracking as a first step to improved resource allocation. We thereby solicit manuscripts that document the development or application of methodological advances in health accounting and resource tracking.Finally, CERA recognizes that cost and cost-effectiveness analysis alone may not provide sufficient information to decision makers to guide their choices on the allocation of resources, and the implementation of interventions. Additional evidence on other relevant criteria, such as the budget impact of an intervention, whether an intervention targets disadvantaged populations, or the strength of evidence of its effectiveness is typically required. Additional challenges exist in addressing the many managerial questions decision-makers may have regarding the implementation of complex interventions. These questions can be considered to be part of the broader priority-setting process. CERA therefore encourages submission of studies that advance the broader field of priority-setting, in terms of methodological or conceptual contributions, as well as empirical case studies.To help in this process, Richard Grieve and Kathryn Antioch have agreed to serve as Associate Editors. Richard Grieve has a particular interest in methods, while Kathryn Antioch will focus largely on studies from the developed world.The authors declare that they have no competing interests.All authors contributed to writing the manuscript, and all authors read and approved the final manuscript.

Access to affordable health care is limited in many low and middle income countries and health systems are often inequitable, providing less health services to the poor who need it most. The aim of this study was to investigate health seeking behavior and utilization of drugs in relation to household socioeconomic status for children in two small Amazonian urban communities of Peru; Yurimaguas, Department of Loreto and Moyobamba, Department of San Martin, Peru.Cross-sectional study design included household interviews. Caregivers of 780 children aged 6–72 months in Yurimaguas and 793 children of the same age in Moyobamba were included in the study. Caregivers were interviewed on health care seeking strategies , and medication for their children in relation to reported symptoms and socio-economic status. Self-reported symptoms were classified into illnesses based on the IMCI algorithm (Integrated Management of Childhood Ilness). Wealth was used as a proxy indicator for the economic status. Wealth values were generated by Principal Component Analysis using household assets and characteristics.Significantly more caregivers from the least poor stratum consulted health professionals for cough/cold (p < 0.05: OR = 4.30) than the poorest stratum. The poorest stratum used fewer antibiotics for cough/cold and for cough/cold + diarrhoea than the least poor stratum . For pneumonia and/or dysentery, the poorest used significantly fewer antibiotics (16%) than the least poor (80%).The poorest seek less care from health professionals for non-severe illnesses as well as for severe illnesses; and treatment with antibiotics is lacking for illnesses where it would be indicated. Caregivers frequently paid for health services as well as antibiotics, even though all children in the study qualified for free health care and medicines. The implementation of the Seguro Integral de Salud health insurance must be improved. Following health reforms in the 1980s and 1990s, many Latin-American countries moved from universal coverage towards cost recovery initiatives utilizing, for example, user fees and social insurances . HoweverIn Peru, inequity in health service utilization during the late 1990s was shown for adults . FurtherThe Seguro Integral de Salud state health insurance (SIS) was implemented in Peru in 2001 and at the time of this study offered free of charge health care and pharmaceuticals, such as antibiotics, to children in the study area, regardless of socioeconomic status. Access to health services and pharmaceuticals following policy implementation has improved, at least theoretically through the SIS, for children from all socioeconomic groups; however, presumptive improvements in the health seeking behavior of poor children have yet to be empirically analyzed or verified. The question of verifiable improvements becomes even more essential when considering poor children who have high geographic access to health facilities. The aim of this study, therefore, was to describe health care access – measured as consultations with health professionals – and antibiotic use in relation to socioeconomic status for children who recently presented symptoms of infectious disease.This survey was conducted in 2002 in two Peruvian communities, Yurimaguas (Department of Loreto) and Moyobamba (Department of San Martin). In 2002, each community had a population of approximately 32000 inhabitants. Both departments represent one of the most underprivileged areas of Peru – the Amazonian region. Approximately 55% of the population lives below the poverty line, and 15% in extreme poverty and the majority of the working population survive on subsistence farming [The study was conducted in urban settings where geographical distances to health facilities are small. Yurimaguas has one Ministry of Health (MoH), a public hospital, a Local Committees for Health Administration (CLAS) Maternal Health Centre and two All licensed, private pharmacies – nine in Yurimaguas and fifteen in Moyobambas – had trained pharmacists on their staff list. However, in most cases, these pharmacies were run by assistants without formal education. Officially, antibiotics could only be sold by pharmacies, but in practice they were also bought without prescription, available at the market place, in food stores or from traditional healers.The SIS was created by merging the already existing Maternal/Infant and School insurances. In theory, SIS provided health care and essential pharmaceuticals via the public health care sector free of charge to those with low economic status, to pregnant women and to senior citizens, according to insurance schemes specified by target group. In areas with a poverty level higher than 60%, such as the Amazonian area, all children qualified for the insurance, irrespective of their parents' economic status. The insurance covered health care, including essential generic drugs and diagnostic services. Affiliation to the insurance was not, however, automatic and the children had to be registered every calendar year at the hospital's SIS office.The results presented in this paper were generated within the ANTRES project, a collaborative research project funded by the EC INCO-DEV, ICA4-CT-2001-1001, addressing the themes of antimicrobial use and resistance in Peru and Bolivia.This cross sectional survey used household interviews. Faecal samples were also collected for microbiological studies, which have been reported elsewhere . ChildreHousehold interviews were conducted by ten trained interviewers from the public health sector who had extensive experience working with community outreach activities. The children's caregivers were interviewed using a structured questionnaire (available from the first author) which had been pre-tested and validated during a pilot study. The caregivers were chosen for the interviews on the basis of being present in the household and taking care of the child during the time of the interviewers' visit. The majority of caregivers were mothers (87% in Moyobamba and 85% in Yurimaguas). Interview questions addressed the child's symptoms for the most recent illness during the previous two weeks, as well as all actions taken by the caregivers to cure the symptoms, including medication and healing practices. The interviewers first asked for the symptoms in an open-ended question and then probed by stating all symptoms in the questionnaire one by one while also explaining the symptoms.A system for checking data quality was developed in order to ensure high quality during study implementation: on a daily basis, study supervisors screened the questionnaires for missing responses and logical inconsistencies and requested re-visits to households where more detailed clarifications where needed. The caregivers were also asked to show interviewers the package or blister pack if antibiotic use was reported. If caregivers were not in possession of the package or did not remember the name of the antibiotic consumed, but could describe the package, bottle or tablet, the interviewers presented them with identifiable antibiotics samples. The interviewers also carried a list of local antibiotic brand names and the corresponding ATC category .The health seeking behavior was classified into "self-care", "exclusive consultation " and "self care and consultations". Self-care was defined in line with Levin as all tThe symptoms (as reported by caregivers) were classified according to the principles of the IMCI algorithm (Integrated Management of Childhood Illness) for classification and treatment of infectious diseases in children in low malaria-prevalence areas . The algor symptoms of pneumonia and dysentery, or cough/cold and dysentery).The children were classified with one of the following illnesses: diarrhoea , dysentery , cough/cold , pneumonia , cough/cold + diarrhoea (Symptoms of cough/cold and symptoms of diarrhea), pneumonia and/or dysentery and the least poor half (the two least poor strata pooled) in relation to cost incurred for health care, cost for antibiotics and place of provision of antibiotics. The difference has been considered significant if the p-value is less than 0.05.Of a total of 780 children from Yurimaguas included in the study, 382 (48%) children had shown symptoms related to infectious illnesses in the previous two weeks. In Moyobamba, 425 (54%) of a total of 793 children had suffered from symptoms. In total, four children were excluded due to incomplete data regarding health seeking behavior, leaving 803 children for further analysis.Many caregivers (42%) stated that they had consulted health professionals with regard to their children's health problems Table . The leaIn all strata, public sector medical doctors were the most commonly visited health professionals. The least poor households consulted nurses and health technicians to a lower extent than the poorest households . Caregivers from all strata paid out-of-pocket for care provided by public sector health facilities (Table A similar antibiotic use was reported for the children in Yurimaguas and Moyobamba (42% and 36% respectively). As the patterns of medicine use in relation to socio-economic status and illnesses were similar for the two communities, the pooled data from both is presented in Table The locations for antibiotic provision, including antibiotics for self-medication, were investigated. In Yurimaguas, the two least poor strata had bought their antibiotics (either as a part of self care or with a prescription) at the pharmacy (private or public pharmacy) significantly (p < 0.05) more frequently 45%) than the two poorest quartiles (15%) than the two poorest strata aimed to reduce financial barriers to health by providing free health care and pharmaceuticals for the target groups. In the Amazonian area, all children qualified for the SIS due to the high poverty status of the region. However, the formal supply of free health care was not enough to ensure equitable access, and instead, remaining barriers exist which prevented equitable supply. For example, following initiation of the SIS, it is plausible that caregivers lacked adequate information about the benefits and regulations of the new SIS insurance system or that they may have confused it with previous insurance schemes that were granted only after assessment of the families' financial status. Either way, during the implementation of this study, the local health professionals complained that the poorest households were "over-seeking" health care for unnecessary symptoms and thereby wasting resources. Ironically, this attitude would have contributed to preventing truly vulnerable patient groups from seeking health care. Moreover, caregivers' perceptions about quality of care and pharmaceuticals, as well as attitudes of health professionals, have been shown to be important factors determining health facility utilization -27.The analysis of costs associated with health care services provided by the public health facilities in the two study sites showed that payments were made for consultations with health professionals, more often in Yurimaguas than in Moyobamba. Cost has been shown to be an important factor influencing health seeking behavior . AccordiThe poorest children were provided with fewer antibiotics for some of the illnesses where antibiotic use was recommended in the IMCI algorithm. According to our definition, this disadvantage represents a link to the inequity in heath-seeking behavior. An analysis of the costs paid for the antibiotics and the health care provided by public sector health professionals showed that a number of caregivers had paid for their antibiotics, even though these were supposed to be provided free of charge to all children through the SIS insurance. Our assessment of the location where the antibiotics had been acquired showed that a large part of the antibiotics were bought at public pharmacies. This finding indicates that the SIS implementation was not functioning in an optimal manner, as the health facilities were still charging the patients. On the other hand, purchasing antibiotics rather than receiving them free of charge could also be an indication of problems related to out-of-stock pharmaceuticals in the public sector or that informal payments were charged.The poorest were mainly self caring for non-severe illnesses such as common cold or non-complicated diarrhea. This is in line with IMCI recommendations and can This study shows that even in a setting providing universal access to free health care for children, the poorest seek less care from health professionals for severe illnesses, and that treatment with antibiotics is lacking for illnesses where it should otherwise be indicated. Despite that all children in the study qualified for free health care and medicines, their caregivers frequently paid for health services as well as antibiotics. Given these findings, the implementation of the Seguro Integral de Salud health insurance must be improved.The authors declare that they have no competing interests.CK participated in the design and implementation of the study, acquisition of data, analysis and interpretation of data and helped to draft the manuscript. EG participated in the design and coordination of the study, analysis and interpretation of data and helped to draft the manuscript. HR, AB and MS participated in the design and implementation of the study, acquisition of data and helped to draft the manuscript. GT and PH participated in the analysis and interpretation of data and helped to draft the manuscript. All authors read and approved the final manuscript.

Laccases are enzymes that couple the oxidation of substrates with the reduction of dioxygen to water. They are the simplest members of the multi-copper oxidases and contain at least two types of copper centres; a mononuclear T1 and a trinuclear that includes two T3 and one T2 copper ions. Substrate oxidation takes place at the mononuclear centre whereas reduction of oxygen to water occurs at the trinuclear centre.Bacillus subtilis was used as a model to understand the mechanisms taking place at the molecular level, with a focus in the trinuclear centre. The structures of the holo-protein and of the oxidised form of the apo-protein, which has previously been reconstituted in vitro with Cu(I), have been determined. The former has a dioxygen moiety between the T3 coppers, while the latter has a monoatomic oxygen, here interpreted as a hydroxyl ion. The UV/visible spectra of these two forms have been analysed in the crystals and compared with the data obtained in solution. Theoretical calculations on these and other structures of CotA were used to identify groups that may be responsible for channelling the protons that are needed for reduction of dioxygen to water.In this study, the CotA laccase from These results present evidence that Glu 498 is the only proton-active group in the vicinity of the trinuclear centre. This strongly suggests that this residue may be responsible for channelling the protons needed for the reduction. These results are compared with other data available for these enzymes, highlighting similarities and differences within laccases and multicopper oxidases. Multicopper oxidases (MCOs) are a group of enzymes that are able to couple the oxidation of a variety of different substrates concomitantly with dioxygen reduction to water -3. This ca. 600 nm, which is responsible for the blue colour of the protein, and is due to the ligand-to-metal charge transfer between the cysteine sulphur and the copper atom. This site also shows a characteristic EPR signal that is due to the high covalency at the copper site. The type 2 (T2) copper site, located in the trinuclear centre . Up. Up2O2 [a Figure 21]. Th. Th2O2 [a Figure determina Figure ; CotA-reThe simulation results reported above, and shown in figure In laccases, the exit channel for water molecules also contains, at least, one acidic residue, Asp116 in CotA Figure , in closE. coli [One could argue that the results presented here, by having been done with one particular enzyme of the bacterial multicopper oxidase family - CotA laccase - may be specific for this particular enzyme. Namely, one could raise the possibility that the residues equivalent to Glu 498 and Asp 116 in other multicopper oxidases, which have been subjected to site-directly mutagenesis, may behave differently. In order to investigate this, we set up test calculations using the structure of the multicopper oxidase CueO from E. coli . Given t2O2). The pKa of this group increases by 1.4 pH units, from 5.3 to 6.7, evidencing the influence of the redox state of T1 on its protonation. On the other hand, the different redox and bridging moieties of the trinuclear centre (which can include protonation changes of Glu 498) also show an influence on the redox affinity of the T1 centre, as shown in the redox titrations (at pH 7) of the T1 centre performed in the different structurally characterised states of the trinuclear centre . TheMelanocarpus albomices [- anion bound to the T2 copper ion, instead of a water or hydroxyl group, as observed in other laccases. It is tempting to speculate that the proximity of Glu 498, or equivalent groups, to the trinuclear centre in prokaryotic laccases (and to the dioxygen molecule itself) can be a factor for the stability of the dioxygen state, but other factors may exist. One example of the sensitivity of the trinuclear centre to the effects of its surroundings is the influence of the acidic group equivalent to Asp 116 in CotA ) were obtained as described in Durão et al. 2008 [2 (1W6L) [et. al.[2, NO, and CO, but the enzyme has high affinity for dioxygen, and in an aerobic environment the availability of the other two species, when compared with dioxygen, is much lower; therefore the probability of the enzyme to bind them would be unlikely. Another possibility for the diatomic species would be peroxide, as present in the peroxide soaked structure of CotA [HoloCotA protein and the reconstituted apo-CotA soaked with Cual. 2008 . Crystalal. 2008 ,54 and Sal. 2008 ; the datal. 2008 and usin2 1W6L) and mode2 (1W6L) . Solvent [et. al.. TherefoW6L and [et. al.,23. At t of CotA ,23 is moCE/MC calculations (described below) require special care concerning the consistency of the structural models to be compared (different redox situations and different liganted states of active site are examples). The main reason for this is the fact that CE/MC calculations use rigid structures , making the simulation of the titration of protonatable groups quite susceptible to conformational changes occurring in polar and charged groups in their vicinity. This effect is especially significant in protein interiors. The inclusion of flexibility in the methodology would alleviate this susceptibility, but this is quite difficult nowadays. Therefore, to overcome these limitations of the methodology, besides using protein crystals obtained in conditions as similar as possible for the different situations, a special crystallographic refinement procedure was applied here; when electron density was not enough to clearly identify the conformation of residue side-chains , these were placed in a conformation as close as possible to the previously determined holoCu(II) structure . This ishttp://www.pdb.org[2X87 and 2X88 for the apoCu(I) and HoloCotA, respectively.The atomic coordinates of both crystals structures have been deposited in Protein Data Bank w.pdb.org: PDB ID UV/Visible absorption spectra for holoCotA and on apoCu(I) crystals were collected under cryo conditions (110 K) using an offline microspectrophotometer at the Cryobench Laboratory, ESRF, Grenoble, France .Kint) and interaction terms of the binding free energy of the protons and electrons. These free energy terms are then used in a MC method [Ka prediction is optimised [K units. Averages were computed using 105 MC steps. In all simulations, only the T1 centre was considered titrable, while the trinuclear centre was considered fixed in each state considered. Contrary to simulated pH titrations, which are done against a model compound reference (reflected in the pKa mod) and can be directly compared with experimental values, simulated redox titrations are usually made against an unknown reference, due to the unavailability of a corresponding Emod, i.e. the redox potential of an adequate model compound in water. This is due to the difficulty in finding such a model compound for protein metal co-factors, as it is the case for the T1 copper centre. The only option is to fit the value of Emod to experimental data on redox titrations of the same group in different proteins, but this is only usually exact if these proteins have only one type of redox centre tn 2.2.0) ,64. The n 2.2.0) ,66, exceptimised . The solinstance , the expinstance to modelPartial charges for the T1 copper and the trinuclear centre were calculated considering model compounds for the different redox and liganted states analysed. These model compounds were created using coordinates of the centres as present in the structures with dioxygen, peroxide and in the fully reduced state as obtained previously and the IB carried out protein structure determination and spectral analysis and drafted the manuscript. CSS carried out protein crystallization trials. ZC did the protein purification and protein crystallization trials. LOM participated in the design of the protein production and helped in the drafting of the manuscript. PFL helped in the protein structure determination and in the drafting of the manuscript. CMS carried out the protein modelling and drafted the manuscript. All authors read and approved the final manuscript.Table S1_20100804 Supplementary material. Bfactors values for the different atoms in the trinuclear centre when different moieties were refined in between the two T3 coppers.Click here for file

Chronic pain is a major health problem associated with significant costs to both afflicted individuals and society as a whole. These costs seem to be disproportionately borne by women, who generally have higher prevalence rates for chronic pain than do men.Data obtained from 125,574 respondents to the Canadian Community Health Survey (2000–2001) indicated that 18% of Canadian women suffered from chronic pain, compared to 14% of men. This gender discrepancy, however, seemed to be linked primarily to differences in age, income, and education between adult men and women in this large sample. Age, income, depression and functional interference with activities were strongly associated with chronic pain in general. No gender differences were found in the intensity of pain experienced. Ethnicity was not strongly associated with chronic pain prevalence, although Asians were the group with the highest chronic pain prevalence in the over-65 age group and Aboriginal Canadians had the highest prevalence in the under-65 age group.Current gaps in our knowledge include the types of chronic pain women experience, their impact on domestic responsibilities and parenting and health care utilization patterns of women with chronic pain. Data sources such as provincial databases of billing claims may be useful in the future to enrich our knowledge of health care utilization and analgesic medication use. Enhanced surveillance, assessment, and early identification of pain disorders are recommended to improve outcomes. Considering current demographic patterns toward an older population, there is also some urgency to the development of patient education and self-management programs. Chronic pain is a major public health problem that places serious stress on afflicted individuals, the health care system and private industry. It has been associated with deficits in quality of life and psychological adjustment, disability, reduced income potential, high levels of health care utilization and high costs to private industry. Generally defined as any continuous or persistent intermittent pain experienced for a period longer than three months, chronic The magnitude of the sex difference in pain,3 is difIn terms of biological factors, the transmission and modulation of pain signals may differ in men and women.,6 NormalIn a random survey of 500 households in Ontario, prevalence rates of chronic pain were found to be 11% among people under 60 years and 25% to 40% for those over 60. The 1994Recent chronic pain prevalence rates in other Western countries are comparable to those found in Canada. U.S. estimates have placed the prevalence rates among women in the United States at 14.7% in the 18 to 50 age range. An AustrAge and socio-economic variables have been associated with chronic pain. For certain pain syndromes, such as joint pain, chronic widespread pain and fibromyalgia, prevalence rates increase with age. Not surpThe functional interference of pain is also high, and a whole range of activities are often severely curtailed. Daily chores become difficult, ability to work diminishes, and there is a lower rate of full-time employment. -12 SociaIn addition to the burden on the individual, chronic pain also exacts a high cost from society at large and the health care system in particular. It is associated with a loss of productivity, high utilization of health services and substantial health care expenditures. Women in North America have a higher rate of health care utilization than men, and thisPain, which may be a disorder in itself rather than simply a symptom of an underlying condition, is increasingly recognized as a substantial public health problem. More comprehensive and gender-sensitive information on pain is needed in Canada so that enhanced interventions can be developed. In this chapter, the overall burden of chronic pain among Canadian women as well as its determinants and impact are assessed using currently available population health data.Data obtained from the Canadian Community Health Survey (CCHS) Cycle 1.1 (2000–2001) were used in this chapter. This survey was cross-sectional in design and had a total of 131,535 respondents. Health Canada had access to data on the 95.5% of these respondents who agreed to share their information. All analyses presented in this chapter used the sample of respondents who agreed to share their information. The prevalence and intensity of chronic pain were compared between men and women and among subgroups of women. Chronic pain status was determined by participants' response to the question "Are you usually free from pain or discomfort?" Those who answered "no" were considered to have chronic pain. The estimated prevalences were calculated using a weighted method to account for the complex sampling design of the survey. The relative contributions of physical/medical (presence of chronic condition(s), etc.) and socio-economic factors to the sex and gender differences were examined using bivariate and multivariate (logistic regression) analysis.Correlates of chronic pain, including depression, restrictions in daily activity, health care utilization and medication use, were also examined and compared between men and women and subgroups of women.Statistics Canada's Bootstrap program was used to determine statistically significant differences between prevalence rates for all confidence intervals (CI) reported for the difference between females and males.According to data collected from Cycle 1.1 (2000–2001) of the CCHS, 16% of the population 12 years of age and older suffered from chronic pain . Classification of pain as either mild, moderate or severe was proportionally similar in males and females , fibromyalgia and migraine headaches is significantly higher among women than men has been found to be associated with increased mortality and decreased life expectancy. Comparison of chronic pain prevalence across BMI also revealed an association: the prevalence was higher for each subsequent BMI category among females, with the lowest prevalence among those who had a BMI of less than 20 and the highest among those with a BMI of greater than 27 Figure . Among mThe prevalence of depression was twice the rate among those who reported chronic pain as among those who did not and appeared to be related to age for both males and females Figure . The preDepression was also related to pain intensity for both sexes. Figure Chronic pain affects daily tasks and can cause restrictions in daily activities. In both age categories the majority of those who suffered from chronic pain were limited in at least "a few" activities as a direct result of their pain. The percentage of females who were limited in a few or more activities was higher than the percentage observed among males (77.7% versus 70.7%).Comparing individuals with chronic pain to those without revealed that the proportion requiring help with at least one task was substantially higher among those suffering from chronic pain than those who were free from pain Figure .For those who suffered from chronic pain, employment issues were very important. In this sample, it was found that the majority of those who were unable to work in the week before being interviewed suffered from pain Figure . ChronicPoor self-rated health was inversely related to chronic pain Figure . Those wSelf-rated stress was related to chronic pain, in that those who were extremely stressed had the highest prevalence of chronic pain and those with lower levels of stress had a lower prevalence of chronic pain Figure .In this analysis, social support was measured by a variable referred to as "tangible social support," which measures whether the individual had somebody to take them to the doctor, do their chores, prepare meals or help if they were confined to a bed.Figure There do not seem to be major ethnic differences in chronic pain prevalence, with the notable exception of two ethnic groups. For both sexes, in the age group 65 years and older the proportion of South Asians who reported chronic pain was greater than for any other ethnic group. Chinese males and females had the lowest rates for this age group. Among those aged less than 65 years, Aboriginals had the greatest proportion of reported chronic pain, for both sexes Figure .In bivariate analysis, level of education was not associated with chronic pain for either of the sexes or age groups.Figure Chronic pain sufferers have a substantial impact on the use of health care services. As shown in Figure Medication use was higher among those reporting chronic pain than those not doing so for all medications in general and all selected types of medication Figure . The useThe chronic pain sufferer in Canada is more likely to be a woman than a man, although the gender difference is not tied exclusively to sex. Women also have lower incomes, less formal education and twice the prevalence of depression, all of which were strongly associated with the report of chronic pain in this study. It thus seems reasonable to speculate that the differences in chronic pain evidenced in this CCHS were attributable to a combination of biological and psychosocial conditions specific to each sex. Not surprisingly, chronic pain was also strongly associated with age and multiple chronic conditions. Women with chronic pain were more likely to report fibromyalgia, arthritis and migraine headaches, although there was no significant sex difference in the prevalence of back pain. In terms of potential impact, chronic pain was strongly related to reports of poor health, high levels of stress, low levels of social support, more functional interference with work and other activities, higher levels of dependence on others, higher levels of health care utilization, and higher medication usage.The "chronic" in chronic pain encapsulates the sense of defeatism that characterizes the common attitude of many patients and health care providers who are dealing with this perplexing and debilitating problem. The etiology of most chronic pain syndromes remains largely unknown and, consequently, treatment efforts have consisted of pain management, at best, and narcotic dependence, at worst. Pain is a multi-dimensional problem not amenable to single causal pathway explanations or treatment approaches. It involves biological processes as well as cognitive, emotional and social ones. Chronic pain thus presents a challenge to both health care providers and patients understandably searching for a quick and definitive solution.Multidisciplinary treatment is indicated for multi-dimensional problems such as chronic pain. In addition to medical and physical therapy, cognitive-behavioural approaches have been shown to be important components in treatment. Recent research indicates that behavioural interventions are generally superior to medical treatment controls in improving pain, decreasing disability and increasing activity levels. These inDespite the demonstrated effectiveness of multidisciplinary approaches to the treatment of chronic pain, it is only a highly select group of patients who ever reach multidisciplinary pain clinics. Most chronic pain patients show a pattern of repeated consultations with primary care doctors and high levels of multiple consultations in the hopes of finding the one who will solve the problem. This high level of consultation is sometimes also fuelled by the search for more prescription analgesics, after the tolerance of prior health care providers has been exhausted. The continuity of care becomes a major problem as patients skip from one provider to another. The elusive treatment is never found, drug dependence is common, and the consequent expense is a major burden on the Canadian health care system.Although specialty pain clinics are often perceived as expensive ventures, their treatment outcomes can result in lower levels of patient disability. They are thus likely to have an impact on health care utilization. The econThe data source for the analysis in this chapter was cross-sectional in nature, and as a result causal pathways are difficult to infer. Also, since the survey was based on respondents' self-reports, the quality and accuracy of the data cannot be determined. Furthermore, the survey asked respondents about only four specific chronic conditions that have been associated with chronic pain. Clearly, there are many other conditions that can result in chronic pain.There are a number of gaps in the chronic pain and gender data currently available. One major gap is the lack of detailed data on the types of chronic pain that women experience. Chronic pelvic pain is an example of a gender-specific pain tied to women's reproductive function for which there is little Canadian, population-based data, despite ample U.S. evidence indicating that this is a major women's health care problem. Endometriosis and polycystic ovarian disease are just two of the common disorders of reproductive function that result in chronic pelvic pain, although much of this pain is without obvious pathology. Vulvar vestibulitis and vulvodynia are also increasingly reported in both pre- and post-menopausal women. Temporomandibular joint disorder (TMJ) is yet another example of a chronic pain disorder that affects predominantly women.A second major gap in the Canadian literature is systematic data collection from sources other than self-reports. Provincial databases of billing claims need to be investigated to obtain a clearer picture of health care utilization, prevalence of pain disorders and pain disorder-related patterns of analgesic medication prescription. The Pharmacare data from some provinces could be useful in inferring the presence of chronic pain syndromes, as the prevalence of heavy users of analgesic drugs could be detected using this source. In addition, many women report reproductive function-related pains to obstetricians or gynecologists who often serve as their primary care providers. Studies on women's health care need to increase the focus on this group of providers in addition to the existing focus on primary care doctors. Billing databases may also serve to clarify the currently murky picture regarding chronic pain prevalence in different ethnic groups. Cultural differences in the acceptability of reporting pain may be obscuring ethnic trends that could be directly targeted by public health efforts.A third gap of particular importance to women is the lack of assessment of the functional impact of chronic pain on domestic responsibilities and parenting. The CCHS and many other surveys have consistently shown a connection between reports of chronic pain and employment interference, but there is very little investigation into the impact of pain on work in the home. This kind of functional impairment gets lost in the employment data. If chronic pain is interfering with work outside the home, it is most likely also interfering with work inside the home. The lack of assessment of this type of interference only serves to marginalize an important aspect of women's lives and hide the wide-ranging deleterious effect of chronic pain on women and their families.Filling these gaps in our knowledge about women and pain is likely to prove integral to the development of strategies designed to reduce the impact of chronic pain. Certain recommendations, however, can already be suggested. Surveillance and early identification of pain disorders is crucial, as there are both theoretical and empirical reasons to believe that early treatment will result in better outcomes. Untreated pain can establish a central nervous system hold that becomes increasingly resistant to peripheral and other interventions. Long-standing pain can also result in behaviour patterns (e.g. lack of activity) that lead to other complicating disorders (e.g. obesity) and to cognitive and emotional problems (e.g. depression) that complicate treatment. Finally, the more long-standing the pain, the more likely is the dependence on narcotics and other pain medications.Primary care providers and obstetrician/gynecologists are crucial to this surveillance and early detection effort. Assessment of pain needs to be incorporated into the first consultation and targeted, even if it is not the primary reason for the consultation. It then needs to be reassessed periodically. Patient education about chronic pain syndromes is also important, as it can establish hopeful yet realistic expectations and moderate the impulse to consult multiple doctors in search of "the cure." It can also be an efficient way to teach patients self-management strategies that have been empirically shown to lead to significant decreases in pain, disability and medical consultations. As well,Multidisciplinary pain clinics have demonstrated effectiveness and may, in the long term, be the most economical and effective recourse in the treatment of chronic pain. Rather than envision these as clinics within large, central metropolitan hospitals, perhaps smaller community-based versions would better serve the population in question. These smaller clinics would be more accessible to women who may be older, be disabled, or have lower income and/or have children, and they could also be tailored to the culturally specific characteristics of the community.Chronic pain is a daunting problem for both individuals and society. Its effects on quality of life and economic costs demand attention as we enter the twenty-first century and plan for improvements in the delivery of health care to Canadians. The current age structure of the Canadian population indicates a large expected increase in the number of individuals who are over the age of 65 over the next 30 years. This necessarily means an increase in the prevalence of chronic pain, especially among women. Strategies for addressing this growing problem are needed to reduce the overall impact of chronic pain. The collection of more finely gradated information on the nature and impact of chronic pain and health care utilization is necessary, yet health care delivery strategies cannot wait for all of the information to be collected. The aim of this survey and report is to make a contribution to future data collection efforts and to ongoing and future applications centred on the care of both men and women suffering from chronic pain.

TNFAIP3, an RA candidate gene, flanks this region, and polymorphisms in both the TNFAIP3 gene and the intergenic region are associated with systemic lupus erythematosus. We hypothesized that there is a similar association with RA, including polymorphisms in TNFAIP3 and the intergenic region.Genome-wide association studies of rheumatoid arthritis (RA) have identified an association of the disease with a 6q23 region devoid of genes. To test this hypothesis, we selected tag-single nucleotide polymorphisms (SNPs) in both loci. They were analyzed in 1,651 patients with RA and 1,619 control individuals of Spanish ancestry.TNFAIP3 locus. The rs582757 SNP and a common haplotype in the TNFAIP3 locus exhibited association with RA. In the intergenic region, two SNPs were associated, namely rs609438 and rs13207033. The latter was only associated in patients with anti-citrullinated peptide antibodies. Overall, statistical association was best explained by the interdependent contribution of SNPs from the two loci TNFAIP3 and the 6q23 intergenic region.Weak evidence of association was found both in the 6q23 intergenic region and in the TNFAIP3 gene, like that previously described for systemic lupus erythematosus.Our data are consistent with the hypothesis that several RA genetic factors exist in the 6q23 region, including polymorphisms in the PTPN22 gene [TRAF1-C5 locus and the intergenic region in the 6q23 chromosome [The etiology of rheumatoid arthritis (RA) includes a genetic component that has become amenable to investigation in recent years. A major development has been the availability of large-scale genome-wide association (GWA) studies. The first GWA studies in RA were readily able to confirm the two clearest RA genetic factors – in the human leukocyte antigen region and in the N22 gene -3. In adTNFAIP3 gene – have been found to be reproducibly associated with systemic lupus erythematosus (SLE) susceptibility [TNFAIP3 could also be involved in susceptibility to RA. This gene is an excellent candidate for such an effect because it is a feedback negative regulator of tumor necrosis factor signaling through nuclear factor-κB (NF-κB) [Two single nucleotide polymorphisms (SNPs) in 6q23, namely rs6920220 and rs13207033 (or its perfect surrogate rs10499194), have exhibited peak association with RA in an independent manner [ (NF-κB) -10.TNFAIP3 locus to the intergenic 6q23 region, we have genotyped tagSNPs at both loci. Analysis in 1,651 RA patients and 1,619 control individuals revealed significant but weak associations at each locus. Each of these signals was statistically reinforced when signals in the other locus were accounted for. These results are consistent with multiple RA genetic factors in chromosome 6q23 that include polymorphisms in the TNFAIP3 gene and that interact with one another.To test our hypothesis and to relate the Recruitment of samples included in this study has already been described . SamplesTNFAIP3 gene and the region of high LD with polymorphisms in the gene. The second, of 65 kb, is the LD region that includes the two association peaks from previous studies and that is limited by the recombination hot spots at about 138.002 and 138.067 megabases described in the HapMap CEU data (corresponding to samples with European ancestry) [r2 ≥ 0.8 of all of the SNPs with minor allele frequency over 0.05 (TNFAIP3 locus) or 0.1 (intergenic locus). TagSNPs of the intergenic region included the peak SNPs in previous studies [Two separated regions of linkage disequilibrium (LD) in 6q23 were selected for analysis Figure . The firncestry) to proviPCRs were done with the Qiagen Multiplex PCR kit on 30 ng genomic DNA. PCR products were purified by Exo-SAP digestion with Exonuclease I and Shrimp Alkaline Phosphatase . Single-base extension reactions were done using the SNaPshot Multiplex Kit . Oligonucleotide sequences are presented in the additional materials [see Table S2 in Additional data file 2 tests for the 2 × 2 contingency tables were used to compare allele frequencies. The minor allele of each SNP was taken as reference for all comparisons, and minor allele frequencies are reported in the tables. Allele frequencies of each SNP were compared between controls from each center or region of origin, as a way to detect population heterogeneity. In addition, combination of results after stratification by individuals' origin was done following the Mantel-Haenszel approach, and heterogeneity of effect sizes was explored using the Breslow-Day test. ratio tests for the additive, dominant and recessive genetic models were obtained relative to the co-dominant model. Multivariate logistic regression analysis was used to evaluate the conditional effect of the SNPs. For conditioning on haplotype #5, a new genotype for this haplotype was created with codes 0 (non-carrier), 1 (heterozygote), and 2 (homozygote) for each individual. No problem of colinearity was detected with the inclusion in the model of haplotype #5 and SNP rs582757, which contributes to defining the haplotype, because the same allele of this SNP is present in three other common haplotypes. Stepwise logistic regression with all SNPs was conducted to detect the best multi-SNP models. Haplotypes were estimated using the Phase 2.1 software [Hardy-Weinberg equilibrium (HWE) concordance was tested in control samples. LD was analyzed using Haploview . χ2 testsoftware . Odds rasoftware .TNFAIP3 gene and 20 kb of flanking sequences to either side [see Table S2 and Additional data file Six tagSNPs were sufficient to cover the vice versa) [see Table S3 in Additional data file No significant differences in allele frequencies were found between samples stratified by center of recruitment or region of origin. Analysis of allele frequencies revealed that the minor allele of the rs582757 SNP was significantly less frequent in patients with RA than in control individuals in the same direction that has previously been reported [P value that was just below 0.05, with the minor allele exhibiting a lower frequency in patients with RA than in control individuals (Table P = 0.006). Genotypes of this SNP were best fitted by a dominant model, and analysis according to this model revealed a clearer difference between patients with RA and control individuals . The difference was greater in women .Comparison of allele frequencies did not reveal clear association of any of these SNPs with RA Table . Associareported ,2,4. Onlls Table . The difP = 0.01; and rs675520, P = 0.004), and one of them was also different between regions of origin of the samples . However, these differences did not introduce detectable artefacts in the global results, as shown by the similar results obtained above and lack of significant heterogeneity of the ORs as assessed with the Breslow-Day test .Genotype analyses of all of the other SNPs yielded findings similar to those of the allele frequency comparisons, and no differences were found by sex stratification in any of them (not shown). Two of the SNPs in this locus exhibited significant allele frequency differences between recruitment centers . However, lack of pair-wise correlation does not exclude complex interdependence between the loci.We found weak evidence of association with RA both in TNFAIP3 locus (P = 0.009). The two SNPs were significantly associated when considered conditional upon the other . The backward stepwise procedure yielded a best model with three SNPs (P = 0.009): two of the intergenic region, namely rs13207033 and rs609438, and the rs582757 SNP from the TNFAIP3 gene. Each made a significant contribution to RA when assessed conditional upon the other two .To explore more complex relationships, we used stepwise logistic regression with the 17 SNPs. This unsupervised multivariate process was run both in a forward and in a backward mode. That is, it was run starting with the most associated SNP and adding a SNP in each step until the model was not longer improved, or starting with a model incorporating all SNPs and eliminating the least associated in each step until the model deteriorated. The forward process yielded a best model that combined the rs6920220 SNP from the intergenic region and the rs582757 SNP from the P values of association for each SNP were lower (more significant) in the multivariate analysis than when taken individually. For example, the rs6920220 and the rs13207033 SNPs were not associated with RA in isolation , but they were associated in the multivariate models. If these results are confirmed, then they amount to epistasis between the two loci.Therefore, the two procedures showed that the best models differentiating cases and controls include SNPs from the two loci. In addition, they suggested interactions between them because the TNFAIP3. The recently reported coincident association in SLE increased our interest and suggested that the genetics of the region could be complex and include the TNFAIP3 gene [Association of RA susceptibility to SNPs in the intergenic region of chromosome 6q23 has attracted strong interest in a locus that, because of its lack of coding sequences, is especially difficult to investigate ,2,4. ThiIP3 gene .TNFAIP3 locus revealed weak association with RA that could be explained either by the rs582757 tagSNP or by the commonest haplotype. Because of the weakness of the association and the multiple SNPs tested, these findings should be considered tentative. However, confidence in this association is increased by considering the summary statistics from the Wellcome Trust Consortium Case Controls (WTCCC) GWA study [P = 0.02). Additional preliminary data from a larger study are also concordant with association with RA of SNPs in the TNFAIP3 gene [TNFAIP3 SNP with strong correlation (r2 > 0.9) with the rs582757 SNP is associated with reduced expression of TNFAIP3 and with coronary artery disease in patients with type 2 diabetes [Our findings regarding the WA study , which iIP3 gene . It is adiabetes .P = 4 × 10-7), in which all patients were ACPA positive than in the WTCCC GWA study [P = 0.01), in which the patients were unselected. There are already antecedents of this type of preferential association in relation to the ACPA status of patients with RA, including the shared epitope, the PTPN22 nonsynonymous SNP and IRF5 [Regarding the 6q23 intergenic region, we found weak association with a previously unreported SNP, rs609438, and replication of association with the rs13207033 SNP. This latter was observed only in patients positive for ACPAs. Previous reports could be interpreted as supporting this preferential association of the rs13207033 SNP, because association with this SNP was much clearer in the study conducted by Plenge and coworkers [and IRF5 -21. HoweP = 0.01). However, we found a weaker effect (OR = 1.12) than in previous studies. Such a difference in effect size between studies is common, and recent examples have been found in confirmed RA genetic factors such as STAT4 and TRAF1-C5 [An unexpected result was the lack of association with RA of the rs6920220 SNP Association of this SNP with RA has previously been demonstrated in several studies with an overall OR of 1.23 . Our stuTNFAIP3 gene [The two large and comprehensive SLE studies of the 6q23 region have yielded multiple independent association signals, including polymorphisms in the IP3 gene . At leasTNFAIP3 is a clear candidate for a role in RA by virtue of the anti-inflammatory effects of its encoded protein. It is involved in many regulatory feedback loops through the cooperative activity of its two ubiquitin-editing domains [TNFAIP3 – an important regulator of the NF-κB pathway. domains . TNFAIP3 domains ,10. Once domains . InvestiTNFAIP3 gene. These factors appear to be shared with SLE susceptibility. Involvement of TNFAIP3 is of practical interest, given its inhibitory effect on the NF-κB pathway. Nevertheless, there remain many aspects that require further analysis: confirmation of our results, delineation of genetic influences on specific RA subphenotypes, and identification of the functional variants in this locus and their effects.We have found evidence of multiple RA genetic factors in the 6q23 region including polymorphisms in the ACPA: anti-citrullinated peptide antibody; CI: confidence interval; GWA: genome-wide association; HWE: Hardy-Weinberg equilibrium; kb: kilobases; LD: linkage disequilibrium; NF-κB: nuclear factor-κB; OR: odds ratio; PCR: polymerase chain reaction; RA: rheumatoid arthritis; RF: rheumatoid factor; SLE: systemic lupus erythematosus; SNP: single nucleotide polymorphism; TNFAIP3: tumor necrosis factor-α-induced protein 3; WTCCC: Wellcome Trust Consortium Case Controls.The authors declare that they have no competing interests.RD-G participated in design of the study, genotyped the samples, and participated in the interpretation of the results and in writing the manuscript. MC participated in the statistical analysis and in the interpretation of results. EPP, AB, FJB, JDC, RC, LC, ARS, BF-G, AMO, GH-B, JLP, JN, FN and JLM participated in the acquisition of clinical data and collection of samples, and in the analysis and interpretation of results. JJG-R coordinated the acquisition of clinical data and collection of samples, and participated in the analysis and interpretation of results. AG participated in the design of the study and in the coordination of acquisition of clinical data and collection of samples, and supervised genotyping, statistical analysis, interpretation of results and writing of the manuscript. All authors read and approved the final manuscript.TNFAIP3 locus), Table S4 (results for each SNP stratified by ACPA or RF status), and Table S5 .A Microsoft Word document that contains the following tables: Table S1 , Table S2 (details of the SNPs that were studied and the oligonucleotides that were used), Table S3 (conditional analysis between the rs582757 SNP and the most common haplotype in the Click here for file

A comparative genomic and proteomic study of halophilic and non-halophilic prokaryotes identifies specific genomic and proteomic features typical of halophilic species that are independent from genomic GC-content and taxonomic position. Halophilic prokaryotes are adapted to thrive in extreme conditions of salinity. Identification and analysis of distinct macromolecular characteristics of halophiles provide insight into the factors responsible for their adaptation to high-salt environments. The current report presents an extensive and systematic comparative analysis of genome and proteome composition of halophilic and non-halophilic microorganisms, with a view to identify such macromolecular signatures of haloadaptation.Comparative analysis of the genomes and proteomes of halophiles and non-halophiles reveals some common trends in halophiles that transcend the boundary of phylogenetic relationship and the genomic GC-content of the species. At the protein level, halophilic species are characterized by low hydrophobicity, over-representation of acidic residues, especially Asp, under-representation of Cys, lower propensities for helix formation and higher propensities for coil structure. At the DNA level, the dinucleotide abundance profiles of halophilic genomes bear some common characteristics, which are quite distinct from those of non-halophiles, and hence may be regarded as specific genomic signatures for salt-adaptation. The synonymous codon usage in halophiles also exhibits similar patterns regardless of their long-term evolutionary history.The generality of molecular signatures for environmental adaptation of extreme salt-loving organisms, demonstrated in the present study, advocates the convergent evolution of halophilic species towards specific genome and amino acid composition, irrespective of their varying GC-bias and widely disparate taxonomic positions. The adapted features of halophiles seem to be related to physical principles governing DNA and protein stability, in response to the extreme environmental conditions under which they thrive. Halophiles are organisms adapted to thrive in extreme conditions of salinity. There is a wide range of halophilic microorganisms belonging to the domains Archaea and Bacteria. The intra-cellular machinery of these prokaryotes has evolved to function at very high salt concentrations -5. A detThe stable and unique native structure of a protein is a basic requirement for its proper functioning -11. To uHaloquadratum walsbyi is so far the only exception, with a remarkably low genomic GC-content of 47.9% [Halobacterium sp. NRC1 [H. walsbyi [Several studies have suggested that high genomic GC-content (well above 60%) is also a common feature of extreme halophiles, presumably to avoid UV induced thymidine dimer formation and possible accumulation of mutations ,19. The of 47.9% . At the sp. NRC1 , but not walsbyi . Thus, aThe current report presents an extensive and systematic analysis of the genome and proteome composition of halophilic organisms, along with a comparative study of non-halophiles, with a view to characterize the molecular signatures of halophilic adaptation. We consider 6 completely sequenced obligatory halophiles and compare them with 24 non-halophiles from various phyla of both Archaea and Bacteria with comparable GC-content to minimize the phylogenetic influence and the effect of mutational bias on their nucleotide/amino acid usage patterns. We examine the preferences, if any, in amino acid replacements from non-halophile to halophile orthologs in an attempt to understand which residues are instrumental for halophilic adaptation. Finally, we show how observed patterns of change in amino acid compositions in response to extreme conditions of the environment are related to physical principles that govern stability of proteins under such conditions. This study examines in detail the genome and proteome-wide adaptations to extreme environments, knowledge of which has important potential applications in various fields, including the engineering of industrial biomolecules.Escherichia coli, while the right panel offers a pictorial representation of relative amino acid usage in the respective organisms. As the relative abundances of the residues increase from 0.35 to 1.80, the color of the respective block changes from red to green, that is, the greener the color, the more abundant is the residue in that organism compared to E. coli. Halophilic organisms show quite distinct usage of amino acid residues compared to non-halophiles, elucidated by the presence of either more red or green blocks in Figure H. walsbyi, probably due to its significantly lower genomic GC-content of axis 1 with the GC-content of the respective genomes identifies GC-bias as one of the major sources of inter-species variation in global amino acid composition, while the contributions to axis 2 come from hydrophobicity and the ratio of negatively versus positively charged amino acid residues of the encoded gene products of the organisms. This indicates, therefore, that the proteins of halophilic organisms are characterized by less hydrophobicity (or higher hydrophilicity) and relatively higher usage of negatively charged amino acids compared to non-halophile proteins. Figure Similar to the cluster analysis, correspondence analysis (COA) on amino acid usage also segregates the halophilic organisms from the non-halophiles along the second principal axis Figure . The firMethanosaeta thermophila, Thermoplasma acidophilum and so on , appears in the same cluster along with the GC-rich halophiles, while the three non-halophilic species with similar GC-content and cluster with the other non-halophiles, most of which are characterized by much higher GC-content. It is worth mentioning at this point that organisms with high growth temperature also cluster together share the same node. The distinct branching pattern of three thermophiles with relatively low genomic GC-content suggests that the overall GC-content also plays a significant role in shaping the amino acid composition of such organisms, as observed previously by Kreil and Ouzounis [All these trends are specifically exhibited by halophiles irrespective of their taxonomic origins and their genomic GC-content between halophilic and non-halophilic organisms was performed to identify the underlying factors for halophilic adaptation in more detail. Table p < 10-2 for set II; p < 10-3 for set I; and p < 10-6 for sets III and IV). They contribute 56%, 52%, 66% and 63% of the replacements for set I , set II , set III and set IV , respectively . The top 20 replacements in all these sets suggest that there are two clear trends in amino acid substitution patterns in terms of highest gain as well as highest ratio /2 = 190 possible pairs of replacements) between the orthologous sequences in the direction from non-halophile to halophile proteins . There are 59 , 51 , 81 and 76 pairs of amino acids for sets I, II, III and IV, respectively, that have significant directional replacement bias compared to C. vibrioforme MDH (48.5% decrease). The comparison of aligned sequences of secondary structure regions using the DSSP program also lends supports to this notion , the cumulative frequency of Asp and Glu is 20.5%, whereas in C. vibrioforme MDH it is 12.9%.One pair of crystal structures of the protein malate dehydrogenase (MDH) from halophilic The distinct amino acid usage pattern in halophiles might have originated from compositional bias operating at the nucleotide level, or from the preference for, or avoidance of, specific amino acid residues as a tool for halophilic adaptation. With a view to distinguish between these two possibilities, we randomly re-shuffled the nucleotides in the coding sequences of all genomes and calculated the average amino acid composition of the hypothetical protein sequences of halophiles and non-halophiles obtained from the theoretical translation of the reshuffled gene sequences. If the selection had operated at the mono-nucleotide level, proteins translated from such randomly reshuffled hypothetical sequences of halophiles should feature similar trends as depicted by their true proteomes, since the nucleotide bias of the reshuffled sequences would have remained the same as those of the real gene sequences. On the contrary, if the distinct amino acid composition of halophile proteomes had evolved due to environmental adaptation of these extremophiles, the trends in amino acid usage in reshuffled hypothetical sequences would differ from those of actual halophilic proteins. In Figure Thermoplasma acidophilum. However, on the basis of dinucleotide frequencies at the first and second codon positions of genes, these organisms cluster together irrespective of any phylogenetic relationship. In order to figure out the possible impact of the relative abundance of specific dinucleotides on the mechanical properties of halophilic genomes, we calculated the likelihood of their sequences forming a Z-DNA structure, using ZHunt software [2 = 0.54, p < 10-4) between the propensity of DNA to flip from the B-form to the Z-form per kilobase of genome and the relative abundance of the CG dinucleotide.We calculated the dinucleotide abundance of all genomes to find out whether any specific nucleotide composition has significant influence on the genomic signature of obligatory halophiles. Clustering on dinucleotide abundance by city-block (Manhattan) distance clearly segregates the halophilic organisms from the non-halophiles Figure . The higsoftware . We foun3 values , indicating separation of genomes according to their genomic GC-content.In an attempt to examine whether the pattern of synonymous codon usage in halophiles follows any specific signature, COA was performed on the relative synonymous codon usage (RSCU) of 82,927 predicted open reading frames (ORFs) from 30 microbial genomes of the COA of RSCU, the variation along the third major axis separates the halophiles from the non-halophiles. The distribution of codons along axis 3 Figure depicts The present study discerns the nucleotide and amino acid biases in extreme halophiles and thereby characterizes the genomic/proteomic determinants of halophilic adaptation in prokaryotes. From this study, it appears that specific trends in amino acid usage are required for halophilic adaptation of organisms, irrespective of their genomic GC-content and taxonomic position. Evidence in favor of specific selection on dinucleotide and synonymous codon usage are apparent for halophiles Figures and 7a. M. thermophila from Methanogens group II and T. acidophilum from Thermoplasmatales - organisms very close to haloarchaea as per the 16s rRNA tree . Among bacterial non-halophiles, we chose members from different bacterial phyla, such as proteobacteria, firmicutes, cyanobacteria, actinobacteria and especially P. luteolum from the bacteroidetes/chlorobi group to which the halophilic bacteria S. ruber belongs . It can be concluded, therefore, that the determinants of genomic/proteomic architecture in halophilic organisms are high salt adaptation specific, and transcend the boundary of phylogenetic relationships and the genomic GC-content of the species.In order to subtract out the phylogenetic influence, we have included both bacterial and archaeal organisms in the dataset Table . The datH. marismortui in our analysis and found that the amino acid usage, dinucleotide relative abundance and synonymous codon usage of chromosome II are quite different from those of chromosome I . A high GC-content in halophilic genomes is thought to help in avoiding UV-induced thymidine dimer formation and the possible accumulation of mutations in their specialized habitat , characterized by high levels of UV irradiation [H. walsbyi, the disadvantage of a low GC-genome is thought to be partly compensated for by the presence of a relatively higher number (four copies) of photolyases [2 = 0.54, p < 10-4) between the propensity of Z-DNA formation per kilobase in genomes with a relatively high abundance of CG dinucleotides supports this notion. We also observed that the pattern of synonymous codon usage in halophiles is significantly different from that in non-halophiles , except for adiation ,19. In Htolyases . Our anatolyases . It is atolyases . Hence, tolyases . A signiThe present study demonstrates the generality of the mechanisms of macromolecular adaptation of extreme salt-loving organisms, irrespective of their genomic GC-content and taxonomic position. At the protein level, these include: convergent evolution towards a specific proteome composition, characterized by low hydrophobicity; over-representation of acidic residues, especially Asp; higher usage of Val and Thr; lower usage of Cys; and a lower propensity for helix formation and a higher propensity for coil structure. Among the signatures of halophilic adaptation at the DNA level, the abundance of GA, AC and GT dinucleotides may partly be coupled with the specific amino acid requirements, while CG dinucleotide abundance may be an additional halophilic signature of DNA stability at high salt concentration. The synonymous codon usage in halophiles also seems to have converged to a single pattern regardless of their long-term evolutionary history.H. walsbyi, all the extreme halophilic organisms are GC-rich, so to minimize the GC-compositional effect on amino acid usage comparison (as well as on codon usage), most of the chosen non-halophilic organisms are similarly GC-rich, while some others have GC-content comparable to that of H. walsbyi.All protein coding sequences of the chromosomes of 6 extreme halophiles and 24 non-halophiles from Archaea (both euryarchaeota and crenarchaeota) and bacteria were retrieved from NCBI GenBank version 145.0) and Halolex databases and standardized amino acid usage values, respectively. The over-representation or under-representation of standardized amino acid usage values of the organisms in the matrix are shown in green or red colored blocks in Figure To find the differences in amino acid usage between extreme halophilic and non-halophilic organisms, the cluster analysis on amino acid composition was carried out using STATISTICA for all 30 organisms Table . The amiCOA on amino acid usage was performed using the program CODONW 1.4.2 to identIn order to identify any halophile-specific genome signature, dinucleotide abundance values ,43 of ge-10. Hits less than 60% similar and having more than 20% difference in length with the query were removed from the dataset. Putative membrane proteins and proteins likely to be secreted or localized to the cell surface, predicted using TMHMM2.0 [S. ruber and the non-halophile P. luteolum - both belonging to the phylum bacteroidetes/chlorobi. Set II contained 104 orthologous sequences from two species with similar GC-content (Table H. marismortui (Ch-I) and non-halophilic bacteria Pseudomonas putida. Set III contained 584 orthologous proteins from a halophilic and a thermophilic archaeon, namely H. marismortui (Ch-I) and M. thermophila. Set IV incorporated 574 orthologous proteins of the halophilic archaeon Natronomonas pharaonis and uncultured methanogenic archaeon RC -I.Four sets of orthologous sequences between halophiles and non-halophiles were identified using the BlastP program using a TMHMM2.0 and SignTMHMM2.0 , were alThe amino acid sequences of these four sets of orthologous genes were aligned using ClustalW and the -3 to 10-6. For each pair of replacements, the first and second rows of the 2 × 2 contingency table represented the number of replacements from one particular residue to another of the pair and the total count of the remaining replacements from the residue i (where k ≠ j), respectively.While examining the trends in amino acid or secondary structure replacements, the direction of conversion of non-halophile proteins to extreme halophile proteins were taken by convention as the 'forward' direction. Under unbiased conditions, the ratio of forward to reverse replacements was expected to be 1:1 for each pair of replacements. To test this hypothesis, the observed and expected numbers (based on a 1:1 ratio) were recorded for each pair of residues belonging to a particular group. In all cases, the chi-square test was applied to assess the significance of the directional bias, if any, at significance levels of 10Indices like RSCU , GC-contp-value 1e-38) MDHs from H. marismortui (1D3A) [C. vibrioforme (1GV1) [We obtained one pair of protein structures for extreme halophilic and non-halophilic organisms from the Protein Data Bank. The pair contains (Blast i (1D3A) and C. ve (1GV1) . The sece (1GV1) and DSSPe (1GV1) .COA, correspondence analysis; MDH, malate dehydrogenase; ORF, open reading frame; RSCU, relative synonymous codon usage.SP and SKB made substantial contributions to the conception of the study, devised the overall strategy, performed genome sequence analysis and drafted the manuscript, developed relevant programs for sequence analysis and performed sequence alignment. SD participated in the initial work, development of the work plan and manuscript preparation. ETH made thoughtful and constructive suggestions during preparation of the manuscript. CD participated in the design and coordination of the study and revised the manuscript critically for important intellectual content. All authors read and approved the final manuscript.P. luteolum and S. ruber orthologs. Additional data file P. putida and halophilic H. marismortui chromosome I orthologs. Additional data file M. thermophila and halophilic H. marismortui chromosome I orthologs. Additional data file Methanogenic archaeon and halophilic N. pharaonis orthologs. Additional data file P. luteolum to halophilic S. ruber orthologs. Additional data file P. putida to halophilic H. marismortui chromosome I orthologs. Additional data file M. thermophila to halophilic H. marismortui chromosome I orthologs. Additional data file M. archaeon to halophilic N. pharaonis orthologs. Additional data file The following additional data are available with the online version of this paper. Additional data file Phylogenetic relationship with 16s rRNA using the neighbor joining method with Tamura-Nei model.Click here for fileP. luteolum and halophilic S. ruber orthologs.Trends in amino acid replacements in non-halophilic Click here for fileP. putida and halophilic H. marismortui chromosome I orthologs.Trends in amino acid replacements in non-halophilic Click here for fileM. thermophila and halophilic H. marismortui chromosome I orthologs.Trends in amino acid replacements in non-halophilic Click here for fileM. archaeon and halophilic N. pharaonis orthologs.Trends in amino acid replacements in non-halophilic Click here for fileP. luteolum to halophilic S. ruber orthologs.Number of amino acid replacements from non-halophilic Click here for fileP. putida to halophilic H. marismortui chromosome I orthologs.Number of amino acid replacements from non-halophilic Click here for fileM. thermophila to halophilic H. marismortui chromosome I orthologs.Number of amino acid replacements from non-halophilic Click here for fileM. archaeon to halophilic N. pharaonis orthologs.Number of amino acid replacements from non-halophilic Click here for fileDinucleotide relative abundance for all the organisms under study.Click here for fileDinucleotide frequency at the first and second codon positions for all the organisms under study.Click here for fileRSCU of genes at the positive and negative extremes of axis 3 of COA on RSCU.Click here for file

Salmonella enteritidis chromosome.A variety of techniques have been described which introduce scarless, site-specific chromosomal mutations. These techniques can be applied to make point mutations or gene deletions as well as insert heterologous DNA into bacterial vectors for vaccine development. Most methods use a multi-step approach that requires cloning and/or designing repeat sequences to facilitate homologous recombination. We have modified previously published techniques to develop a simple, efficient PCR-based method for scarless insertion of DNA into S. enteritidis genome without the addition of any unwanted sequence. This experiment was performed by a two-step mutation process via PCR fragments, Red recombinase and counter-selection with the I-SceI enzyme site. First, the I-SceI site and kanamycin resistance gene were introduced into the genome of cells expressing Red recombinase enzymes. Next, this sequence was replaced by a chosen insertion sequence. DNA fragments used for recombination were linear PCR products which consisted of the foreign insertion sequence flanked by homologous sequences of the target gene. Described herein is the insertion of a section of the M2e epitope (LM2) of Influenza A virus, a domain of CD154 (CD154s) or a combination of both into the outer membrane protein LamB of S. enteritidis.The final product of this mutation strategy is the insertion of DNA encoding a foreign epitope into the We have successfully used this method to produce multiple mutants with no antibiotic gene on the genome or extra sequence except those nucleotides required for expression of epitope regions. This method is advantageous over other protocols in that it does not require cloning or creating extra duplicate regions to facilitate homologous recombination, contains a universal construct in which an epitope of choice can be placed to check for cell surface expression, and shows high efficiency when screening for positive mutants. Other opportunities of this mutational strategy include creating attenuated mutants and site-specific, chromosomal deletion mutations. Furthermore, this method should be applicable in other gram-negative bacterial species where Red recombinase enzymes can be functionally expressed. Scarless, site-directed mutagenesis on a bacterial chromosome is often a preferred method for studying a particular region of DNA. This is due to the locational relevance and stability of the construct. The approach of constructing mutations on plasmids is still used consistently for many applications but is not always appropriate in the case of deletion mutations and vaccine therapy. In the case of live bacterial vaccines, inserting heterologous antigens on surface expressed proteins of bacteria has provided an efficient means to display immunogenic antigens. However, using plasmids for expression of these antigens comes with the risk of posing a metabolic burden on the bacterial cell, which causes decreased fitness or loss of the plasmid.Escherichia coli as well as in Salmonella typhimurium which resulted in site-directed, chromosomal insertions or deletions but still had the problem of extraneous DNA left behind on the genome [S. typhimurium, yet, as before, an antibiotic gene or FRT scar sequence will remain on the genome [E. coli genome [E. coli and performing in vitro transposition using these PCR products. Because PCR products ranged from 102–4617 bp in length, the transposon could be flanked by approximately 50–2300 bp of homology to the corresponding genomic site. The flanking sequences provided by PCR products reduce the need for designing sequences to facilitate recombination and also has the potential for providing greater lengths of homology. This might be more important for organisms, other than E. coli, to overcome unique restriction systems. For example, homologies ranging from 36–50 nucleotides are significant enough to allow recombination in E. coli by Red recombinase [Salmonella enteritica serovar Enteritidis (S. enteritidis) may require 100 bp – 1 kb of sequence homology for recombination to be efficient [Still, several challenges exist for bacterial genomic mutagenesis and include the following: designing and creating delivery vectors that carry target genes with desired modifications, overcoming the host restriction system, avoiding the cause of a polar effect on downstream sequences, and eliminating unwanted scar sequences or antibiotic genes on the genome. All of these challenges have been confronted and either completely or partially overcome using a set of similar techniques. For example, a mutational strategy using Red recombinase was introduced in e genome ,2. Addite genome . More dee genome ,5. By a i genome . Yet, thi genome . This prS. enteritidis genome without leaving a scar. In the present study we inserted a section of the M2e epitope (LM2) [lamB gene of S. enteritidis in order to investigate the potential for a Salmonella-based vaccine against avian influenza virus.Presently, we have applied techniques from the afore mentioned transposon-based method that allows scarless mutations with an pe (LM2) from infpe (LM2) , also knS. enteritidis as a model organism. The experimental method made use of overlapping extension PCR, the Red recombinase system, and an intermediary insertion of the I-SceI endonuclease recognition site as a counter-selection marker. The overall strategy is shown in Figure r) cassette was first inserted into the chromosome in the lamB gene by homologous recombination. Then, this mutation was replaced with the desired insertion sequence . To make the replacement, a PCR product carrying the desired insertion sequence was added simultaneously with a plasmid encoding the I-SceI endonuclease enzyme used for counter-selection between the first and second mutations.The goal of this study was to devise an efficient strategy to make markerless, site-directed mutations on a bacterial genome, using r cassette to be inserted into the lamB site. PCR-A consisted of the I-SceI enzyme recognition site adjacent to the Kmr gene with approximately 200–300 bp of flanking DNA on each end homologous to the upstream and downstream regions of lamB loop 9 insertion site . The fragment was introduced into S. enteritidis cells expressing Red recombinase enzymes. This step proved to be straightforward, and selecting for Kmr colonies was the first criteria for identifying potential positive clones. After screening a few colonies by colony PCR, positive clones were sequenced for the desired inserted I-SceI site/Kmr sequence, and the identified mutants in S. enteritidis were designated SE164.The first mutation step involved designing a PCR fragment, PCR-A, which would serve as the carrier of the I-SceI site/KmlamB homologous fragments. PCR-B amplicons have no selection marker and must be counter-selected after replacement for the previous I-SceI site/Km r mutation in SE164. Plasmid pBC-I-SceI encodes the chloramphenicol resistance (Cmr) gene and the I-SceI enzyme, which will cut the genome at the I-SceI site of SE164. Therefore, pBC-I-SceI was electroporated into SE164 along with PCR-B. After recombination of PCR-B to replace PCR-A, positive clones were chosen based on the ability to grow on chloramphenicol (Cm) but not on kanamycin (Km). After DNA sequencing of mutants to confirm successful recombination of PCR-B into SE164, the strains were designated SE172, SE173, SE180A, and SE189 for insert sequences LM2, CD154s, (Gly)3-CD154s-(Gly)3-LM2-(Gly)3, and (Ser)4-M2eA-(Ser)4-M2eA-(Ser)4-CD154-(Ser)4-LM2-(Ser)4-LM2-(Ser)4, respectively. For electroporation of LM2 and CD154s PCR-B products, at least 600 colonies were Cmr. To test efficiency of counter-selection, fifty Cmr colonies from each the LM2 and the CD154s electroporation reaction were screened by restreaking on Km plates. For both LM2 and CD154s clones, 96% of each proved to be Cmr but Km sensitive (Kms). Ten random clones for each the LM2 and CD154s insertion were used for PCR with lam 3f and lam 3r then digested using unique restriction enzymes sites for each insertion sequence. 100% of clones tested by digestion were positive for the desired mutation sequence, concluding the reliability and high efficiency of this selection scheme. Sequencing results in Figure The second mutation step required constructing a PCR fragment, referred to as PCR-B, consisting of the final insertion sequence flanked by aroA gene of SE172 and SE180A and in the aroA and htrA genes of SE189, the resulting strains were designated SE171, SE180B and SE197, respectively. LM2 antibody responses were analyzed using serum from chickens challenged with saline, S. enteritidis ΔaroA, SE171, SE180B or SE197. ELISA results showed 3.00, 2.92 and 3.36 fold increases for SE171, SE180B and SE197, respectively in production of LM2 antibodies compared to S. enteritidis ΔaroA alone . On the other hand, chicken serum antibody responses testing the in vivo expression of all ranges of insertion sequences have shown significantly increased LM2-specific antibody titers in chickens challenged with the epitope mutants compared to those challenged with saline or S. enteritidis ΔaroA alone unless described otherwise. Salmonella enteritidis 13A [All plasmids were first maintained in TOP10 Luria-Bertani (LB) mediawas used for routine growth of cells, and SOC media was used for phenotypic expressi on after electroporation. When appropriate, the following antibiotics were added to the media: ampicillin (Amp) at 100 μg/ml, kanamycin (Km) at 50 μg/ml, and chloramphenicol (Cm) at 25 μg/ml.r) gene used in overlapping PCR. Plasmid pBC-I-SceI produces the I-SceI enzyme, which cleaves the following 18 base pair, rare recognition sequence: 5'-TAGGGATAACAGGGTAAT-3' [r) gene is located on pBC-I-SceI, and this plasmid can be maintained in the cell at 37°C.Plasmids pKD46, pKD13, and pBC-I-SceI used for the present study were described previously ,6. PlasmGTAAT-3' . Also, tPfu polymerase buffer, 5 U Pfu polymerase , 1 mM dNTPs , 1.2 μM each primer in a total volume of 50 μL. The DNA engine thermal cycler was used with the following amplification conditions: 94°C for 2 minutes; 30 cycles of 94°C sec for 30 sec, 58°C for 60 sec, 72°C for 90 sec per 1 kb; and 72°C for 10 minutes for final extension. Each PCR product was gel purified and either eluted in 25 μL EB buffer for preparation of templates used in overlapping extension PCR or in 50 μL EB buffer, ethanol precipitated and suspended in 5 μL of ddH2O for electroporation into S. enteritidis.All primers used for PCR are listed in Table S. enteritidis was the first step carried out so that Red recombinase enzymes could be used for mediating recombination of subsequent mutations.Transformation of pKD46 into E. coli BW25113 [S. enteritidis 13A which had been prepared for electroporation according to a previously described protocol with few modifications [Plasmid pKD46 was harvested from 2O water and resuspended in 60 μL of 10% glycerol. Cells were then pulsed at 2400–2450 kV for 1–6 ms, incubated in SOC for 2–3 hours at 30°C and plated on LB media with appropriate antibiotics. S. enteritidis transformants with pKD46 were maintained at 30°C. When these transformants were prepared for additional electroporation reactions, all steps were the same except that 15% arabinose was added to induce Red recombinase enzymes one hour prior to washing, and cells did not undergo the 50°C heat step.2X YT broth at 37°C for 3–4 hours. Cells to be transformed with pKD46 plasmid were heated at 50°C for 25 minutes to help inactivate host restriction . Cells wr gene into loop 9 of the lamB gene was done using the Red recombinase system and overlapping PCR as described previously [lamB gene using Salmonella typhimurium LT2 (S.typhimurium) as an annotated reference genome [r gene from pKD13 plasmid [r- loop 9 down sequence (PCR-A) were electroporated into S. enteritidis, which harbored pKD46 and were induced by arabinose, and then plated on LB with Km plates. To verify the correct sequence orientation of the mutation, we performed colony PCR with primer pairs Kan4F/lam3f and Kan4R/lam3r, where Kan4F and Kan4R are Kmr gene-specific primers and lam3f and lam3r are primers located outside the lamB loop 9 region. These PCR fragments were gel purified and used for DNA sequencing. The verified mutant which carried the I-SceI/Kmr fragment in the mentioned loop 9 region of the lamB gene was designated SE164.Introduction of I-SceI enzyme recognition site along with the Kmeviously ,8. The ie genome . First, The final overlapping PCR fragment, PCR-B, contained the added LM2, CD154s, combination sequence I or combination sequence II flanked by loop 9 up and down regions Figure . Combina3-CD154s-(Gly)3-LM2-(Gly)3:TGGGCAGAAAAAGGTTATTATACCATGTCT; combination sequence I (Gly)4-M2eA-(Ser)4-M2eA-(Ser)4-CD154-(Ser)4-LM2-(Ser)4-LM2-(Ser)4:GGTGGTGGTTGGGCAGAAAAAGGTTATTATACCATGTCTGGTGGTGGTGAAGTTGAAACCCCGATTCGTAACGGTGGTGGT; and combination sequence II (Ser)TCCTCCTCCTCCGAAGTTGAAACCCCGACCCGTAACTCCTCCTCCTCCGAAGTTGAA ACCCCGACCCGTAACTCCTCCTCCTCCTGGGCAGAAAAAGGTTATTATACCATGTCT TCCTCCTCCTCCGAAGTTGAAACCCCGATTCGTAACTCCTCCTCCTCCGAAGTTGAA ACCCCGATTCGTAACTCCTCCTCCTCC.E. coli and Salmonella typhimurium proteins [To shorten the amount of steps for construction of this next fragment, the LM2 or CD154s sequence was synthetically added to the 5' end of the lam-dn-f primer and preceded by the complimentary region to the loop-up-r primer. The previously used PCR product for loop 9 up could be used together with the newly constructed PCR product in which LM2 or CD154s were incorporated at the 5' end of loop 9 down to perform the final PCR reaction. However, for other insert sequences (referred to as combination sequence I and II), an extra PCR step was needed, due to the longer lengths of insert sequences, to amplify loop 9 up with added nucleotides specific to insertion sequences connected to loop-up-r primer. The coding sequence for Gly (GGT) and Serine (TCC) as well as all other amino acids were chosen based on compiled data of the most frequently used codons in proteins . See Tabr fragment in loop 9 of the lamB gene. Clones for each PCR-B recombination mutation were chosen according to the ability to grow on Cm plates but not on Km plates, due to the replacement of PCR-B for the Kmr encoding PCR-A sequence. Modified regions in the selected clones were PCR-amplified, and DNA sequences were determined using primers lam3f and lam3r located outside the loop 9 down and up amplified regions. The assigned strain numbers for epitope insertions LM2, CD154, combination sequence I and combination sequence II were SE172, SE173, SE180A and SE189, respectively.PCR-B products and plasmid pBC-I-SceI (at a molar ratio of approximately 40:1) were simr gene in place of and thereby deleting aroA and/or htrA. This was done by first using overlapping PCR with primers aroA-1F, aroA-1R, aroA-2F and aroA-2R for the aroA deletions and htrA-1F, htrA-1R, htrA-2F and htrA-2R for the htrA deletions. The Kmr gene was amplified from pKD4 using primers Kan 3F and Kan 3R were calculated using the following equation: (sample- negative control)/(positive control – negative control).The author(s) declares that there are no competing interests.MC is the main author of the manuscript as well as the individual who carried out the majority of experimental methods and part of the experimental design. SL, TJ and KC have also contributed to lab work as well as editing of the manuscript. WB, LB, BH and YMK are the Principal Investigators who gathered the concepts of experimental design. All authors have read and approved the final manuscript.

We report on a patient with an animal bite eye injury, his surgical treatment and proper rabies immunoglobulin administration.A 33-year-old Turkey hunter was attacked by a bobcat and his injuries included a ruptured globe with corneal laceration, two iris sphincter tears, and a ruptured anterior capsule with a traumatic cataract. Rabies vaccination was started, primary closure of the corneal laceration, an anterior chamber washout and one week later cataract surgery were performed. Three months postoperatively he achieved an uncorrected visual acuity of 20/50 and a best corrected visual acuity of 20/20.Bobcat attacks on humans are very rare and extremely suspicious for rabies infection of the animal. Ophthalmologists need to be aware of the importance of immediate and appropriate post exposure rabies vaccination. Proper rabies immunoglobulin administration in the setting of globe injuries is challenging and we report on the Center for Disease Control and Prevention recommendations for globe injuries. Pasteurella multocida to be the most common pathogen cultured with 50% and 80% culture-positive rates for dog and cat bite scratches, respectively [Animal bites and scratches to the eye and ocular adnexa may result in severe injuries and are a significant medical problem. The vast majority of these bites are from pets such as dogs and cats . In moreectively . Injurieectively . Prodromectively . Wild an® MA60AC IOL was implanted symmetrically into the capsular bag and oriented 90° away from the anterior capsule extension . His injuries included a ruptured left eye with a 5 mm corneal laceration superior temporal, two iris sphincter tears at the area where the cornea was injured, and a ruptured anterior capsule with a traumatic cataract . A B-scan Figure . Three mAnimal bite injuries occur in the United States in more than a million cases per year, a number that probably only represents 25% to 50% of all incidents . Twenty In conclusion, the case reported shows the potential danger of animal attacks on humans and demonstrates subsequent important steps to treat ocular injuries and start proper rabies and tetanus immunization.CDC: The Center for Disease Control and Prevention.Written informed consent was obtained retrospectively from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.The authors declare that they have no competing interests.KDS performed the surgical treatments and follow-up of the patient. MPH reviewed the case and the literature and prepared the manuscript. Both authors read and approved the final manuscript.

As mtDNA comes from the recipient oocyte during SCNT and is regulated by genes in the donor nucleus, it is a perfect model to investigate the interaction between donor nuclei and host oocytes in SCNT.The interaction between the karyoplast and cytoplast plays an important role in the efficiency of somatic cell nuclear transfer (SCNT), but the underlying mechanism remains unclear. It is generally accepted that in nuclear transfer embryos, the reprogramming of gene expression is induced by epigenetic mechanisms and does not involve modifications of DNA sequences. In cattle, oocytes with various mitochondrial DNA (mtDNA) haplotypes usually have different ATP content and can further affect the efficiency of in vitro development of reconstructed bovine embryos produced by SCNT would be influenced by mtDNA haplotype compatibility between the oocytes and donor cells. Embryos from homotype A-A or B-B showed significantly higher developmental ability at blastocyst stages than the heterotype A-B or B-A combinations. Post-implantation development ability, pregnancy rate up to day 90 of gestation, as well as percent of term births were higher in the homotype SCNT groups than in the heterotype groups. In addition, homotype and heterotype SCNT embryos showed different methylation patterns of histone 3-lysine 9 (H3K9) genome-wide and at pluripotency-related genes .We investigated whether the Both histone and DNA methylation show that homotype SCNT blastocysts have a more successful epigenetic asymmetry pattern than heterotype SCNT blastocysts, which indicates more complete nuclear reprogramming. This may result from variability in their epigenetic patterns and responses to nuclear reprogramming. This suggests that the compatibility of mtDNA haplotypes between donor cells and host oocytes can significantly affect the developmental competence of reconstructed embryos in SCNT, and may include an epigenetic mechanism. Oct3/4, Sox2 and Nanog normally activated in the blastocyst stage , at 38.5About 2 hr after fusion, fusion rates were determined by visualisation. Then, the reconstructed embryos (fused KCCs) were replaced into 5 μM ionomycin for 4 min and then into in-house prepared additional culture of ACM culture medium with 10 μg/ml cycloheximide and 5 μg/ml cytochalasin B in four-well tissue culture plates for 5 hr.2 in air at 38.5°C for 7 days. The embryos were changed to a new MEF plate with ACM supplemented with 10% FBS on the third day after the day of nuclear transfer which was set as day 0. The cleavage rates, 8-cell rates and blastocyst rates were determined at 48 hr, 72 hr and 7 days after activation, respectively.The reconstructed embryos were transferred into ACM culture medium supplemented with 1% FBS on mouse embryonic fibroblast (MEF) monolayer under humidified atmosphere of 5% COin vitro maturation, MII oocytes were fertilized with thawed bull semen from a single ejaculate [in vivo embryos develop a little faster than in vitro embryos.As a control, 20 hr after jaculate . The embOn the seventh day after observed estrus, the homotype and heterotype SCNT embryos were transferred nonsurgically into the uterine lumen ipsilateral to the corpus luteum of each heifer (Chinese yellow cattle). Pregnancies were confirmed on day 60 by ultrasonography and thereafter on day 90 by trans-rectal palpation. These cattle were observed periodically until the cloned calves were born.Procedures using an antibody to identify H3K9 dimethylation specifically in the context of constitutive heterochromatin in the embryo were performed as described by Santos et al. with minin vivo embryo, IVF embryo, embryos derived from SCNT including homotype and heterotype haplotypes) as described previously [DNA was isolated from three replicates of each of the sample types . Individual clones were purified and then sequenced.t test (P < 0.05) and proportional data such as potential differences for embryo development or promoter DNA methylation profiles among different groups were analysed with Chi-square tests . Differences with a P-value < 0.05 were considered significant.All data were obtained from at least four replicates. Continuous data were analyzed with Student's FYZ, YTZ and SZH designed the study, while ZHY, YYZ, FY, JF, LWZ and PFG carried out the experiments ZHY, YYZ, JF, YTZ and FYZ prepared the manuscript. All authors read and agreed with the final draft.