Datasets:

krvhrv
/

Healix-2.8B-Token-Medical-Shot

Dataset card Viewer Files Files and versions Community

Split (1)

train · 1.39M rows

text stringlengths 4.16k 79.2k
1 4 9 2. QC Testing for the Release of a PER.C6 Working Cell Bank The release protocol of research working cell bank (rWCB) A068-043W, according to the panel of testing, is presented in Table III. The QC testing was conducted by contract at Inveresk Research and at MicroSafe. This testing included tests for (i) identity, (ii) sterility, and (iii) viral safety in cells of human and simian origin. 3. Development of a Master Cell Bank at the Merck Research Laboratories Cryopreserved vials of the rWCB were obtained from Crucell by the Merck Research Laboratories and expanded under conditions of cGMP manu facture to create a master cell bank (MCB) for future manufacturing use. This MCB has been released for use in the propagation of recombinant adenovirus according to a release protocol presented in Table IV. The preponderance of this QC testing was conducted by Q-One BioTech (Glasgow, Scotland). This release protocol for the rWCB provides persuasive demonstration of the (i) identity, (ii) sterility, and (iii) viral safety of the PER.C6 MCB. This release protocol specifies animal testing in small animals to supplement the egg safety testing applied to the rWCB, expands the variety of primary and continuous cell lines used for viral safety using in vitro cell culture, and greatly broadens the variety of agent-specific testing using PCR-based testing and biochemical testing for retroviruses. The human cell line 293 was included in the panel of tissue culture cell lines in an attempt to detect the presence of any defective adventitious virus that requires the presence of El in the host cell. The direct assay for reverse transcriptase, as well as the detection of RT in cocultivation supernatant fluids, was done with the highly sensitive PCR-based reverse transcriptase (PBRT) assay. The supplemental PCR tests were included Table III Release Protocol for Crucell rWCB A068-043W Test Method Identity Isozyme Sterility Broth and agar for cultivation of bacteria, fungi, mycoplasma In vitro cell culture testing for mycoplasma Viral Safety In vitro cell culture Vero, MRC-5, PER.C6 Agent-specific testing Adeno-associated virus using PCR 1 5 0 Nichols et al. Table IV Protocol for Release for the a PER.C6 Master Cell Bank Test Method Identity Isozyme analysis DNA Fingerprinting PCR-Based Test for El Sterility Broth and agar for cultivation of bacteria, fungi, mycoplasma In vitro cell culture testing for mycoplasma Viral safety In vivo eggs Eggs (allantoic and yolk sac) In vivo animals Guinea pig, adult and suckling mouse In vitro cell cuhure VERO, MRC-5, 293, Rabbit Kidney 13, Vero, bovine turbinate, porcine kidney Agent-specific testing Transmission electron microscopy PERT for RT Raji, RD, H9 cell-cocultivation for retroviruses PCR for HBV, HCV CMV, EBV, HHV6, HHV7, HHV8, HIV-1, HIV-2, HTLV-1 6c HTLV-2, SiFV, SFV, AAV, B19, bovine polyoma, SV40 with due consideration for the human origin of the cell line and the use of bovine serum for the derivation of the cell line. The tumorigenic potential of the cell line w âs tested beyond the anticipated manufacturing cell-passage level. Satisfactory results w êre obtained from all QC testing. The results of the testings are presented in Table V. B. Tumorigenicity 1. Tumorigenicity Studies of PER.C6 Cells Three tumorigenicity studies v^ere carried out on the PER.C6 cell line. The results of these studies are summarized in Table VI. In the first study, nude (nu/nu) mice v^ere injected subcutaneously v^ith 10^ PER.C6 cells. Positive control animals v^ere injected subcutaneously w îth \0^ KB cells. KB is a know^n tumor-producing cell line derived from an epidermoid carcinoma (American Type Culture Collection; CCL-121). The study w âs conducted over 28 days, at w^hich point all animals were necropsied and examined grossly and histologically. All of the positive control animals had growing nodules, and 8 of 10 male mice and 7 of 10 female mice receiving PER.C6 cells had growing nodules, thus producing a positive test (Table VIA). At the time of the first study, 21 or 28 days was the duration that was usually used. Subsequently the Center for Biologies Evaluation and 6. Propagation of Adenoviral Vectors 151 Table V Summary of Testing of PER.C6 Research Master Cell Bank (Passage No. 29) Test Specification Result Sterility (EP) Negative Negative Mycoplasma (broth, agar and DNA Negative Negative staining) In vitro virology for adventitious Negative Negative viruses (28 days, with cytopathic effect and haemadsorption) on Vero, MRC-5, HeLa and PER.C6 cells (PTC) Specific viruses Human immunodeficiency virus Negative Negative types 1 and 2 Human T-lymphotropic virus types Negative Negative 1 and 2 Human hepatitis B + C Negative Negative Human cytomegalovirus Negative Negative Human parvovirus B 19 Negative Negative Human herpes virus 6 Negative Negative Simian virus 40 Negative Negative Adeno-associated virus Negative Negative Epstein-Barr virus Negative Negative Bovine viruses (BVD, IBR and PI3) Negative Negative In vivo virology in suckling mice (i.e. Negative Negative and i.p.), and embryonated eggs. allantoic and yolk sac injections (PTC) Isoenzyme test for human origin Confirmed Confirmed In vivo virology (adult mice, guinea Absence of adventitious Free from infectious pigs and suckling mice) and microbial adventitious transmission electron microscopy contamination microbial (TEM) contamination Reverse transcriptase assay Negative Negative S+L^ focus forming assay and XC Negative Negative plaque assay Tumorigenicity in nude mice Report result Tumorigenic Restriction analysis No evidence of No evidence of mutation or mutation or rearrangements rearrangements Sequencing Report sequence Sequence reported {continued) 152 Nichols et aL Table V {continued) Test Specification Result DNA profiling rMCB (passage 29) Late passage banding Late passage banding and late passage cells (passage 98) pattern resembles pattern resembles rMCB rMCB Karyotyping/chromosomal analysis Report chromosome Modal No. 86. Range numbers 68-106 Fluorescent product enhanced reverse transcriptase (PERT) assay Negative Negative S^L~ focus forming assay and XC plaque assay Negative Negative Multicolor fluorescent in situ hybridization (M-FISH) Report integration site Chromosome 14 Copy no. determination (fiber FISH analysis) Report results 13.6 ± 6 . 1 Prions No evidence for Determination of prions infectious PrP^^ Confirmed Sequence analysis Research (CBER) of the Food and Drug Administration had suggested the observation period be extended to 84 days. This was to give more time for slow growing tumors to appear and for nontumorigenic nodules to regress or disappear. Therefore, the tumorigenicity study on the PER.C6 cells was repeated. The second study was performed in nude (nu/nu) mice over an 84-day period. Thirty nude mice were injected subcutaneously with 10^ PER.C6 cells in 0.2 mL of serum-free medium. As a positive control, 10 mice were injected subcutaneously with 10^ HeLa cells in 0.2 mL of serum-free medium. As a negative control, 30 mice were injected with 0.2 mL of medium. The mice were palpated at the injection site every 3 to 7 days and any nodules found were measured in two dimensions. The PER.C6 cell test arm and the negative control arm had 10 mice necropsied 21, 42, and 84 days postinjections. The positive control arm was necropsied at 42 days postinjection. Gross and histological examinations were performed on all injection sites and nodules if they appeared. During the initial days after injection, palpable nodules were present at the subcutaneous injection sites in all animals inoculated with PER.C6 cells. Between postinjection days 5 and 14, the detectable masses disappeared from the injection sites. However, in several of these mice, the masses subsequently reappeared by around day 21 and continued to enlarge until the animals were necropsied. Of the mice injected with PER.C6 cells, 5 of 10 sacrificed on day 21, 5 of 10 sacrificed on day 42, and 1 of 10 6. Propagation of Adenoviral Vectors 1 5 3 Table VI Tumorigenicity of PER.C6 Cells A. Day 28 tumorigenicity of PER.C6 and KB cells in nude mice Cell type No. of cells Male Female KB 1 X 10^ 10/10 10/10 PER.C6 1 X 10^ 9/10 7/10 B. 84-Day tumorigenicity study of PER.C6 and HeLa cells Cell type No. of cells Day 21 Day 42 Day 84 HeLa 1 X 10^ NA 10/10 NA PER.C6 1 X 10^ 5/10 5/10 1/10 Medium control — 1/10^ 0/10 0/10 C. Titration tumorigenicity study of PER.C6 cells in nude mice Cell type No. of cells Day 21 Day 42 Day 84 PER.C6 1 X 10^ 0/10 0/10 0/10 PER.C6 1 X 10^ 0/10 0/10 0/10 PER.C6 1 X 10^ 5/10 9/10 7/10^ Medium — 0/10 0/10 0/10 Note. Details of the experiment are presented in Section 5B. ^ Benign lung adenoma. Seven animals sacrificed, with tumors on day 56 and leaving 0/3 at day 84. sacrificed on day 84 (actually sacrificed on day 49 due to tumor size) had gross or microscopic evidence of a tumor (Table VI B). Histologically, these recurrent nodules were composed of sheets of large pleomorphic cells with numerous, sometimes abnormal, mitotic figures. These masses compressed the surrounding tissues but were not invasive. No tumors were observed outside the injection sites. The interpretation of the test is that PER.C6 cells are positive for tumorigenicity. In view of the positive tumorigenicity results obtained following injection of 10^ PER.C6 cells, a titration study was performed in which nude mice were injected with PER.C6 cells at doses of 10^, 10^, or 10^ cells per animal. Mice were necropsied 21, 42, or 84 days postinjection. No animals receiving 10^ PER.C6 cells had palpable masses at the injection site from the first palpation day until necropsy. None of these animals had gross or microscopic evidence of nodules or tumor cell collections at any necropsy time point. Two of the 30 mice receiving 10^ PER.C6 cells had palpable nodules on postinjection day 3. 1 5 4 Nichols ef al. These masses disappeared by day 7 and did not recur. Gross and histological examination of the injection sites were negative at all necropsy time points. In the mice that received 10^ PER.C6 cells, 29 of 30 animals had palpable nodules on Day 3 — some of which disappeared or became smaller but most of these recurred and grew progressively until necropsy. At necropsy, 5 of 10 mice on day 21 had tumors, 9 of 10 mice sacrificed on day 42 had tumors, and 7 of 10 in the group scheduled for day 84 had tumors but were sacrificed on day 56 because of tumor size (Table VI C). The histological and gross features of the PER.C6 cell tumors were similar to those described for the previous study (above). No metastatic nodules were found. Thus, the tumorigenicity studies of PER.C6 cells were positive at 10^ cells per animal and negative at 10^ and 10^ cells per animal. This would indicate that not all of the PER.C6 cells are tumorigenic and/or a critical mass of tumorigenic cells are necessary for tumor formation. 2. Tumorigenicity Studies of Residual DNA from PER.C6 Cells In view of the positive tumorigenicity studies with 10^ PER.C6 cells, the oncogenic potential of residual DNA from these cells was tested in both nude mice and newborn hamsters. For these studies, DNA was isolated from passage 61 PER.C6 cells using standard procedures. The DNA preparation was shown to be of high molecular weight (average size ~100 kb) and devoid of significant protein or RNA impurities. In the nude mouse study, 20 female nude (nu/nu) mice were injected subcutaneously with 225 \|JLg of PER.C6 DNA (in a volume of 0.25 mL). For negative controls, two groups of 20 female mice each were injected subcutaneously with 0.25 mL of vehicle. Approximately 5 months after injection, the mice were necropsied and examined histologically for tumor growth. None of the mice in this study exhibited gross or microscopic evidence of tumors at the injection site. One treated mouse had a lymphoma at a distant site. However, nude mice — particularly females — are known to have a high incidence of spontaneous lymphoma [75-78], and the occurrence of a single lymphoma in 20 treated mice is consistent with the spontaneous incidence. Although the lymphoma was almost certainly a spontaneous event, a polymerase chain reaction (PCR) study was performed on the lymphoma DNA to determine if there was any evidence for the presence of the adenovirus El region — the transforming agent of PER.C6 cells. The study was negative, with a sensitivity of approximately one copy of El per 750 tumor cells. Previously, El expression has been shown to be necessary to maintain the transformed state of 293 cells, which, like PER.C6 cells, were transformed by El [79]. The results of the PCR
analysis support the conclusion that the lymphoma was a spontaneous event, not induced by PER.C6 DNA. A second tumorigenicity study using DNA from PER.C6 cells was carried out in newborn hamsters. Between 18 and 36 h after birth, female and male 6. Propagation of Adenoviral Vectors 1 5 5 hamsters (28 total) were injected subcutaneously with approximately 100 \|xg of PER.C6 DNA (in a volume of 110 \|JLL). TWO groups of control hamsters (50, mixed sex, per group) were injected with 100 \|JLL of vehicle. Several pups in each group were lost due to maternal cannibalism, reducing the group sizes to 20 (11 female, 9 male) in the PER.C6 DNA group, 40 (19 female, 21 male) in control group 1, and 45 (27 female, 18 male) in control group 2. After weaning, the hamsters were palpated on a weekly basis. The hamsters were necropsied approximately 5 months after injection and examined grossly and histologically for tumor growth. One female hamster in control group 2 died approximately 21 weeks after injection of a malignant ovarian teratoma. No evidence of tumors was found in the 20 hamsters that were injected with PER.C6 DNA. 3. Concerns about Using a Tumorigenic Cell Substrate The basis for concern about using a tumorigenic cell substrate to produce a vaccine includes three theoretical possibilities. First, DNA from the cells carrying a putative activated oncogene or cancer-causing mutation could be integrated into the recipient's genome and produce a tumor. Second, a transforming protein in the cells could be transmitted and result in a tumor. Third, an adventitious tumor virus may be present and could be transmitted to the recipient and produce a tumor. Concerning residual DNA from a tumorigenic cell substrate, there have now been several reports demonstrating that DNA extracted from tumorigenic cell lines or tumors growing in vivo — and even purified activated onco genes— do not produce tumors when injected into animals at levels up to 1000 \|xg of DNA [80-87]. The negative results obtained with PER.C6 DNA in nude mice and newborn hamsters are consistent with these findings. In the case of the PER.C6 studies, the amount of DNA injected (~100 or 225 \|JLg) rep resents a > 10^-fold excess compared to the amount of residual DNA present in a dose of vaccine produced on this cell substrate. Others have calculated that 100 pg of residual DNA from tumorigenic cells would be equal to less than a billionth of a tumor-producing dose [80-87]. The second concern, transforming proteins or growth factors, has been considered by a WHO study group to be significant only if they are continually produced by cells or have continued administration [80, 81]. The study group did not consider the presence of contaminating known growth factors, in the concentrations that they would be found, to constitute a serious risk in biological products prepared from continuous cell lines. The third category of concern, viruses or other adventitial agents, does present a potential risk. This risk is greatest when primary cells are used because of the frequent need for newly acquired cells that require repeats of the extensive testing for adventitial agents. Human diploid cell lines and continuous tumorigenic cell lines are thoroughly and routinely tested for a 1 5 6 Nichols et al. wide variety of known and unknown adventitial agents in a series of in vitro and in vivo assays, thus providing adequate assurance that adventitial agents will not be transmitted. C. Prion-Related Issues It is now generally accepted that an abnormal form of the cell surface glycoprotein PrP, or prion protein, is the main infectious agent in transmissible spongiform encephalopathies like scrapie, bovine spongiform encephalopathy (BSE), and Creutzfeldt-Jakob disease (CJD) ([88] and reviewed in [89]). The abnormal form of PrP, called PrP^^ or PrP-res, is characterized by a remarkable resistance to denaturing agents and to degradation by Proteinase K (Prot K). Diagnostic tests take advantage of this unusual stability that allows a distinction between PrP^ and PrP^^ using antibodies that recognize both forms ofPrP(e.g., [90]). Human prion diseases occur in sporadic, acquired or inherited forms with different clinical and pathological phenotypes (reviewed in [91]). In 1996 a new variant of CJD (vCJD) was reported in the United Kingdom in relatively young patients with clinical features different from the known CJD forms [92]. It was also found by strain typing that the prion protein of these patients was indistin guishable from the one that causes BSE, thus raising the question whether vCJD could be acquired by consumption of meat from cattle suffering from BSE [93, 94]. The possibility of transmission of PrP^^ from bovine to human raises safety issues for cultured cell lines used for the production of human drugs. Therefore, PER.C6 cells were carefully examined for the PrP phenotype (see below) as well as genotype. It has been found that specific mutations in the PrP gene are associated with hereditary forms of human prion disease (reviewed in [89] and [91]). Furthermore, a common methionine/valine polymorphism at codon 129 of the PrP gene appears to be associated with phenotypic variability and susceptibility to sporadic and iatrogenic CJD. The vast majority of patients suffering from sCJD and also from vCJD were found to be homozygous for 129 M, whereas patients heterozygous at codon 129 were strikingly underrepresented [95-97]. To examine whether the PER.C6 PrP gene contains any of the known mutations associated with susceptibility to prion diseases, the PER.C6 PrP gene was sequenced. For these sequencing studies, genomic DNA from PER.C6 cells was isolated, and used to amplify the PrP gene sequences by PCR. The resulting PCR product was cloned into a vector, and the PrP gene in each of 13 PrP-containing clones was sequenced by BaseClear (Leiden, The Netherlands). Five of these clones contained sequences coding for the 129 Methionine PrP^ protein, while the other eight contained the 129 Valine PrP^ sequence, demonstrating the heterozygosity at this position. To confirm this observation, the resulting PCR product was also sequenced. As expected, a double peak (g/a) was observed in the 129 codon at a position 6. Propagation of Adenoviral Vectors 1 5 7 defining it as a valine (if the nucleotide is a guanine) or as methionine (if the nucleotide is an adenine). The PER.C6 PrP gene sequence was then compared to the wild-type sequence published in GenBank (Accession No. M12899) and was found to be identical to the wild type gene; thus, ruling out the possibility that these cells possessed a hereditary mutation that would be predisposing for prion diseases. The sequence also revealed that PER.C6 cells are heterozygous for methionine/valine at codon 129. PrP^ is constitutively expressed in adult brain [90, 98, 99] and at lower levels in other tissues like liver and spleen [100]. PrP expression has also been found in a variety of rodent and human cell lines. Our studies on PER.C6 and 293 cells have shown that these cells also express the cellular form of PrP. A validated Western blot analysis of Prot K-treated protein extracts of PER.C6 cells and their parental HER cells has failed to detect any Prot K-resistant forms of PrP at passages 33 and 36 of PER.C6 cells and passage 6 of their parental HER cells. In addition to the sequencing of the prion gene and testing for the presence of abnormal prion protein in the PER.C6 cells at an early and late passage level of the culture, serum and trypsin batches that were used were traced to see if any were derived in the United Kingdom. Finally, it has been possible to adopt the PER.C6 cells to serum-free suspension so that bovine sera can be completely avoided in the future if desired. The above-mentioned characteristics of PER.C6 make it a safe manufac turing cell line in this respect. D. Genetic Characterization of PER.C6 Cells 1. Sequence Analysis of El The integrity of the ElA and ElB coding regions present in PER.C6 was tested by sequence analysis. This was done by bidirectional sequencing of PCR fragments generated from these regions, and the sequence of these fragments was compared to the original pIG.ElA.ElB sequence, the construct that was initially used in transfection. No mutations, deletions, or insertions were detected between the sequence of the PCR fragments and pIG.ElA.ElB, indicating that no genetic alterations were introduced in the ElA and ElB regions during transfection and subsequent culture of the cells. 2. Site of Integration of El The chromosomal integration site of the plasmid pIG.ElA.ElB in PER.C6 was determined by using the multicolor fluorescent in situ hybridization (MEISH) technique in combination with the principle of combined binary ratio labeling (COBRA) [101]. This technique combines 24-color COBRA-MFISH 1 5 8 Nichols et al. using chromosome-specific painting probes for all human chromosomes with plasmid probe (pIG.ElA.ElB) visualization (25th color). The pIG.ElA.ElB integration site was determined using PER.C6 cells that are derived from the research master cell bank (passage number 29). Cells were analyzed at passage numbers 31, 41, 55, and 99. Two hundred and fifty metaphases and interphases were studied. pIG.ElA.ElB integration was detected only on chromosome 14 (Fig. 9, see color insert) and in both sister chromatids of the chromosome in all PER.C6 passage numbers screened. Of the 47 metaphases and 203 interphases, 75-80% consisted of integration of pIG.ElA.ElB in one chromosome 14, whereas 2 0 - 2 5 % consisted of integration in two chromosomes 14 [102]. 3. Copy Number of the El Construct The number of copies of pIG.ElA.ElB present in the PER.C6 chro mosome was studied by Southern blot analysis, dot bot analysis and fiber FISH analysis [102]. Southern hybridization revealed the presence of several integrated copies of pIG.ElA.ElB in the genome of PER.C6 [46]. In addition, dot blot analysis showed a pIG.ElA.ElB plasmid copy number of 19 ib 3 (research master cell bank) and 24 ± 16 (extended cell bank, passage number 99) per genome. From the results it was concluded that PER.C6 consists of five to six copies of pIG.ElA.ElB per haploid genome. Fiber FISH enables physical length measurements of in s/Yw-hybridized DNA probes on linearized DNA fibers with a resolution equal to the theoret ical length of a linearized DNA molecule according the model of Watson and Crick (1 kb is 0.34 jxm). Therefore, fiber FISH was conducted to measure the length of the integrated construct in the PER.C6 cell line at pas sage numbers (pns) 31, 41, and 99. Twenty fibers were measured. It was determined that pIG.ElA.ElB was integrated in tandem copies in chromo some 14 of PER.C6. The copy number of these in-tandem integrations was determined to be as follows: pn31, 13.6 ± 6 . 1 ; pn41, 18 ± 4 . 5 ; and pn99, 20.1 ± 7 . 9 . 4. Chromosome Analysis PER.C6 cells from cellular passages 44 and 66 were harvested for chromosome analysis to determine the modal chromosome number and the karyotype in a sample of metaphase plates. Cells were harvested, and slides were prepared and stained using a standard giemsa banding (GTG) technique. At each passage level, the chromosomes in 50 metaphase plates were counted. Also, full karyotypes were prepared from each passage level. At passage level 44, the chromosome number ranged from 43 to 160. The mean number of chromosomes was 72 and the modal number was 6. Propagation of Adenoviral Vectors 1 5 9 61. All metaphase plates examined had structural chromosomal changes and rearrangements. A marker chromosome 19 with additional material in the long arm (19q^) was the most common alteration and was found in 14 of the 20 metaphase plates that were karyotyped. At passage 66, the chromosome number ranged from 42 to 112. The mean number of chromosomes was 63 and the modal number was 64. All metaphase plates karyotyped again were found to have structural changes. The 19q'^ was again the most common change, observed in 15 of 20 karyotypes. There was also a marker chromosome 11 with extra material in the short arm (llp+) in 14 of the 20 karyotypes and a marker chromosome 9 with additional material in the short arm (9p+) in 8 of the 20 karyotypes. Several of the markers differed at the two passage levels, but the most common marker, 19^+, was the same. The continuing changes seen as passage level increases is typical of heteroploid continuous cell lines. 5. DNA Fingerprinting PER.C6 cells were also analyzed on two
occasions by DNA fingerprinting. DNA profile analysis of PER.C6 indicated no changes in the banding pattern obtained between the research master cell bank (pn 29) and an extended cell bank that was laid down at passage number 99. On a second occasion, a consistent DNA fingerprint was obtained between pn 45 and pn 67. There was no evidence of cross contamination with other cell lines. VI . Conclusions At the present time, the PER.C6 cell line is the best substrate for the production of adenoviral vectors for gene therapy or vaccines. This conclusion is based on the ability to obtain good yields and safety considerations. The major safety considerations are the possibility of: i. the production of replication-competent adeno virus (RCA); ii. a tumorigenic risk from the transformed cell line; iii. the presence of abnormal prions; iv. contamination by adventitial agents. As described in this chapter, the lack of any overlap between the genome of the adenoviral vectors that carry the El deletion and the adenoviral El sequences carried in the PER.C6 cells makes homologous recombination impossible, thereby preventing the formation of RCA. It is well known that many transformed cell lines can produce tumors when injected into immunodeficent animals. As described, PER.C6 cells pro duce tumors in nude mice when 10^ cells are injected. They do not produce 1 6 0 Nichols et al. tumors, however, when 10^ or 10^ cells are injected. Since it is not anticipated that there will be any PER.C6 cells in a final product, this leaves the question of possible tumorigenicity of residual PER.C6 cellular DNA. Studies in nude mice and newborn hamsters in which DNA from PER.C6 cells was injected were negative for tumor production. The possibility of the presence of abnormal prions that could produce a neurodegenerative disease was also considered. This could occur if the PER.C6 cells had a mutation in a prion gene or if the cells were contaminated with abnormal prions such as in bovine spongioform encephalopathy. As far as possible, all serum and trypsin batches used from the time of origin of the culture were traced and no contact of serum from British sources was identified. The PER.C6 cell line was also adapted to serum-free suspension cultures. The prion protein gene of PER.C6 cells was sequenced and no mutations were found and the cell line was shown to be heterozygous for the 129 MA^ polymorphism. The cell line was also analyzed for the presence of abnormal prions at an early and late passage and an early passage of the HER parental line and none were found. In total, these studies indicate that the risk of a prion disease from the use of PER.C6 cells is vanishingly small. Finally, extensive studies for known and unknown adventitial agents have been documented and are negative. While there can be no absolute elimination of risk, this body of studies indicates a minimal, if any, risk from the use of this cell substrate for the production of adenoviral vectors. As new studies are developed they will also be apphed to ensure that no hazards are present. It has often been pointed out that a continuous cell line such as PER.C6 permits extensive analysis for adventitial agents and other safety concerns and thus is less hazardous than short-lived primary cell cultures for which testing must be repeated for each newly established culture. References 1. Russell, W. (2000). Update on adenovirus and its vectors./. Gen. Virol. 81, 2573-2604. 2. Rowe, W., Huebner, R., Gilmore, L., Parrott, R., and Ward, T. (1953). Isolation of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proc. Soc. Exp. Biol. Med. 84, 570-573. 3. Hilleman, M., and Werner, J. (1954). Recovery of new agents from patients v^ith acute respiratory illness. Proc. Soc. Exp. Biol. Med. 85, 183-188. 4. Hierholzer, J., Wigand, R., Anderson, L., Adrian, T., and Gold, J. (1988). Adenoviruses from patients with AIDS: A plethora of serotypes and a description of five new serotypes of subgenus D (types 43-47) . / . Infect. Dis. 158, 804-813. 5. Schnurr, D., and Dondero, M. E. (1993). Two new candidate adenovirus serotypes. Intervi- rology 36, 79-83. 6. Jong, J. C. de, Wermenbol, A. G., Verweij-Uijterwaal, M. W., Slaterus, K. W., Wertheim- van Dillen, P., Doornum, G. J., van, Khoo, S. H., and Hierholzer, J. C. (1999). Adenoviruses 6. Propagation of Adenoviral Vectors 1 6 1 from human immunodeficiency virus-infected individuals, including two strains that represent new candidate serotypes Ad50 and Ad51 of species Bl and D, respectively./. Clin. Microbiol. 37, 3940-3945. 7. Francki, R., Fauquet, C , Knudson, D., and Brown, F. (1991). Classification and nomencla ture of viruses. Fifth report of the international committee on taxonomy of viruses. Arch. Virol, suppl. 2, 140-144. 8. Horwitz, M. S. (1990) Adenoviridae and their replication. In "Virology" (B. N. Fields and D. M. Knipe, Eds.), pp. 1679-1740. Raven Press, New York. 9. Wold, W. S. M., Tollefson, A. E., and Hermiston, T. W. (1995) Strategies of immune modulation by adenoviruses. In "Viroceptors, Virokines and Related Immune Modulators Encoded by DNA Viruses" (G. McFadden, Ed.), pp. 147-185. Springer-Verlag, Heidelberg. 10. Wadell, G. (1984). Molecular epidemiology of adenoviruses. Curr. Top. Microbiol. Immunol. 110, 191-220. 11. Ishibashi, M., and Yasue, H. (1984). In "The Adenoviruses" (H. Ginsberg, Ed.), pp. 497-561. Plenum Press, London, New York. 12. Arnberg, N., Kidd, A., Edlund, K., Olfat, F., and Wadell, G. (2000). Initial interactions of subgenus D adenoviruses with A549 cellular receptors: Sialic acid versus av integrins. / . V/ro/. 74, 7691-7693. 13. Roelvink, P., Lizonova, A., Lee, J., Li, Y., Bergelson, J., Finberg, R., Brough, D., Kovesdi, L, and Wickham, T. (1998). The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E and F. / . Virol. 72, 7909-7915. 14. Bergelson, J., Cunningham, J., Droguett, G., Kurt-Jones, E., Krithivas, A., Hong, J., Horwitz, M., Crowell, R., and Finberg, R. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 15. Greber, U. F., Willetts, M., Webster, P., and Helenius, A. (1993). Stepwise dismantling of adenovirus 2 during entry into cells. Cell 75, 477-486. 16. Vliet, P. van der (1995) Adenovirus DNA replication. In "The Molecular Repertoire of Adenoviruses" (W. Doerfler, and P. Bohm, Eds.), Vol. II. Springer Verlag, Berlin. 17. Ulfendahl, P. J., Linder, S., Kreivi, J. P., Nordqvist, K., Sevensson, C , Hultberg, H., and Akusjarvi, G. (1987). A novel adenovirus-2 El A mRNA encoding a protein with transcription activation properties. EMBO J. 6, 2037-2044. 18. Stephens, C , and Harlow, E. (1987). Differential splicing yields novel adenovirus 5 ElA mRNAs that encode 30 kd and 35 kd proteins. EMBO J. 6, 2027-2035. 19. Sarnow, P., Hearing, P., Anderson, C. W., Halbert, D. N., Shenk, T., and Levine, A. J. (1984). Adenovirus early region IB 58,000-dalton tumor antigen is physically associated with an early region 4 25,000-dalton protein in productively infected cells. / . Virol. 49, 692-700. 20. Rubenwolf, S., Schutt, M., Nevels, H., and Dobner, T. (1997). Structural analysis of the adenovirus type 5 ElB 55-kilodalton-E40RF6 protein complex./. Virol. 71, 1115-1123. 21. Debbas, M., and White, E. (1993). Wild-type p53 mediates apoptosis by ElA which is inhibited by ElB. Genes Dev. 7, 546. 22. Tarodi, B., Subramanian, T., and Chinnadurai, G. (1993). Functional similarity between adenovirus ElB 19 K gene and Bcl2 oncogene — mutant complementation and suppression of cell death induced by DNA damaging agents. Int. J. Oncol. 3, 467-472. 23. Telling, G. C , Perera, S., Szatkowski, O. M., and Williams, J. (1994). Absence of an essential regulatory influence of the adenovirus ElB 19-kilodalton protein on viral growth and early gene expression in human diploid WI38, HeLa, and A549 cells. / . Virol. 68, 541-547. 24. Leppard, K. N. (1997). E4 gene function in adenovirus, adenovirus vector and adeno- associated virus infections./. Gen. Virol. 78, 2131-2138. 25. Pombo, A., Ferreira, J., Bridge, E., and Carmo Fonseca, M. (1994). Adenovirus replication and transcription sites are spatially separated in the nucleus of infected cells. EMBO J. 13, 5075-5085. 1 6 2 Nichols ef al. 26. Dobner, T., Horikoshi, N., Rubenwolf, S., and Shenk, T. (1996). Blockage by adenovirus E4orf6 of transcriptional activation by the p53 tumor suppressor. Science 171, 1470-1473. 27. Moore, M., Horikoshi, N., and Shenk, T. (1996). Oncogenic potential of the adenovirus ORF6 protein. Froc. Natl. Acad. Set. USA 93, 11,295-11,303. 28. Muller, U., Kleinberger, T., and Shenk, T. (1992). Adenovirus E4orf4 protein reduces phosphorylation of c-Fos and El A proteins while simultaneously reducing the level of AP-1. / . Virol. 66, 5867-5878. 29. Shtrichman, R., and Kleinberger, T. (1998). Adenovirus type 5 E4 open reading frame 4 protein induces apoptosis in transformed cells./. Virol. 71, 2975-2982. 30. Johnson, D., Ohtani, K., and Nevins, J. (1994). Autoregulatory control of E2F1 expression in response to positive and negative regulators of cell cycle progression. Genes Dev. 8, 1514-1525. 31. Lubeck, M. D., Davis, A. R., Chengalvala, M., Natuk, R. J., Morin, J. E., Molnar, K. K., Mason, B. B., Bhat, B. M., Mizutani, S., Hung, P. P., and Purcell, H. (1989). Immunogenicity and efficacy testing in chimpanzees of an oral hepatitis B vaccine based on live recombinant adenovirus. Proc. Natl. Acad. Sci. USA 86, 6763-6767. 32. Torres, J. M., Alonso, C , Ortega, A., Mittal, S., Graham, F., and Enjuanes, L. (1996). Tropism of human adenovirus type 5-based vectors in swine and their ability to protect against transmissible gastroenteritis coronavirus. / . Virol. 70, 3770-3780. 33. Pacini, D. L., Dubovi, E. J., and Clyde, W. A. (1984). A new animal model for human respiratory tract disease due to adenovirus./. Infect. Dis. 150, 92-97. 34. Trentin, J., Yale, Y., and Taylor, G. (1962). The quest for human cancer viruses. Science 137,835-841. 35. Bernards, R., and Eb, A.J. van der (1984). Adenovirus: Transformation and oncogenicity. Biochim. Biophys. Acta 783, 187-204. 36. Flint, S. J. (1980) Transformation by adenoviruses. In "Molecular Biology of Tumor Viruses: DNA Tumor Viruses" (J. Tooze, Eds.), pp. 547-576. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 37. Freeman, A., Black, P. A. J. van der, Henry, P., Austin, J., and Huebner, R. (1967). Proc. Natl. Acad. Sci. USA 58, 1205-1212. 38. Graham, F. L., Eb, A.J. van der, and Heijneker, H. L. (1974). Size and location of the transforming region in human adenovirus type 5 DNA. Nature 251, 687-691. 39. Bernards, R., and Eb, A. J. van der. (1984). Adenovirus: Transformation and oncogenicity. Biochim. Biophys. Acta 783, 187-204. 40. Schrier, P., Bernards, R., Vaessen, R., Houweling, A., and Eb, A. J. van der. (1983). Expression of class I major histocompatibility antigens switched off by highly oncogenic adenovirus 12 in transformed rat cells. Nature 305, 771-775. 41. Graham, F. L., Smiley, J., Russell, W. C , and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from adenovirus type 5. / . Gen. Virol. 36, 59-72. 42. Whittaker, J. L., Byrd, P. J., Grand, R. J. A., and Gallimore, P. H. (1984). Isolation and characterization of four adenovirus type 12-transformed human embryo kidney lines. Mol. Cell Biol. 4, 110-116. 43. Gallimore, P. H., Grand, R. J. A., and Byrd, P. J. (1986). Transformation of human embryo retinoblasts with simian virus 40, adenovirus and ras oncogenes. Anticancer Res. 6, 499-467. 44. Vaessen, R. T. M. J., Houweling, A., Israel, A., Kourilsky, P., and Eb, A. J. van der. (1986). Adenovirus ElA-mediated regulation of class I MHC expression. EMBO J. 5, 335-341. 45. Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houweling, A., Ormondt, H. van, and Hoeben, R. C , and A.J. van der. (1996). Characterization of 911: A new helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Hum. Gene Ther. 7, 215-222. 6. Propagation of Adenoviral Vectors 1 6 3 46. Fallaux, F. J., Bout, A., Velde, I. v. d., Wollenberg, D. J. M. van den, Hehir, K., Kee- gan, J., Auger, C , Cramer, S. J., Ormondt, H. van, Eb, A. J. van der, Valerio, D., and Hoeben, R. C. (1998). New helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 47. Schiedner, G., Hertel, S., and Kochanek, S. (2000). Efficient transformation of primary human amniocytes by El functions of Ad5: Generation
of new^ cell lines for adenoviral vector production. Hum. Gene Ther. 11, 2105-2116. 48. Houv^eling, A., Elsen, P. v. d., and Eb, A. J. van der (1980). Partial transformation of primary rat cells by the left-most 4.5% of adenovirus 5 DNA. Virology 105, 537-550. 49. Teodoro, J., and Branton, P. (1997). Regulation of apoptosis by viral gene products. / . Virol. 71, 1739-1746. 50. Dyson, N., and Harlow, E. (1992). Adenovirus El A targets key regulators of cell prolifera tion. Cancer Surv. 12, 161-195. 51. Peeper, D. S., and Zantema, A. (1993). Adenovirus-EIA proteins transform cells by seques tering regulatory proteins. Mol. Biol. Rep. 17, 197-207. 52. Peeper, D. S., A.J. van der, and Zantema, A. (1994). The Gl/S cell-cycle checkpoint in eukaryotic cells. Biochim. Biophys. Acta 1198, 215-230. 53. White, E., Cipriani, R., Sabbatini, P., and Denton, A. (1991). Adenovirus ElB 19-kilodalton protein overcomes the cytotoxicity of ElA proteins. / . Virol. 65, 2968. 54. Bout, A. (1999). Towards safe and effective adenoviral vectors for human gene therapy. Eur. Biopharm. Rev. December, 94-99. 55. Imler, J. L., Chartier, C , Dreyer, D., Dieterle, A., Sainte-Marie, M., Faure, T., Pavirani, A., and Mehtah, M. (1996). Novel complementation cell lines derived from human lung carcinoma A549 cells support the growth of El-deleted adenovirus vectors. Gene Ther. 3, 75-84. 56. Brough, D. E., Lizonova, A., and Kovesdi, I. (1996). Stable cell lines for complementation of adenovirus early regions El , E2A and E4. In "Abstract Book CSH Conference on Gene Therapy," p. 42. 57. Louis, N., Evelegh, C , and Graham, F. L. (1997). Cloning and sequencing of the cellular- viral junctions from the human adenovirus type 5 transformed 293 cell line. Virology 233, 423-429. 58. Hehir, K. M., Armentano, D., Cardoza, L. M., Choquette, T. L., Berthelette, P. B., White, G. A., Couture, L. A., Everton, M. B., Keegan, J., Martin, J. M., Pratt, D. A., Smith, M. P., Smith, A. E., and Wadsworth, S. C. (1996). Molecular characterization of replication- competent variants of adenovirus vectors and genome modifications to prevent their occurrence./. Virol. 70, 8459-8467. 59. Lochmiiller, H., Jani, A., Huard, J., Prescott, S., Simoneau, M., Massie, B., Karpati, G., and Acsadi, G. (1994). Emergence of early region 1-containing replication-competent adenovirus in stocks of replication-defective adenovirus recombinants (DEI + DE3) during multiple passages in 293 cells. Hum. Gene Ther. 5, 1485-1492. 60. Zhu, J., Grace, M., Casale, J., Chang, A., Musco, M., Bordens, R., Greenberg, R., Schaefer, E., and Indelicato, S. (1999). Characterization of replication-competent adenovirus isolates from large-scale production of a recombinant adenoviral vector. Hum. Gene Ther. 10, 113-121. 61. Imler, J. L., Bout, A., Dreyer, D., Dieterle, A., Schultz, H., Valerio, D., MehtaU, M., and Pavirani, A. (1995). Trans-complementation of El-deleted adenovirus: A new vector to reduce the possibility of codissemination of wild-type and recombinant adenoviruses. Hum. Gene Ther. 6,711-721. 61. Hermens, W. T. J. M. C , and Verhaagen, J. (1997). Adenoviral-vector-mediated gene expression in the nervous system of immunocompetent Wistar and T cell-deficient nude 1 6 4 Nichols ef al. rats: Preferential survival of transduced astroglial cells in nude rats. Hum. Gene Ther. 8, 1049-1063. 63. Ormondt, H. v., and Galibert, F. (1984) Nucleotide sequences of adenovirus DNAs. In "Current Topics in Microbiology and Immunology," Vol. 110, pp. 73-142. Springer-Verlag, Heidelberg. 64. Vales, L. D., and Darnell, J.J. (1989). Promoter occlusion prevents transcription of aden ovirus polypeptide IX mRNA until after DNA replication. Genes Dev. 3, 49-59. 65. Singer-Sam, J., Keith, D. H., Tani, K., Simmer, R. L., Shively, L., Lindsay, S., Yoshida, A., and Riggs, A. D. (1984). Sequence of the promoter region of the gene for X-hnked 3-phosphoglycerate kinase. Gene 32, 409-417. GG. Valerio, D., Duyvesteyn, M. G. C , Dekker, B. M. M., Weeda, G., Bervens, T. M., Voorn, L. van der, Ormondt, H. van, and Eb, A. J. van der (1985). Adenosine deaminase: charac terization and expression of a gene w îth a remarkable promoter. EMBO J. 4, 437-443. 67. Simonsen, C., and Levinson, A. (1983). Analysis of processing and polyadenylation signals of the hepatitis B Virus surface antigen gene by using simian virus 40-Hepatitis B Virus chimeric plasmids. MoL Cell Biol. 3, 2250-2258. 68. Roberts, B. E., Miller, J. S., Kimelman, D., Cepko, C. L., Lemischka, I. R., and Mulligan, R. C. (1985). Individual adenovirus type 5 early region lA products elicit distinct alterations of cellular morphology and gene expression. /. Virol. 56, 404-413. 69. Albert, D., Rabson, A., and Dalton, A. (1968). In vitro neoplastic transformation of uveal and retinal tissues by oncogenic DNA viruses. Invest. Ophthalmol. 7, 357-365. 70. Mukai, N., Kalter, S., Cummins, L., Mathews, V., Nishida, T., and Nakajima, T. (1980). Retinal tumor induction in the baboon by human adenovirus 12. Science 210, 1023-1025. 71. Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houw^ehng, A., Ormondt, H. v., Hoeben, R. C , and Eb, A. J. van der (1996). Characterization of 911: A new helper cell line for the titration and propagation of early-region-1-deleted adenoviral vectors. Hum. Gene Ther. 7, 215-222. 72. Byrd, P., Brown, K., and Gallimore, P. (1982). Malignant transformation of human embryo retinoblasts by cloned adenovirus 12 DNA. Nature 298, 69 -71 . 73. Bett, A. J., Haddara, W., Prevec, L., and Graham, F. L. (1994). An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc. Natl. Acad. Sci. USA 91, 8802-8806. 74. Blanche, F., Cameron, B., Barbot, A., Ferrero, L., Guillemin, T., Guyot, S., Somarriba, S., and Bisch, D. (2000). An improved anion-exchange HPLC method for the detection and purification of adenoviral particles. Gene Ther. 7, 1055-1062. 75. Sadoff, D., Jr, W. G., DiGiacomo, R., and Vogel, A. (1988). Neoplasms in NIH Type II athymic (nude) mice. Lab. Anim. Sci. 38, 407-412. 76. Furmanski, P., and Rich, M. (1982) Neoplasms of the hematopoietic system. In "The Mouse in Biomedical Research" {H. Foster, J. Small, and J. Fox, Eds.), pp. 351-371. Academic Press, London. 77. Gershwin, M., Yoshiyuki, P., Castles, J., Ikeda, R., and Ruebner, B. (1983). Anti-\|JL induces lymphoma in germfree congenitally athymic (nude) but not heterozygous (nu/+) mice. / . Immunol. 131, 2069-2073. 78. Frith, C , Ward, J., Frederickson, T., and Harleman, J. (1996) Neoplastic lesions of the hematopoietic system. In "Pathobiology of the Aging Mouse" (U. Mohr, D. Dungsworth, C. Capen, W. Carlton, J. Sundberg, and J. Ward, Eds.), pp. 219-235. ILSI Press, Washington DC. 79. Quinlan, M. P. (1993). Expression of antisense ElA in 293 cells results in altered cell morphologies and cessation of proliferation. Oncogene 8, 257-265. 6. Propagation of Adenoviral Vectors 1 6 5 80. WHO Report (1987). Acceptability of cell substrates for production of biologicals. "Report of WHO Study Group", WHO Technical Report Series 747, tables 1 and 2. World Health Organization, Geneva. 81. WHO Report (1998). WHO requirements for the use of animal cells as in vitro substrates for the production of biologicals. In Requirements for Biological Substances, No. 50 [Reproduced from WHO Technical Report Series 878]. 82. Grachev, V. Advances in biotechnical processes. In "Viral Vaccines" (A. Mizraki, Ed.), Vol. 14. Wiley-Liss, New York. 83. Mufson, R., and Gesner, T. (1985). Lack of tumorigenicity of cellular DNA and oncogene DNA in nev^born Chinese Hamsters. In "Abnormal Cells, New Products and Risk" (H. Hopps, and J. Petricciani, Eds.) pp. 168-169. Tissue Culture Association, Gaithersburg, Maryland. 84. Levinson, A., Svedersky, L., and Jr, M. P. (1985) Tumorigenic potential of DNA derived form mammalian cell lines. In "Abnormal Cells, New Producst and Risks" (H. Hopps, and J. Petricciani, Eds.), pp. 161-165. 85. Palladino, M., Levinson, A., Svedersky, L., and Objeski, J. (1987). Safety issues related to the use of recombinant DNA-derived cell culture products. I Cellular components. Dev. Biol. Standard 66, 13-22. 86. Wierenga, D., Cogan, J., and Petricciani, J. (1995). Administration of tumor cell chromatin to immunosuppressed and non-immunosuppressed non-human primates. Biologicals 23, 221-224. 87. Lower, J. (1990). Risk of tumor induction in vivo by residual cellular DNA: Quantitative considerations./. Med. Virol. 31, 50-53 . 88. Prusiner, S. (1982). Novel proteinaceous infectious particle causes scrapie. Science 216, 136-144. 89. Prusiner, S. (1998). Prions. Proc. Natl. Acad. Sci. USA 95, 13,363-13,383. 90. Oesch, B., Westaway, D., Walchh, M., McKinley, M., Kent, S., Aebersold, R., Barry, R., Tempst, P., Teplow, D., Hood, L., Prusiner, S., and Weissmann, C. (1985). A cellular gene encodes scrapie PrP 27-30 protein. Cell 40, 735-746. 91. Ironside, J. (1998). Prion diseases in man. / . Pathol. 186, 227-234. 92. Will, R., Ironside, J., Zeidler, M., Cousens, S., Estibeiro, K., Alperovitch, A., Poser, S., Pocchiari, M., Hofman, A., and Smith, P. (1996). A new variant of Creutzfeldt-Jakob disease in the U.K. Lancet 347, 921-925. 93. Bruce, M., Will, R., Ironside, J., McConnell, I., Drummond, D., Suttie, A., McCardle, L., Chree, A., Hope, J., Birkett, C , Cousens, S., Eraser, H., and Bostock, C. (1997). Transmissions to mice indicate that 'new variant' CJD is caused by the BSE agent. Nature 389,498-501. 94. CoUinge, J., Sidle, K., Meads, J., Ironside, J., and Hill, A. (1996). Molecular analysis of prion strain variation and the aetiology of "new variant" CJD. Nature 383, 685-690. 95. Palmer, M., Dryden, A., Hughes, J., and CoUinge, J. (1991). Homozygous prion protein genotype predisposes to sporadic Creutzfeld-Jakob disease. Nature 352, 340-342. 96. CoUinge, J., Palmer, M., and Dryden, A. (1991). Genetic predisposition to iatrogenic Creutzfeld-Jakob disease. Lancet 337, 1441-1442. 97. Parchi, P., Castellani, R., CapeUari, S., Ghetti, B., Young, K., Chen, S., Farlow, M., Dickson, D., Sima, A., Trojanowski, J., Petersen, R., and Gambetti, P. (1996). Molecular basis of phenotypic variability in sporadic Creutzfeldt-Jakob disease. Ann. Neurol. 39, 767-778. 98. Chesebro, B., Race, R., Wehrly, K., Nishio, J., Bloom, M., Lechner, D., Bergstrom, S., Robbins, K., Mayer, L., Keith, J., Garon, C , and Haase, A. (1985). Identification of scrapie prion-protein mRNA in scrapie-infected and uninfected brain. Nature 315, 331-335. 99. Meyer, R., McKinley, M., Bowman, K., Braunfeld, M., Barry, R., and Prusiner, S. (1986). Separation and properties of cellular and scrapie prion protein. Proc. Natl. Acad. Sci. USA 83,2310-2314. 1 6 6 Nichols ef al. 100. Caughey, B., Race, R., and Chesebro, B. (1988). Detection of prion protein mRNA in normal and scrapie-infected tissues and cell lines./. Gen. Virol. 69, 711-716. 101. Tanke, H. J., Wiegant, J., van Gijlswijk, R. P., Bezrookove, V., Pattenier, H., Heetebrij, R. J., Talman, E. G., Raap, A. K., and Vrolijk, J. (1999). New strategy for multi-colour fluorescence in situ hybridisation: COBRA: COmbined Binary RAtio labelling. Eur. J. Hum. Genet. 7 , 2 - 1 1 . 102. Wiegant, J., Brouwer, K., Bezrookove, V., Raap, A., Bout, A., and Tanke, H. "Molecular Cytogenetic Characterization of PER.C6 Cells". In preparation. C H A P T E R Purification of Adenovirus Paul Shabram Gary Vellekamp Canji Inc. Schering-Plough Research Institute San Diego, California Kenilworth, New Jersey Carl Scandella Carl Scandella Consulting Bellevue, Washington I. Introduction Since the late 1950s, adenoviruses have been purified using classical methods of density gradient ultracentrifugation. These methods w êre efficient and could supply the quantities of highly purified viral particles necessary for research. The need for larger quantities has arisen v^ith the advent of the use of adenoviral vectors for gene therapy trials. In this chapter, ŵ e discuss the techniques for extracting adenoviral particles from a complex milieu. Selecting the best technique for purification requires an understanding of the physical nature of the particles as well as the nature of contaminants. Knov^ledge of these properties is essential for developing a purification process that is sufficient to supply the commercial market for a therapeutic adenovirus. A. The Physical Characteristics of the Adenovirus Particle in Solution There are numerous adenoviruses that possess specific tropism for many species of animals including human, bovine, ovine, equine, canine, porcine, murine, and simian adenovirus subgenera. Although many of these aden oviruses are capable of delivering a transgene to human tissues, the development of clinical adenoviral agents most often employs human adenoviral vectors derived from human adenovirus serotypes 2 or 5. Consequently, for the pur poses of this discussion, the information given here refers to human adenovirus types 2 and 5. ADENOVIRAL VECTORS FOR GENE THERAPY 1 £.y Copyright 2002, Elsevier Science (USA). All rights reserved. 168 Shabram ef a/. 1. Particle Size Size and shape are key factors involved in purifying any macromolecule. These factors are
equally applicable to adenoviruses, w^hich are much larger than most biomolecules commonly purified. Adenoviruses are icosahedral in shape v^ith fiber-like extensions from each of the 12 vertices. The adenovirus is composed of DNA, protein, and carbohydrate. The viral DNA is packaged in a highly organized protein coat termed the "capsid." Negative staining electron microscopy of the adenovirus capsid was used to estimate a diameter of 73 nm along a fivefold symmetry axis with a vertex-to-vertex diameter of about 83 nm [1]. Freeze-fracture studies demonstrate a slightly larger capsid diameter. Fibers extending from each of 12 vertices increase vertex-to-vertex diameter by about 40 nm for human adenovirus serotype 5. Oliver et al. [2] employed photon correlation spectroscopy to characterize the adenovirus type 5 particles in solution, reporting a molecular w^eight of 167 x 10^ Da and a corresponding particle diameter of 98 nm. 2. Diffusion of Adenovirus Particles The adenovirus particle diffuses very slow l̂y in solution. The diffusion coefficient for Ad-5 is 4.46 x 10~^^ m^/s in serum containing media at 37°C [2, 3]. Figure 1 compares the diffusion constants of some w^ell-knov^n 10^ • Sucrose* ^ 101 Insulin* f s • Horse Hemoblobin* • Urease* Q 1011 Tobacco Mosaic Virus* • Adenovirus Type 5** • 1012 —^ —r- —T" 102 103 104 105 106 107 108 109 Molecular Weight Figure 1 The diffusion coefficients of macromolecules are related to their sizes. Adenoviral particles diffuse very slov/ly in solution. This slow diffusion rate affects mixing, separation, and analytical methods. 7. Purification of Adenovirus 1 6 9 macromolecules to adenovirus. The large size and corresponding slow diffusion of adenovirus particles in solution require consideration in mixing because, given the density of the particle and its SIOMA rate of diffusion, Brovs^nian motion cannot be relied upon to disperse the particle. If left alone the particles in solu tion w^ould take v^eeks to reach equilibrium. Hov^ever, gravity w îll intervene and cause the particles to sediment to the bottom of the container. Conse quently, adenovirus solutions require greater agitation than protein solutions to disperse the particles evenly. The slov^ diffusion rate also complicates analytical methods. For example, the interaction betv^^een the virus and a cell takes much longer than protein-cell interactions because of the SIOVSA diffusion rate. Typical biological methods for quantifying particles depend on Brow^nian motion for bringing about virus-cell interaction. Without accounting for this slow diffusion, the titer of the material tested may be underestimated. This will be discussed in more detail below (see section III.B.2 of this chapter). 3. Capsid Surface The surface of the adenovirus capsid is of particular interest when select ing a separation technique since there are many binding methods available. The adenovirus capsid consists of 252 capsomeres. Two hundred and forty of these capsomeres are hexons and 12 are pentons. Hexons are trimers of protein II and are the main structural component of the capsid. Pentons, constructed from penton base and fiber proteins, are prominent features as these structures protrude and add to the hydrodynamic radius of the virus particle. In addi tion, protein Ilia and protein IX may also contribute to surface characteristics. Protein Ilia is essential and two of these proteins are found at the junction joining adjacent facets together like stitching. Protein IX is not essential for capsid assembly but enhances the stability of the virus at higher temperatures. Four protein IX trimers stabilize a group of nine hexons (ninemers) that have assembled into a facet [4]. The hexon, which comprises about 50% of the total virion protein, dominates the charge characteristics of the particle. Hexon capsomeres possess an isoelectric point (pi) near pH 6 [1]. At physiological pH, the capsomere would be expected to bear a negative charge. The complete adenovirus structure would also be expected to show a net anionic surface charge under physiological conditions. It is generally advisable to avoid exposing the proteins to solutions at or near the pi because many proteins change conformation, degrade, or precipitate when titrated through it. Ninemers, hexons, and complete virions precipitate from solution when titrating the solution from pH 7 to pH 5 [5, 6]. If the particle is titrated through the pi rapidly and further lowered, losses occur but active particles can be recovered from solutions such as acetic acid. The virus is also stable up to around pH 8; the exact threshold being dependent upon the composition of 1 7 0 Shabram ef al. the solution. Exposing particles to a pH greater than 8 generally leads to a loss of activity and particle disruption. 4. Hydration of the Adenovirus Particle The degree of hydration of the particle is an important consideration for both purification and stability of the adenovirus. Sedimentation by ultra- centrifugation using Schlieren optics [2] suggested that the adenovirus particle contains a "hard core" (w^ater excluded) w îth a diameter of 76 nm, similar to that obtained using negatively stained electron microscopy. The difference between the hard core diameter of 76 nm and the light scattering diameter of 98 nm is significant because it suggests that the particle contains w^ater. The amount of v^ater represented by the difference suggests that the virus particle contains 2.3 g of w^ater for every gram of virus [2]. These observations are consistent w îth measurements of other viruses [7, 8]. While proteins are stabilized by the incorporation of a feŵ w^ater molecules ('Vaters of hydration"), the amount of w^ater suggested by these studies is more than 21 million w^ater molecules per virion. This amount far exceeds water typically bound to proteins. This degree of hydration corre sponds to a theoretical density calculation of about 1.4 g/mL, which is very close to the observed density of 1.34 g/mL. The additional water should not be surprising since the virus exists in an aqueous environment. With these data in mind, however, the particle would be expected to show unique properties. The adenovirus particle is generally considered rigid. However, the degree of hydration suggests that a certain amount of flexibility should be considered. Since the particle is not encapsulated in a membrane small ions may have ready access to the core (see section IV). Changes in ionic strength may induce conformational changes in the capsid proteins; some of these may be beneficial for separation and some may be catastrophic. The particle may also be sensitive to rapid changes in salt concentrations. One might also predict that hydrophobic solvents should be avoided. B. Features of the Milieu Effective virus purification capitalizes on the differences between the physical properties of the adenovirus relative to the components of the mixture from which it is being isolated. The exact composition of the milieu varies with the cell culture process, and, to a lesser extent, every batch. In general, the large-scale purification of adenovirus requires the isolation of the virus from infected cell lysate taken from a bioreactor. This mixture consists of a formulated medium usually containing bovine serum, and less frequently antifoaming agents, or anti-clumping agents (pluronics). Significant amounts of additives, however, present difficult challenges for any recovery procedure. Efficient large-scale production requires high cell densities which in turn require 7. Purification of Adenovirus 1 7 1 high gas exchange rates. This can cause severe foaming and necessitate the addition of agents to control it. Other additives, such as anti-clumping agents and hpids, adapt the media for large-scale cell culture. Cell lysis, necessary to release the adenovirus from the host cell, results in the additional release of DNA, protein, lipids, carbohydrates, and other cellular components. Culture conditions, media components, cell derived contaminants, and additives may have a significant impact on dow^nstream processing. 1. Culture Conditions Adenoviruses are produced by infection of cell lines in culture w îth a viral seed stock. The particular cell line used requires a highly developed cell culture method to achieve maximum yield. Flat stock culture, although useful for small-scale work, is generally not sufficient for larger scale applications. Many of the cell lines used in flat stock culture have resisted attempts to adapt them to the suspension and serum free conditions preferred for large-scale processes. A compromise is struck by the culture of attachment-dependent cells using microcarriers in a bioreactor. This microcarrier-based process introduces yet another component that must be separated from the adenovirus. Similarly, if serum is utilized, it will be necessary to consider the effective removal of its components. 2. Construct Induced Contaminants and Considerations The viral construct may also contribute to the milieu as the viral DNA backbone may lead to the contribution of many more contaminants. For down stream purification, higher titers favor better recovery and cleaner preparations because recovery and purification is an enrichment process. Even with max imum productivity, however, adenoviral particles represent a small fraction of molecular entities produced by the end of the culture process. Therefore, factors affecting the end titer can also affect the process. The majority of adenoviral vectors for gene therapy are serotype 5 and have been rendered deficient for replication in most cells. With the exception of replication-competent adenoviruses, most vectors have been crippled to eliminate their replication in normal human cells. In general, when compared to wild-type virus, deletions or mutations in the early genes tend to attenuate viral replication in all cell lines. Attenuation for replication is typically achieved by large deletions in the immediate-early region El . These vectors require specialized packaging cell lines for efficient production. Cell lines such as HEK 293 [9] or PER.C6 [10] have been transformed with adenoviral DNA and provide sufficient El function in trans to enable replication. In addition to El deletions, many vectors possess deletions for much of the E3 region. The deleted E3 genes are considered nonessential for viral replication and these deletions allow for larger transgene packaging capacity. Other deletions have been made to reduce the frequency of recombination 1 7 2 Shabram ef o/. during culture. So-called "second generation" viruses may have additional early gene deletions (e.g., in E4) as w êll as a deletion of protein IX encoding sequences [11]. Elimination of certain essential genes from the virus requires that the cell line be able to complement these protein functions in trans to package the virus [12]. A significant unw^anted by-product of adenoviral replication is DNA. Wild-type human adenoviruses are able to replicate in a variety of both quiescent and proliferating human cells due to the function of adenoviral immediate-early genes. El a proteins can be observed within 1 h after infection, as cellular transcription factors are sufficient to transcribe the El a genes. El expression initiates the adenoviral life cycle by altering the cell cycle machinery to induce cellular DNA replication even in quiescent cells. Viral and cellular proteins activate subsequent viral transcription. New^ copies of viral DNA are synthesized and viral production proceeds in a replication cascade. By the end of viral DNA replication, a large amount of DNA is present in the infected cell. The purpose of a gene therapy vector is to convey a therapeutic effect by the delivery and expression of therapeutic genes. Many of these trans- genes have a significant effect on the cells and adenoviral life cycle. Some genes, such as the retinoblastoma protein and the cyclin-dependent kinase inhibitor p21 directly affect the levels of activated E2F. E2F is a cellular transcription factor that is necessary for the transactivation of the adenovi ral E2 promoter and thus the expression of viral DNA replication proteins. Other transgene products, such as proapoptotic proteins, can overcome the adenoviral block to apoptosis leading to early cell death and can interfere v^ith adenoviral particle assembly. Secreted pleiotropic transgene products, such as growth factors, can trigger undesired effects in the packaging cell and severely attenuate production. Before adenoviral DNA can be coated with viral core proteins, the DNA is available for transcription. In this way, some adenoviral genes, especially those encoding capsid components, are not expressed until DNA replication occurs [13]. During this phase, the expression of transgene product is enhanced by the replication cycle itself by expanding the copy number of the transgene with each copy becoming available for transcrip tion. Strong exogenous promoters may also sequester transcription factors and the cellular protein synthesis machinery can become clogged with transgene expression leading to attenuated adenoviral protein production. If the sequence of events leading to particle maturation is disturbed, even by an imbalance in protein production, large
quantities of viral proteins, incomplete particle assemblies, transgene products, abnormal cellular structures, and in some cases extreme amounts of extracellular proteins can be added to the milieu. These complications can significantly impede purification and add to the analytical requirements. 7. Purification of Adenovirus 1 7 3 C. Summary of Characteristics The attributes of the adenoviral particle, the culture process, components of the media and properties of the vector itself have significant impacts on the design of a purification process. Table I outlines the salient aspects of the particle and the lysate. II. Recovery and Purification of Adenoviral Particles Purification must take place in the context of a complicated lysate. Table II summarizes the key features of the adenovirus particle and suggests recovery techniques that may be employed. Together, the features of the particle and the milieu point to a sequence of process steps that yield purified adenovirus (Table I). Since the particles are produced in cells, the first recovery step is harvesting of the infected cells. The next step requires lysis of the cell to release the virus. The cell lysate contains cell debris so a clarification step is necessary to protect dov^nstream steps. A substantial amount of DNA is present and must be eliminated early in the process. The clarified lysate is too crude for high-resolution purification so an initial purification is needed. Once the preparation has been simplified by the initial purification, a fine separation step removes the remaining contamination. The purification may utilize salts or buffers that are undesirable for use in the clinic. These components may need to be exchanged for a final formulation. The follow^ing sections provide techniques to accomplish this sequence. A. Harvest Methods Cells grow^n and infected in large-scale flat stock culture eventually detach from the surface. Alternatively, trypsin may be used to detach cells before the onset of cytopathic effect (CPE). Cells free in the medium may be collected by centrifugation or filtration. Cells grow^n in suspension are also harvested in the same manner. Cells grow^n on microcarriers may be harvested by allow^ing the cells to settle so the spent medium can be decanted. Infected cells may be removed from the microcarriers by trypsinization or processed v^hile still on the carrier. Infected cells remain suspended and therefore can be decanted with the spent medium. In order to maximize the harvest yield, one should consider the point at vŝ hich harvest occurs. The life cycle of the adenovirus vŝ as thought to terminate at the time cytopathic effect (CPE) is observed. Analysis using AEHPLC (section III.F of this chapter), how^ever, demonstrated that the peak 174 Shabram ef aL Table I Properties of Adenoviral Particles Property Data Consideration Issues Diffusion 4.46 X 10-12 j^2/5 Filtration, • Slow diffusion rate may centrifugation. provide a means for chromatography, separation on filters and freezing, and chromatography resins. thawing • Centrifugation not counter acted by diffusion. Mixing will be problematic especially during freeze-thaw operations. • Slow diffusion may decrease concentration dependent aggregation. • Assays are hindered. Water High compared to Fragility, salt • Particle may be swelled with content proteins concentration, water. small ions, solvents. • High salt and solvents may freezing, and result in degradation. thawing • Sensitivity to shearing forces. Viral genome Viral, cellular, and Early gene alterations • Cell lysate may contain many alterations transgene and deletions incorrectly assembled expression overexpression of particles, adenoviral protein transgene products structures, and unusual cellular structures that are similar in size to adenoviral particles. Transgene product may be a contaminant which could confound potency assays. High titers result in less difficult purification Lysate Complex Contaminants Particle assay for crude materials. DNA, lipids, BSA, antifoaming agents, anti-clumping agents, and other contaminants may bind to the particle and co- purify or foul filters and resins. of particle production occurs before cells begin to detach. Figure 2 shows the particle count taken at various time points during a bioreactor process. In most bioreactor runs the particle concentration drops slightly from the peak, but in some cases the particle concentration falls to as low as 10% of the peak value 7. Purification of Adenovirus 175 Table II Physical Properties of Adenovirus Particles That Can Be Exploited for Purification Property Data Method Issues Density 1.34 g/mL Density gradient Classical method — small scale. uhra-centrifugation Size ~100 nm Fihration Some cell debris similar size, lipids, and cell culture additives may interfere. Size exclusion Particle larger than resin pore chromatography sizes. Could be used for buffer exchange. Surface Protein: ionic, Ion exchange, Scaleable methods employed for hydrophobic, hydrophobic protein purification. specific surface interaction, affinity Well established literature to chemistry chromatography predict behavior of cell culture hgand binding components. Particle size larger fihration than pore sizes. Aggregation may occur. Reversed-phase Solvents may be problematic. chromatography, solvent extraction in just a few hours. This phenomenon underscores the need to monitor the process carefully to obtain maximum yield. B. Lysis Methods Following recovery of the infected cells, the adenovirus must be released from the cell. This is accomplished by lysing the cell. There are many methods available for both large- and small-scale cell lysis. The most useful of these methods are discussed below. 1. Freeze-Thaw Cells burdened with a full viral load are fragile and easily disrupted. Freezing and thawing the infected cells achieves the release of virus. This method is attractive at small scale because it does not require specialized equipment. It is less attractive at large scale because the freezing and thawing of a large sample is difficult to control. Consequently other methods are preferred for large scale. The freeze-thaw lysis method requires that one observe how the solution freezes and how it thaws. During the freezing process, solutes, such as salts, proteins, and free viral particles, depress the freezing point of the solution. 176 S h a b r a m ef al. 40000 35000 30000 25000 C/3 20000 u 15000 10000 H 5000 A Hours Post Infection Figure 2 Adenoviral particle production can be followed using anion-exchange high-performance liquid chromatography (HPLC) as discussed in section III.F. The per cell productivity was monitored during a 5 L bioreactor run with a replication deficient type 5 adenovirus grown in HEK 293 cells. The completion of particle production occurs before obvious signs of cytopathic effects are manifested. Small ice crystals of pure water begin to form. The solutes excluded from the ice tend to concentrate in spaces between the ice crystals. These areas of concentrated solutes experience freezing point depression. If the freezing process is too slow, the virus may be found in highly concentrated bands. Once the thawing process begins, low-molecular-weight solutes are free to diffuse away rapidly, but adenovirus particles remain roughly in the same place, owing to their large size and slow diffusion constant. Given that nearly all proteins precipitate from solution at a critical concentration, one would expect that the virus particle would also be similarly limited. At temperatures above 0°C, frequent collisions among particles lead to an aggregation cascade. While freeze-thaw releases more than 90% of the virus in three cycles under favorable conditions, improper control may lead to greater than 50% loss. Consideration for damage and loss of the particles represents the greatest concern. Damage may not be obvious at first when a structure as large as a virus is involved; rather, damage suffered during early recovery steps may manifest itself as reduced stability of the purified virus. Particles are packed into the cell in a tight array; once released the viral particle can aggregate. Collisions leading to aggregation in the cell may be limited by mediating proteins, which impede movement and hold the particle in the soluble array. 7 . Purif ication of Adenov i rus 177 The control of pH and salt concentration is also critical for freeze-thaw. Some buffers such as phosphate do not maintain buffering capacity when the solution freezes. This may be because sodium phosphates precipitate at low temperature. 2. Homogenization A useful method for cell disruption used for recovery of recombinant proteins involves passage of bacterial or yeast cells through a small orifice under pressures up to 20,000 psi. Upon passage through the orifice, the cells expand and rupture as they experience a sudden drop in pressure. The French press has been used for this purpose at laboratory scale for many years [14]. Large-scale processing using this principle may be accomplished using a Gaulin homogenizer (APV Gaulin, Wilmington, MA). Lysis of infected mammalian cells can also be achieved using a similar device. However, at the pressures under which this method is normally used to rupture bacterial cells viral loss is observed. To protect the virus the pressures must be minimized. Figure 3 illustrates this affect by comparing the recovery of adenovirus particles after lysis at different fluidization pressures in a microfluidizer. \fV - • • 80 - u > • O QJ 60 - Pi u 40 - • PH 20 - • 0 - 1 1 1 1 ! 1000 2000 3000 4000 5000 6000 Microfluidizer Pressure (psi) Figure 3 Methods to lyse infected cells vary from repeated cycles of freezing and thawing to microfluidization. The cell can be lysed by a sudden pressure drop generated by several different means. This experiment used anion-exchange HPLC to measure the recovery of particles over a range of pressures in a microfluidizer. Samples were also submitted for titer and showed the same trend. Particle recovery declines at differential pressures above 600 psi. Similar results were obtained using a nitrogen bomb apparatus (data not shown). 178 Shabram ef al. 3. Sonication Sonication is widely used for breaking small quantities of cells for research [14] because it is rapid and convenient for small samples. This method results in excellent release of virus from infected cells. Disadvantages of this method include the generation of heat, production of free radicals, and attendant chemical damage, as well as the lack of equipment suitable for large-scale applications. 4. Simultaneous Harvest and Lysis Using a Continuous Flow Centrifuge Bacterial and yeast cells can be readily harvested at large scale by the use of continuous flow centrifuges. The use of these devices to harvest intact mammalian cells is less certain. These centrifuges are configured to concentrate and harvest cells by different means. To aid in the separation these centrifuges often are fitted with a series of conical discs inside the rotor. All systems expose the cells and liquid to a centrifugal field allowing the cells to be concentrated in the interior of a hollow rotor. Supernatant, which has a lower buoyant density, flows out of the rotor. The "pellet," which remains liquid, either collects in the rotor, exits through restrictions on the outer edge of the rotor, or is ejected in a discharge cycle as the rotor opens. This third method is to briefly open the rotor on the outer edge while it is spinning. If the rotor is opened for just a fraction of a second, the pellet is discharged and little supernatant is lost. Generally, these centrifuges develop between 10,000 and 20,000 g. Fragile cells, such as mammalian cells, are particularly at risk of lysis in both the discharge and nozzle-type disc stack machines because of the shear forces and rapid pressure changes. For the same reason these systems are ideal for large-scale concentration and lysis of infected cells [15]. Shear from the rotating discs provide some cellular disruption and the rapid pressure drop from discharge finishes the job. The resulting lysate may be further clarified. 5. Lysis during Filtration Another method used for lysis is cross-flow filtration. Cross-flow filtra tion, also known as tangential-flow filtration, separates particles in solution by passing the solution along the surface of a membrane. Liquid passes through the membrane because of the pressure differential across the membrane. Par ticles and solutes are retained if they are larger than the "cutoff size" of the membrane. Cross-flow systems are configured to allow for recirculation of material along the membrane surface. In this way, larger components are retained (retentate) and smaller components are collected in the passed liq uid (permeate). Membranes may be configured in flat plate, spiral wound, or hollow fiber systems. Cutoff sizes vary from particles visible to the eye down to molecules as small as 300 molecular weight. A typical clarification operation can be achieved by using either a 0.45- or a 0.2-^im nominal cutoff 7.
Purification of Adenovirus 1 7 9 size. Infected cells in this system are exposed to both shear and rapid pressure drops. The advantage of these systems is that the viral particles, w^hich are slightly less than 0.1 \|xm in diameter, are not allowed to traverse the filter until they have been released from the cell. Cellular debris is retained and therefore separated from the virus. C. Clarification The lysis procedure releases the virus from the packed array inside the cell into the medium. All procedures produce cell debris, which must be removed before purification. A common procedure for lysis includes concentration of the intact cells followed by lysis. This method works well at the laboratory scale and may be necessary for production with viral vectors that exhibit poor per cell productivity. With optimized culture methods overconcentration becomes a concern. Highly concentrated lysates exhibit significant losses during lysis and clarification. The loss seems to be associated with aggregation of the virus particle. 1. Centrifugation Centrifugation at low relative centrifugal force (RCF, ~1000g-min.) is sufficient for cell debris removal. Centrifugation in a swinging bucket centrifuge is a common method and can be efficient for volumes below 5 L. The disadvantages include performing this operation using an aseptic technique and the possible generation of an aerosol of virus particles. Centrifugation at higher RCF can lead to the loss of virus. Figure 4 shows relative yield loss over time of particles after centrifugation for 5 min at increasing RCF. 2. Filtration Filtration is another clarification method. Either cross-flow filtration or dead end single-pass filtration can be used to remove debris [16]. A study employing a variety of membranes with varying compositions is necessary for optimizing yield. Some membrane materials bind proteins and may also bind adenovirus. Membranes composed of polyethersulfone possess low protein binding characteristics. Adenovirus will pass through these membranes with excellent yields if the concentration of the adenoviral particles is kept below 5 X 10^^ particles/mL. Most filters are rated by their performance in passing dyes or particles of standard sizes. Flowever, manufacturers generate membrane pores in different ways. Some membranes possess pore sizes similar to the cutoff size; while most possess pores much larger than the cutoff. These types of membranes rely on the torturous path the solute must follow to get through the membrane. Proteins and other contaminants can interfere with filtration by forming a barrier that effectively reduces the pore size. Adenovirus can be filtered through some 180 Shabram ef aL 00 - • • • o 90 - • 80 - 4> • 70 - 60 - • 50 - 1 1 r- 1 1 - I 1 1 2000 4000 6000 8000 10000 12000 14000 16000 18000 RCF Figure 4 The density of adenoviral particles is significantly higher than most lysate components. Samples of infected cell lystate were spun in an Eppendorf Microfuge model 5415c at 4°C for 5 min at different speeds. Recovery of particles was measured using anion-exchange HPLC. Yields were plotted against relative centrifugal force (RCF). Particle loss occurred when the sample was subject to RCF greater than 3000 g min. 0.22-\|xm membranes with better than 90% yield; but the membrane must be selected by experimentation. Fortunately, adenoviral preparations may be sterilized by 0.22-\|xm filtration with filters available from many manufacturers such as Millipore, Gelman, or Sartorius. 3. Expanded Bed Chromatography Expanded bed chromatography removes cell debris using an upward- flowing chromatography column partially filled with large or dense beads [17-19]. "Expanded bed" differs from "fluidized bed" in that the suspended bed is stabilized by a gradient of bead densities so that mixing is minimized. Resin of this type is available from Pharmacia (Piscataway, NJ). In this mode of operation, the column is fed from the bottom at a flow rate sufficient to suspend the beads throughout the column but not cause the resin to pack at the top. Supernatant exits through the top frit. After absorption of the entire volume to be clarified, the direction of flow reverses and the column is packed, washed, and eluted. The main advantage of this technique is that it accomplishes debris removal and column chromatography in one unit operation. Drawbacks include the need for a special column and a special resin, limiting flexibility. The flow rate for loading the column is restricted to 7. Purification of Adenovirus 181 a rather narrow range by the requirements to keep the bed suspended but not packed at the top of the column. 4. Digestion of DNA Lysis releases a large amount of DNA in both large and small fragments. Some of the DNA associates with DNA binding proteins and are found in large structures. DNA (and RNA) digestion is necessary because this con taminant promotes aggregation and complicates downstream processing. The adenovirus particle possesses sufficient surface area that significant amounts of DNA bind to the capsid in spite of the anionic surface charge of the particle. Much of this DNA is viral and if not separated can be taken up by the target cell causing abnormal replication. In some cases, El can be cotrans- fected with an El-deficient particle and can give rise to the generation of replication-competent adenovirus. Consequently, it is important to eliminate as much of the exogenous DNA as is practical. Fortunately, nucleases such as Benzonase (Merck KGaA, Darmstadt, Germany) are available in highly pure forms able to digest the majority of the complicating nucleic acids. The enzymes function best at 37°C near pH 7 in the presence of magnesium ion. The salt concentration is also critical as high salt inhibits the enzymes. Aggregation of the adenovirus, which depends upon collisions, occurs more rapidly at warmer temperatures, while the enzymes function poorly below 15°C. The lysate must be cleared of debris since the quantity of host cell and free viral DNA competes for enzyme and results in incomplete digestion. A compromise is to perform a modest clarification (see above), adjust the salt concentration by dilution, buffer the solution to maintain physiological pH, add magnesium ion, and then perform the digestion at room temperature. The final concentration of nuclease can be increased to accelerate the process. D. Purification Once the clarified lysate is free of exogenous DNA, substantial purifi cation can proceed by a variety of techniques. At small scale both chromato graphic or density gradient centrifugation methods are effective. Large scale, however, favors chromatography. 1. Ultracentrifugation Meselson et al. [20] presented a new method of determining the molecular weight and partial specific volume of macromolecules by density gradient centrifugation. This technique has been particularly useful for macromolecules such as DNA and viruses. Salts, such as CS2SO4 and CsCl, form density gradients when subjected to a strong centrifugal field. Macromolecules separate from contaminates on the basis of their respective buoyant densities and collect in bands at their own density if the sample is centrifuged to equilibrium. 1 8 2 Shabram ef a/. Adenoviruses can be purified using this technique since the buoyant density of the particles is approximately 1.34 g/mL. A typical purification scheme is a three-step process where the infected cell is lysed and the DNA is digested. The sample is then applied to a step gradient of CsCl in a tube where the density of the bottom layer of CsCl is around 1.4 g/mL and that of the top layer is around 1.25 g/mL (both layers are buffered with Tris to approximately pH 8). After spinning at approximately 150,000 g for 1-2 h, the virus separates from cellular debris and collects in a band between the CsCl layers. The band is collected by puncturing the tube and drawing the material out with a syringe. This collected band is then mixed with CsCl at 1.35 g/mL, placed in a centrifuge tube and subjected to 200,000 g overnight. The intact virus separates from DNA, proteins, and defective particles and is collected as before. CsCl is then removed by dialysis. This method is easy to perform and yields high-purity virus preparations. Unfortunately, the process time required is long, CsCl must be removed from the final product, and specialized equipment is required. The main disadvantage is that this process cannot be performed at the large scales demanded for pivotal clinical trial or market use. 2. Purification by Chromatography Column chromatography is by far the most versatile and powerful method for purification of viruses. The methods described above serve to prepare the viral preparation for chromatography by freeing it from cells, cell debris, and interfering substances. The clarified lysate must be in a buffer suitable for application to a chromatography column. Modes of chromatography applica ble to viruses include ion exchange, reversed phase, hydrophobic interaction, size exclusion (gel filtration), immobilized metal chelate, affinity, etc. For each mode, one could choose from many commercially available resins and mobile phases. The selection of an optimal sequence of chromatography steps has been made easier by commercial instruments that are able to perform a sys tematic search of columns and gradient conditions. Books and review articles describe these modes of chromatography and offer strategies for selecting the best combination [21-27]. Specific purification methods for adenoviruses are also found in the literature [28]. Fundamental differences distinguish analytical and preparative chro matography [29]. Analytical runs are performed by injecting a small amount of sample onto a column with high resolving power. Such columns typically have very small particle size beads (3-10 \|xm), high theoretical plate numbers, and rapid run times under high pressure. The result of the run is judged by the appearance of the chromatogram; that is, the peaks should be symmetrical, narrow, and well resolved. Preparative runs, in contrast, are carried out by applying a large sample load (usually near the maximum for the column) using columns of 1 to 500-L bed volume packed with larger beads (20-90 \|xm 7. Purification of Adenovirus 1 8 3 or larger). The cost of the packing becomes more significant for such large columns. The result of the preparative run is measured by the ability to recover pure fractions from the column with high yield. This means that an analytical technique is needed to judge purity and yield of the fractions. Anion exchange HPLC and reversed-phase HPLC [30-32] serve as the tv^o most pow^erful analytical techniques (see section III of this chapter). Without such information, the outcome of a preparative separation is not known because the chromatograms for many preparative separations are complex and difficult to interpret. Method scouting is conveniently done on small columns in high-pressure systems (HPLC, FPLC) in order to speed development and conserve material. Media with smaller bead sizes may be used provided larger bead sizes are also available. Preliminary screening should identify two modes of chromatography able to resolve the virus of interest from the contaminants. The first column step usually employs a resin with high binding capacity and/or high selectivity for the product; otherwise, a very large column may be needed. Anion exchange chromatography is often selected as the first step. Adenoviruses do not adsorb to cation exchange resins at physiological pH; but this type of resin may be used as a first step. While the adenovirus passes through cation exchange columns, some protein contaminants will be removed from the viral solution. For aden ovirus, this method is not needed. Resins for each step are then selected based on resolution, recovery, speed and cost, and possibly other factors such as freedom from extractable materials and availability of documentation required for the production of clinical material for human trials under current Good Manufacturing Practices (cGMP, Part 21CFR). The mobile phase is selected and the gradient optimized. Sample volume and concentration influence resolu tion in column chromatography so both of these parameters must be optimized as well. All of this work can be done on relatively small columns. The product produced at a small-scale should meet all of the purity requirements desired for the final product. Scale-up of chromatography steps is performed by maintaining the media bed height and linear flow rate of the mobile phase while increasing the cross- sectional area (hence column volume) of the column. Fine-tuning the process is usually done at the production scale; only minor adjustments should be needed. Column packing instructions depend on the particle size and nature of the resin [25]. The resin manufacturer's instructions should be followed and then checked by measuring theoretical plates, w,
for the column with acetone (UV detection) or sodium acetate or sodium chloride (conductivity detection). The theoretical plate number can be measured from the chromatogram by the formula [29] 1 8 4 Shabram et al. where t is the retention time and Wi/2 is the width of the peak at half of its maximum height. Sometimes the width is measured at the basehne. In this case, the constant in the equation changes from 5.54 to 16. The plate number increases with column length. Often it is useful to correct the plate number of column length, yielding a parameter known as "height equivalent theoretical plate" (HETP), given by H E T P ^ ^ . N These parameters offer a simple way to monitor column performance over time. Care should be taken to avoid introducing air into the column because air pockets degrade performance and may necessitate repacking of the column. Columns should be cleaned after use and stored in a suitable bacteriostatic environment [25] following the manufacturer's directions. Most process resins can be cleaned and sanitized with sodium hydroxide solutions in the range of 0.1-1 N (exception: silica-based materials dissolve at alkaline pH). a. Ion-Exchange Chromatography of Adenovirus Ion-exchange chro matography offers a powerful method for adenoviral fractionation because of its high capacity and resolution. Ion-exchange chromatography exploits the charge that proteins carry on their surface. The net charge of these groups varies with pH and the amino acids exposed in the protein surface [27, 33]. Adenoviral capsids are highly anionic in nature making anion exchange ideal for purifying them. Anion exchange resins carry positively charged groups such as diethylaminoethyl (DEAE) or quaternary amino ethyl (QAE), which bind anionic proteins in a manner that depends on pH. Elution may also be accomplished by changing pH to eliminate the ionic interaction with the protein. For proteins, it is helpful to know both the isoelectric point of interest and how the protein charge varies with pH. These properties can be measured by isoelectric focusing and electrophoretic titration [25]. Good binding and elution characteristics are often obtained about 1-1.5 pH units above the iso electric point for anion exchange or an equal increment below the isoelectric point for cation exchange. The predominate capsid protein is the hexon which possesses an isoelec tric point near pH 6. As mentioned above, the particle is only stable in a narrow pH range near pH 7. Ion exchange resins also bind protons (cation exchange) or hydroxyl ions (anion exchange). Increasing salt concentration may lead to large changes in pH because salt competes with protons or hydroxyl ions for binding sites on the resin. One should be alert to the possibility of pH changes, possibly as much as one pH unit during chromatography. Maintaining the pH with the correct buffer at sufficient concentration is important for stabilizing the pH during elution. Several ion exchange resins should be tested for binding capacity and resolution at a constant flow rate because resins with the same functional 7. Purification of Adenovirus 1 8 5 group may differ considerably in these properties owing to differences in their backbone, density of substitution, or other factors. After selection of the resin and mobile phase the other critical parameters can be optimized: sample load and volume, flow rates for absorption and elution, and elution gradient. Hexon is a noncovalent trimer that is anionic at pH 7. The capsid is composed of 240 of these capsomeres and gives the particle a large number of negative charges on the surface at neutral pH. Proteins bind to ion exchange resins in low salt (5-50 mM NaCl) and elute with high salt (0.1-1 M). Concerted binding of capsomeres in the capsid to the resin allows the particle to adsorb at higher salt concentrations than those used to elute endotoxins and most proteins. This allows easy separation of viral particles from proteins. Most chromatographic resins are optimized for different classes of ligands by making the resin particle with various pore sizes. Proteins and other ligands have access to a substantial amount of resin surface area inside the pores. Adenoviral particles do not have access and are limited to the outer surface of the resin. Large fragments of DNA, however, are also highly anionic but with a higher charge density. Consequently, DNA elutes at higher salt concentrations than adenovirus. These properties result in an order of binding and elution for the constituents of a clarified lysate. At buffered salt concentrations as high as 350 mM NaCl, the particle binds to the column while nearly no free proteins bind under these conditions. Large DNA-protein complexes such as incorrectly assembled particles and some cellular structures bind under these conditions. DNA binds tightly. Using a linear salt gradient the order of elution will generally be proteins first, followed by complex contaminants, viral particles, other cellular-derived structures, and, last, DNA that has escaped digestion. The elution of these components results in excellent separation between peaks (Fig. 5). Purification yields are as great as 99% but can be lower if the peak must be trimmed to improve purity. b. Immobilized Metal Afftnity Chromatography of Adenovirus In 1975, Porath showed that metal ions could be linked to a column in a 1:1 com plex with a chelating ligand, iminodiacetic acid, bound to the column 134, 35]. These columns had unique properties for fractionation and provide orthogonal methods for purification. This technique is referred to as "immobilized metal affinity chromatography" or IMAC. Beaded agarose is the most common sup port and iminodiacetic acid remains the most popular chelating ligand. Such columns can be charged with a variety of divalent metal ions, Zn^^ and Cu^^ being preferred for protein chromatography 136]. Adenovirus particles bind readily to Zn^+ charged resin, whereas Cu^+ is not as efficient. Excess metal ion is removed by washing before applying protein. Bound metal ion forms a coordination complex, leaving some coordination sites free to interact with proteins. Protein binding typically occurs through histidine residues [23, 36], which occupy the free coordination sites. However, coordination with epsilon 186 Shabram ef a/. 15 Column Volume Figure 5 Anion exchange chromatography is the most robust method to recover and purify adenoviral particles from crude stocks. Monitoring the optical density at 280 and 260 nm allows the chromatographer to easily recognize the fractions containing adenovirus by taking a ratio of A260 ^o A280- The ratio for pure virus is around 1.25. The chromatogram above is plotted as the optical density vs the number of column volumes of materials that have been pumped through the column. In this example, DEAE Fractogel 650 M (EM Sciences) was used. The column was buffered in 50 mM Hepes, pH 7.5, at room temperature throughout the process. Infected cell lysate was loaded onto the column with an adjusted salt concentration of approximately 350 mM NaCl. The load produced significant absorbance as the majority of contaminants passed through the column. More contaminants were eluted during a post loading wash with equilibration buffer. Elution was with a linear salt gradient from 350 to 600 mM NaCl. The adenovirus peak is well resolved at the end of the chromatogram. The approximate salt concentration of the collected peak was about 450 mM NaCl. Column cleaning was achieved with 1 M NaCl and 0.5 N NaOH (data not shown). The column height for this chromatography was about 5 cm. The chromatography looks the same, however at 10 cm bed height. Scale up produces the same chromatogram if the column diameter is increased using the same bed height and the flow rate is adjusted accordingly. amino groups is also probable. Elution can be achieved either by changing pH or by adding competitors such as imidazole or glycine, for the binding sites. Ethylenediaminetetraacetic acid (EDTA) can be used to elute the column, as EDTA strips the metal from the column and the protein. IMAC works well as a polishing step for purification since it removes residual host cell contaminants. Since IMAC can be operated in high salt conditions, fractions from an initial recovery column, such as anion exchange eluate, can be loaded directly on the equilibrated and charged column. The 7 . Purif ication of Adenov i rus 187 buffer selected must not strongly chelate metals, of course. The yields typically fall in the range of 60-80% and the purity is greater than with CsCl ultra- centrifugation methods. Figure 6 shows a chromatogram of adenovirus type 5 purified with zinc charged IMAC and eluted with a step gradient of glycine. Modifications to the fiber can also affect the chromatography. Inter estingly, "fiberless" adenovirus, vectors that have been altered to express truncated fiber protein, bind normally to anion exchange resin, but do not bind at all to IMAC charged with zinc. Presumably the residues serving as zinc binding sites have been removed from the surface of the fiber by muta tion. Alternatively, the adenovirus fiber can be engineered to provide histidine repeats that will bind to Ni^+ very effectively [37]. c. Reversed-Phase Chromatography Reversed-phase HPLC can be used for analysis of adenovirus particles or as a polishing step after initial purification 0.35 Adenovirus 0.30 0.25 0.20 •^ 0.15 O 0.10 0.05 Contaminants 0.00 I 4 6 10 Column Volume Figure 6 High-resolution techniques, such as zinc metal affinity chromatography are needed to complete the purification of adenoviral particles. TosoHaas AF chelate 650 M immobilized metal affinity resin was charged with divalent zinc. The column was equilibrated at room temperature with 450 mM NaCi in 50 mM Hepes at pH 7.5. DEAE adenovirus fractions (Fig. 5) were loaded onto the column followed by a wash with equilibration buffer. Remaining contaminants eluted from the column during the load and wash. The adenovirus was eluted from the column with a 500 mM glycine step gradient. After elution, the column was stripped with EDTA followed by 1 M NaCi then 0.5 N NaOH (data not shown). 1 8 8 Shabram ef o/. by anion exchange chromatography. The recoveries for the preparative method run in the range of 20%, which is poor compared to other methods. The lower recovery may be related to the presence of organic solvents in the mobile phase as high-molecular-weight proteins tend to denature or precipitate. Recoveries may be improved through careful selection of column, solvent, ion-pairing agent, and pH. d. Hydrophobic Interaction Chromatography of Adenovirus The dis covery of hydrophobic interaction chromatography (HIC) resulted from an attempt to make affinity columns [38]. This fortunate accident uncovered a unique mode of protein chromatography. On the surface, HIC resembles reversed-phase chromatography [27, 39, 40] in that the protein binds to the column through hydrophobic interactions in an aqueous solvent. Both resin types consist of a stationary phase with a hydrophobic surface. There after, the two techniques diverge [23]. HIC resins are typically constructed from polysaccharide or polymeric material. Reversed-phase resins are typically bonded silicas. HIC resins have a lower density of substitution and they tend to be less hydrophobic than reversed-phase media. Typically, the conformational changes are driven by high salts (such as ammonium sulfate). The salt presents an ionic environment that is favorable to hydrophilic surfaces. Hydrophobic surfaces are driven together so that exposure to the environment is reduced. In this way, the proteins are partially "salted out" and adsorb to the resin. The use of ammonium sulfate is relatively gentle because most proteins are stabilized in the presence of high concentra tions of ammonium sulfate. High salt, however, may destabilize the particle (see section IV, below), possibly because of its high water content or because the capsid proteins are twisted into destabilized conformations. The loading material may be adjusted to high salt prior to application to the column. Alter natively, small amounts may be applied to the column repeatedly, washing with equilibration buffer, or the material could also be diluted in equilibration buffer inline with the load. The advantage of the two later methods is that protein precipitation occurs slowly from the time of salt addition. Limiting the time of exposure to high salt may improve the chromatography and mitigate yield loss. Elution is achieved by reducing the salt concentration with a reverse gradient. With the exception of the direction of the gradient, HIC columns are optimized and operated along the same lines as ion exchange columns. Resi dence time on the column should be minimized because of the possibility
of denaturation [23]. Yields of virus from this type of chromatography typically range between 20 and 60%. e. Size-Exclusion Chromatography (SEC) of Adenovirus Size exclu sion, also called gel filtration or gel permeation, is the only mode of 7. Purification of Adenovirus 1 8 9 chromatography that is not intended to involve binding of proteins to the resin [41, 42]. The pore structure of the resin provides a molecular sieve, w^here smaller molecules can access the entire volume of the pores and large molecules are excluded from the pores. If a mixture of proteins differing in size is applied to a size exclusion column, the largest proteins v îll emerge first and smallest last. Molecules above a certain size do not penetrate the pores at all. Normally, these are the first to elute from the column; the volume at which they elute is termed the "excluded volume." Adenovirus particles, perhaps owning to the slow rate of diffusion may not elute in the excluded volume of the column. Instead, the particles may elute as much as a column volume beyond the excluded volume. Late elution from SEC often results from charge interactions between the sample and the column. This effect may be reversed by raising salt concentration. Similarly, molecules below a certain size all elute at the "included volume." All other species elute between the excluded volume and the included volume. This property limits the resolving power of size-exclusion chromatog raphy because the number of peaks that can fit into the volume allowed is small. A further limitation of size exclusion chromatography is that resolution deteriorates if sample volume exceeds 4 - 5 % of the bed volume of the col umn. Another limitation is that resolution deteriorates with increasing sample viscosity. The maximum protein concentration allowing good resolution is usually in the range of 5-10 mg/mL protein. Taken together, these two factors mean that a size exclusion column has 1-5% as much protein capacity as an ion-exchange column of the same size! Hence, size exclusion has limited utility for purifying adenoviral particles or proteins and is usually reserved as a last step. Sample load volume, maximum protein concentration and flow rate should be determined by experiment. Careful column packing technique is critical for good results. Plate number should be measured for a new column and at regular intervals during use. Despite these limitations, size-exclusion chromatography has an important place in the arsenal. It is gentle and rapid so yields are nearly quantitative. Additionally, it provides an opportunity to exchange the buffer to the desired formulation because SEC is compatible with a wide range of aqueous buffers. E. Buffer Exchange Every process confronts the problems of removing low-MW species and/or concentrating the desired fractions. Dialysis [43-45] or gel filtration (section II.D.l.e, above) may be used to remove small molecules or exchange buffers when the sample volume is in the range of 1 L or less. Several types of ultrafiltration devices are available for concentration of proteins on a laboratory scale, including pressurized stirred cells and filters driven by centrifugal force or other means. 1 9 0 Shabram et al. Concentration of protein solutions at a process scale is usually done by ultrafiltration using a tangential flow filter [16, 27, 46], Buffer exchange and removal of low-MW species are usually done by diafiltration; both concentration and diafiltration may be done on the same device and combined as a unit operation. Diafiltration is more efficient than dialysis in that less buffer and less time is needed to achieve a given level of solute removal. The concentration of solute remaining in the retentate after 5 vol of continuous diafiltration is given by [47] w^here a represents the rejection of the solute by the membrane. For solutes freely permeable to the membrane, a = 0. Under these conditions, diafiltration with 3 vol of buffer reduces the concentration of solute by 95%. In contrast, 20 vol of buffer would be required for the same result by standard dialysis. In either case, buffer exchange of viral particles can be achieved. Care must be taken to avoid foaming or excessive shear. Special attention should be devoted to pH control. The process should be monitored to avoid overconcentration and possible loss of product through precipitation. III. Analytical Methods for Process Development and Process Tracking Analytical methods are as important for purification as the process steps themselves. Analytical methods are essential for following the process and assessing the purity of adenovirus particles throughout the process. The methods must be rapid, reliable, and informative about the quantity and quality of adenovirus particles. They should be sensitive enough to detect subtle changes. As with the process techniques, characteristics of the virus are useful for selecting analytical techniques. In this section we have highlighted several assays not only because their usefulness for a process, but because an understanding of what these assays mean is critical in producing vector with the quality required for use in humans. A. Plaque-Forming Titer Assays Plaque forming assays have been in use as biological assays since early in the 20th century. A common method for many viruses, this type of assay has been employed with adenovirus since they were discovered. The plaque assay is performed using many variations but generally consists of diluting the virus preparation to a point that a thin layer placed over sensitive cells will result in a countable number of infection events. This is usually accomplished in a petri dish or in six-well plates. Once cells have been exposed, the viral 7. Purification of Adenovirus 1 9 1 solution is removed and a layer of warm agar applied on top of the cells. After 1 to 2 weeks of incubation, the cells are stained with a dye, such as neutral red, and plaques of lysed cells become visible. It is assumed that because of the extreme dilution, each plaque is the result of a single viral particle infecting a cell. The plaque arises following the replication of that viral particle and subsequent infection of adjacent cells by virus progeny. The number of plaques in a well divided by the inoculum volume and corrected for dilution yields a titer. This method is simple but relatively insensitive. If the cells are robust, the inoculum layer may be very thin and the exposure reasonably long. The slow diffusion rate of the particle and the formation of a meniscus in the well limit the method to sampling about 10% of the virions in a sample. B. Adenovirus 96-Well Titer Plate Assay A convenient method for estimating adenoviral titers uses cells (of an appropriate cell line) in the wells of a 96-well plates. The cells are plated such that they reach 50% confluence after 1 day of growth. The sample is then diluted so that the final particle concentration falls between 5 and 1000 particles/mL. Several different dilutions are prepared. It is best to perform an initial dilution in the original sample tube using the whole sample because the freeze-thaw process concentrates the virus into bands that will not disperse without substantial mixing. The largest error in dilution usually occurs with this first dilution. The initial dilution should be limited so that the concentration after the initial dilution can be verified using a particle assay. Thereafter, dilution of the sample is not problematic. To infect the cells the entire medium is first removed from the seeded wells. Each different dilution of virus is pipetted into at least 10 wells per dilution. When using a diffusion-adjusted calculation (see section III.2, below) the wells should be filled to the top. It is common in practice, however, to inoculate 100-200 \|xL of medium with 10-50 \|xL microliters of virus solution. For diffusion-corrected calculation the infection time is limited to 1 h or less (15 min is convenient) and then the virus solution is replaced with medium. For methods using Spearman-Karber titer calculations, such as the Lynn Titerpint analysis [48], analysts typically leave the virus solution on the plate for the duration of the assay. Incubation of cells takes place at 37°C, 7-10% CO2, 90-100% humidity for varying times depending on the method of detection. One method is to fix the cells after 3 to 5 days with methanol and acetone followed by staining with a FITC-conjugated anti-adenovirus antibody. This method of detection requires microscopic examination of each well under ultraviolet light. A well is counted if one or more fluorescent cells as positive. If cytopathic effect is used for detection, 1 to 2 weeks of incubation will be required. The dilutions that produce fewer than 100% positive wells are used in the titer calculations. 1 9 2 Shabram ef al. 1. Spearman - Karber Analysis Spearman-Karber analysis, based on Finney [49], essentially converts data such that graphing the data as log dilution vurses positive v^ells approaches a straight line. Spearman-Karber performs an interpolation to a midpoint. Thus, Spearman-Karber gives a log dilution w^here 50% of the v^ells v^ould have been positive. Titer is expressed as a negative log of the dilution. The Lynn program transforms the number by taking the reciprocal of the dilution (10 raised to the powder of the Spearman-Karber number) and divides by the inoculum amount ostensibly to get the inoculum concentration. How^ever, this value is expressed as ED50 (or TCID50) per milliliter and is often substituted for a virus concentration. This assumes that everything that was put into the well is measured by the assay and the fact that positive wells follow a Poisson distribution is ignored. A more appropriate analysis accepts the Poisson distribution in that even if the average number of virions per well is one, not every well would get a virion; but the Poisson distribution is applicable for this kind of assay. The Poisson distribution is given by where p is probability or fraction of positive wells, S is the event density or average virion per well, and r is the number of virion in a particular well. For the number of wells that get zero particles, r = 0, Ŝ = 1, and r! = 1 so the fraction of positive wells is given by 1 — e~^. The Spearman-Karber analysis gives us a convenient way to take all the data into account, calculate a standard error, and then apply the Poisson distribution to get a concentration. Since the value obtained gives the dilution where the fraction of positive wells is 0.5, p = 0.5. Solving for S yields S = 0.69 virion per well. This is always the case when 50% of the wells are positive. If, for example, the inoculum were 50 \|xL, then the concentration of the inoculum would be 13.8 particles per milliliters. Using the dilution obtained by the Spearman-Karber number the original concentration can be calculated. As in the plaque assay, the key assumption is that no virion in a well escapes detection. In the time frame of these assays, this is clearly not possible. A more precise analysis must take into account Brownian motion (diffusion). 2. Diffusion-Normalized Calculation In the older animal virus literature the methodology used for measuring infectious titer was simple: a thin-layer of a viral preparation was placed over the target cells for as long as practical. It was intuitively understood that the infection process was diffusion limited. This methodology would help minimize underrepresenting the titer. Done properly, these assays may underestimate by 10 to 100-fold; but the values obtained in a given experiment were useful in a relative sense. However, many of the cells used for replication-deficient 7. Purification of Adenovirus 1 9 3 adenoviruses cannot be maintained with very lov^ media levels. Unfortunately, the adenoviral particle, or any particle of similar size, diffuses very slov^ly in solution. Adding more media mitigated the sensitivity of the cells, but resulted in substantially greater underestimations of titer. This is because the probability of infecting a given cell is dependent on the concentration of the virus and the time of exposure. The discrepancy between adenoviral titers and the more precise particle assays (see below) has furthered the concept of particle to infectious unit ratio, or PIU. In the case of adenoviral vectors, this concept is based on the supposition that, in a population of intact and otherwise complete particles, most are not infective. However, a search of the literature does not support this supposition.
To the contrary, work by Nyberg-Hoffman et al. [3] used a model derived from Pick's Laws of Diffusion to demonstrate that most, if not all, adenovirus particles are indeed infective. That work, and others [50], showed the importance of diffusion mechanics for virus binding and demonstrated the dependence of titer determination on often ignored experimental conditions. The defective particle misconception neglects the important factor that most of the added particles in a well never contact the target cell during the critical period of the assay. Changes in assay conditions such as particle con centration or exposure time can have a dramatic effect the results. A significant outcome of the misconception has been the requirement by regulatory agen cies to demand that there be at least one infective particle per hundred total particles (FDA Guidelines). Substantial resources have been spent in attempts to purify away the "defective particles." Unfortunately, in many cases these particles are merely experimental artifacts and thus cannot be removed by purification. Other ramifications of this misconception have been discussed in the literature [50, 51]. Diffusion can be accounted for by the use of diffusion-normalized analy sis [3]. This analysis takes into account the diffusion of the particle under the conditions of the assay by deriving normalization equations from Pick's Laws of Diffusion. Por a titer plate assay the equation is given by ' " ( • - T ) V — ^̂ —n X dilution factor, where pw is the number of positive wells per dilution, n is the total number of wells per dilution, A^ is the area of the bottom of the well in cm^, Cw is the confluence of the well at the time of infection, I is a constant incorporating the diffusion coefficient and is equal to 2.38 x 10~^ cm/particles s^/^, and t is the exposure time in seconds. Prom the equation, one can see that p^ must be less than n and greater than zero. Optimally, the number of positive wells should be between 20 and 80% of the total wells in a dilution. This method yields titers that are up to 50% of the particle concentration. 1 9 4 Shabram et al. C. Flow Cytometry Fluorescence activated cell sorting (FACS) offers another sensitive method to assess infective titer [52]. Sufficient quantities of permissive cells for analysis can be grown and infected in six-well plates. Infected cells are harvested, fixed, and stained with a FITC-conjugated anti-adenovirus antibody. Infected cells are brightly stained while uninfected cells are not. FACS analysis determines the fraction of cells infected at the time of harvest. The fraction of infected cells at the time of infection is diluted at the time of harvest because uninfected cells continue to divide. By performing cell counts at infection and at harvest times, one can then calculate the proportion of cells infected at infection time by using the fact that the number of infected cells does not increase during the incubation period. Multiplying the proportion of infected cells by the number of cells at infection time yields the number of cells originally infected. Since the total number of cells at infection time is also known, the proportion of infected cells at infection time is also known. This value can be used to calculate a titer. Cells are infected with a virus concentration high enough to get 5-10% of cells to stain positive. Exposure time ranges from 30 s to 60 min. Incubation is up to 50 h to avoid secondary infections. The titer is given by the diffusion- adjusted equation: y — — X dilution factor. Iip^/t The average cell area (two-dimensional footprint), symbolized by cp, is a variable that must be determined for each cell line. Subclones of HEK 293 cells, for example can display morphology differences from the parent stock. Cell area can be determined using image analysis to analyze micrographs of cells. HEK 293 cells obtained from ATCC and at low passage number possess a cell area of approximately 6.3 x 10~^ cm^. Other subclones of 293 cells can have larger or smaller areas. F is the final adjusted fraction of positive cells detected. / is 2.38 x lO""^ cm/particles s /̂̂ as above. This method yields titers that are 50 to 80% of the particle concentration. This is probably the best value that can be obtained considering that no step in the infection process is 100% efficient. D. Particle Concentration Determination by Ultraviolet Absorbance The most common method for measuring particle concentration is to dis rupt the particles using SDS followed by absorbance measurement at 260 nm. Maizel [53] determined that the absorptivity of adenovirus was 1.1 x 10^^ particles/mL/absorbance unit at 260 nm. This method is convenient and rapid but not without limitations. The sample must be pure and free of particulates and aggregates in order to obtain an accurate reading. The buffer formulation of the sample can affect the reading as salt concentration partially determines 7. Purification of Adenovirus 1 9 5 the concentration at which SDS may form micelles. This method cannot dis tinguish disrupted particles from intact particles. Contaminating DNA may increase the absorbance and lead to an overestimation of particle concentration. Absorbance readings at several wavelengths provide a check on the validity of the assay. Absorbance in the longer ultraviolet and visible regions indicates light scattering. The ratio of 260 nm (DNA) to 280 nm (protein) should fall between 1.2 and 1.3. A ratio outside this range indicates contamination. E. Analytical Reverse-Phase HPLC Re versed-phase high-performance liquid chromatography (RPHPLC) first achieved prominence as an analytical technique because of its wide applicability and ability to resolve a large number of components in a sin gle chromatographic run [54]. This excellent technique also works well as a preparative method for some proteins, mainly those of lower molecular weights (<30,000) [25, 55], RPPHPLC is the dominant method for the purification of peptides and protein of MW < 10,000 [56]. For example, human insulin is produced at a level of tons per year using RPHPLC. Application to larger proteins is limited by the denaturing tendency of organic solvents. For this reason RPHPLC is considered a denaturing technique. The binding of proteins to reversed-phase columns results from a hydrophobic interaction between exposed regions of the protein and the hydrophobic surface of the stationary phase (the resin). Denaturation by the mobile phase exposes hydrophobic regions buried within the protein. Elution is achieved by applying a gradient of increasing concentration of organic solvent, usually acetonitrile. Proteins tend to elute as broad, asymmetrical peaks unless an ion pairing agent, such as trifluoroacetic acid (TFA) is included. TFA is thought to bind to the positive charges on the protein, masking negative charges on the resin matrix and providing additional hydrophobic surface to interact with the column [54]. RPHPLC is a powerful analytical tool to use for adenoviral samples because it resolves the proteins contained in the virus particle. This method, described in Lehmberg et al. [31], has provided detailed insights into the nature of adenovirus preparations. The method consists of injecting the sample onto a C4 reversed-phase column that has been equilibrated in 20% acetonitrile at a constant TFA concentration of 0 .1%. The column temperature, a critical parameter for RPHPLC, is kept at 40°C. These conditions dissociate the particle into proteins that in turn bind to the column. The column is then eluted with an acetonitrile gradient beginning at 20% and ending at 60%. The TFA concentration is maintained at 0 .1%. The absorbance is monitored at 214 nm and can be monitored at 260 and 280 nm. The resultant chromatogram gives a characteristic fingerprint of the adenovirus proteins. Mass spectrometry and N-terminal sequencing have identified 14 major peaks. These proteins can be recovered quantitatively enabling this assay to be used as a quantitative 1 9 6 Shabram ef al. method for determining particle concentration. The relative peak areas of the proteins can be compared to a known standard to assess particle quality. F. Analytical Anion-Exchange HPLC The anionic nature of the adenoviral particle lends itself to analysis by anion-exchange HPLC [30, 32]. This method is nondestructive and yields a w^ealth of information. Before this method, monitoring the production and purification of adenovirus particles w âs limited to infectious titer assays. For the purposes of process development and monitoring, infectious titer assays were too slow, resulting in low throughput. They were not sensitive enough to distinguish small differences among samples. Protein analysis methods, such as SDS-PAGE, could not quantitate virus in crude samples because most of the viral protein is not incorporated into whole virus [1]. Absorbance techniques to assess viral particles based upon the UV absorption of DNA were not applicable to crude samples. This is because free viral and host cell DNA is present in the sample. These limitations are overcome by AEHPLC. A 1-mL Resource Q anion exchange column (Pharmacia Biotech, Piscat- away, NJ) is convenient for HPLC analysis of samples. Lysates are prepared by treatment with nuclease. Semipure or pure virus can be injected directly because they do not require nuclease treatment. As long as the column is not reequilibrated during injection, the assay is independent of the injection volume. After sample loading, the column is washed with equilibration buffer (Hepes or Tris, at approximately pH 7.5) followed by linear salt gradient elu- tion. The chromatography can be monitored on a standard ultraviolet detector. Significantly, more information can be gleaned by the use of a photo diode array (PDA) detector scanning from 210 to 300 nm. The retention time of the adenovirus peak varies with the serotype of the virus. The AEHPLC chromatogram reveals information about purity, particle integrity, and particle quantity. Figure 7 shows the chromatograms of purified adenovirus type 5 and infected cell lysate. Other serotypes give slightly different peak elution times. Provided that the HPLC system remains below the pressure limits of the resin, the chromatography can be performed in less than 6 min. Monitoring the process by anion exchange HPLC enables the production staff to rapidly obtain a picture of the progress of the purification. IV. Formulation and Stability Process development must determine product stability over a wide range of conditions. The time course of the purification must be scrutinized for excessive run times and delays because rapid processing favors high yields. A well-designed process includes holding points selected such that the viral 7 . Purif ication of Adenov i rus 197 020 Purified AdenovirusType 5 0.15 0.10 Adenovirus 0.05 0.00 200 400 &00 aoo laoo 1200 i4oo laoo laoo 2aoo 1.80 i.eo Adenovirus Infected Cell Lysate 1.40 1.20 1.00 aso aeo 0.40 UNA a20 aoo 1 200 400 aoo aoo moo 1200 i400 laoo laoo 2000 Minutes Figure 7 The most useful method for analyzing both crude and pure samples of adenovirus is anion-exchange HPLC. Pure adenovirus elutes in a nearly symmetrical peak. The adenoviral peak from lysate elutes with baseline separation from contaminants such as hexon and undigested DNA. The method is detailed in Shabram etal. [30]. preparation can be safely stored in the event of a planned or unplanned delay. Stability studies are critical to identify those steps at which the virus is at risk. Additionally, the lessons gleaned from these studies point to a stabilizing formulation needed for clinical trials and beyond. Aggregation of adenovirus particles is w êll know^n to those in the field. The adenovirus demonstrates low^ stability at 4°C. This phenomenon has yet to be explained, although there are examples of cold-sensitive enzymes in the literature [57, 58]. The instability seems to be related to the tendency of adenovirus particles to aggregate. Aggregation requires that particles bind to each other after a collision. As the collisions proceed the aggregating particle groves. A systematic analysis of aggregation v^as published in 1917 by Smoluchowski [59]. Using Smoluchow^ski's coagulation model the aggregation frequency of adenoviral particle can be roughly estimated at one per every 50 198 Shabram ef al. collisions! This may seem surprisingly frequent until one realizes that collisions between particles are relatively rare due to the slow diffusivity of the particle. It also explains the observation that aggregation is dependent on particle concentration. Aggregation may also be the end result of damage that occurs early in the production process but does not manifest itself until the sample is concentrated. Aggregation can be mitigated by
changing the conditions of the formulation such that aggregation events are not favored. Collision frequency can be reduced by increasing the viscosity of the solution. Figure 8 shows the effect of concentration on the stability of virus in phosphate-buffered saline with 2% sucrose at 4°C. Aggregation was measured as disappearance on AEHPLC. Aggregation accelerated at concentrations greater than 5 x 10^^ particles per milliliter. The addition of glycerol increased the virus stability (Fig. 9). This is likely due to the ability of glycerol to cause preferential hydration of protein surfaces [60, 61], leading to a tighter association of the capsid subunit structure. Additionally, an increase in viscosity reduces the number of collisions between particles. Salt concentration plays a significant role in the stability of the particle in that stability is reduced in salt solutions above 300 mM. Stability at these salt levels was increased in the presence of glycerol. The putative damage may be due to an anion-specific effect and probably follows the Hoffmeister series. Studies with potassium chloride, sodium chloride, and cesium chloride showed that while chloride concentrations above 1.5 M were not destabiliz ing, concentrations between approximately 0.4 and 1.0 M could be harmful 100 H 80 2 c 60 ] o U 40 ^ 20 ^ Days at 4° C Figure 8 Adenovirus stability is affected by concentration. Recombinant adenovirus was diluted to 4 X 10^1 (•), 5 x IQ i i ( A ) , 6 x IQi^ ( • ) , o r S x 10^^ ( • ) particles/mL and was stored at 4°C. On the indicated days aliquots were assayed for virus concentration with the anion exchange HPLC assay. The buffer was 20 mM sodium phosphate, pH 8, TOO mM NaCi, 2 mM MgCl2, and 2% 7 . Purif ication of Adenov i rus 199 10 4' o 1 OH Days at 4° C Figure 9 Glycerol stabilizes the adenovirus in solution. Recombinant adenovirus at 10^^ parti- cles/mL was stored at 4°C in aliquots: undiluted ( • ) , diluted 20% with water ( A ) , or diluted with 50% glycerol to a final concentration of 10% (v/v) glycerol (O). On the indicated days aliquots were assayed for virus concentration with the anion exchange HPLC assay. The buffer was 20 mM sodium phosphate, pH 8, 100 mM NaCi, 2 mM MgCl2, and 2% sucrose. regardless of the cation. In contrast high concentrations of sodium sulfate, sodium phosphate or potassium phosphate were not destabilizing. A major consideration is the exposure to pH outside the physiologi cal range. As mentioned earlier, phosphate buffer at pH 7.2 lacks buffering capacity during freeze-thaw. Hence, the rate of freezing and thawing are critical. In general, fast freezing and fast thawing improves the stability of the material. Buffers such as Hepes or Tris maintain buffering capacity during freeze-thaw and therefore are preferable for stabilizing pH. One might suspect that the lower stability at 4°C may be related to pH stability and therefore the buffering capacity of the formulation. While phosphate may be problematic for freeze-thaw it is interesting that substituting Tris for phosphate does not affect the stability at 4°C. Freezing and thawing was mentioned earlier as a potential risk for the viral preparation. Cryoprotection agents are often used to mitigate the risk by disturbing ice crystal formation and providing for an amorphous frozen solid. Typically carbohydrates are use to accomplish this. Sucrose and mannitol are often found in formulations where the freezing process is 2 0 0 Shabram ef al. critical. Typically, mannitol provides slightly better protection with proteins than sucrose and is preferred for its superior cake formation in a lyophilized product. With adenovirus, however, the opposite is true. Sucrose provides moderate protection but mannitol has a clear negative affect. V. Conclusions The use of adenovirus vectors for gene therapy has placed increased demands upon the technology for production, purification, and characteriza tion of virus particles. Some of the classic technology has been reexamined and improved. A new class of methods based upon column chromatography has added a powerful set of tools to this array. In large part, the chromatographic methods are based upon modes of chromatography and resins originally devel oped for protein purification. With proper consideration for the size and other characteristics of adenovirus particles column chromatography may be applied with considerable success. The past decade has witnessed rapid advances in this area. Column chromatography is now a preferred method for adenovirus purification because of its versatility and ability to purify large amounts of virus to a high state of purity while retaining biological activity. Acknov^ledgments The authors acknowledge the indispensable help of Rich Murphy, Beth Hutchins, Daniel Giroux, and Muralidhara Ramachandra for input, advice, and editing of the manuscript. The work presented here is a compilation of effort by many individuals over the past 7 years. In particular, we thank and acknowledge Bernie Huyghe, Daniel Giroux, Mark Horn, Xioa-Dong Lui, Suganto Sutjipto, Erno Pungor, Estuardo Aguilar-Cordova, Douglas Cornell, Mary Nunnaly, Kai Tam, Ann Goudreau, Nancy Connelly, Cassandra Nyberg-Hoffman, Jing Zhou, Fred Porter, Andreas Frei, Barry Sugarman, Margarita Nodelman, Josefina Beltran, Anastasia Sofianos, Karli Watson, Thomas Schluep, Susan Miller, Shu-Fen Wen, Tattanahalli Nagabhushan, and Michael Shepard. References 1. Philipson, L. (1984). Structure and assembly of adenoviruses. Curr. Top. Microbiol. Immunol. 109, 1-52. 2. Oliver, C. J., Shortridge, K. F., and Belyavin, G. (1976). Diffusion coefficient and molecular weight of type 5 adenovirus by photon-correlation spectroscopy. Biochim. Biophys. Acta 437,589-598. 3. Nyberg-Hoffman, C , Shabram, P., Li, W., Giroux, D., and Aguilar-Cordova, E. (1997). Sensitivity and reproducibility in adenoviral infectious titer determination. Nat. Med. 3, 808-811. 7. Purification of Adenovirus 2 0 1 4. Stewart, P. L., Fuller, S. D., and Burnett, R. M. (1993). Difference imaging of adenovirus: Bridging the resolution gap between X-ray crystallography and electron microscopy. EMBO / . 12,2589-2599. 5. Pettersson, U., Philipson, L., and Hoglund, S. (1967). Structural proteins of adenoviruses. I. Purification and characterization of the adenovirus type 2 hexon antigen. Virology 33, 575-590. 6. Boulanger, P. A., Flamencourt, P., and Biserte, G. (1969). Isolation and comparative chemical study of structural proteins of the adenoviruses 2 and 5: Hexon and fiber antigens. Eur. J. Biochem. 10, 116-131. 7. Pusey, P. N., Koppel, D. E., Schaefer, D. W., Camerini-Otero, R. D., and Koenig, S. H. (1974). Intensity fluctuation spectroscopy of laser light scattered by solutions of spherical viruses: R17, Q beta, BSV, PM2, and T7. I. Light-scattering technique. Biochemistry 13, 952-960. 8. Sakaki, Y., Maeda, T., and Oshima, T. (1979). Bacteriophage phiNSll: A lipid-containing phage of acidophilic thermophilic bacteria. IV. Sedimentation coefficient, diffusion coefficient, partial specific volume, and particle weight of the phage./. Biochem. (Tokyo) 85,1205-1211. 9. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-74. 10. Fallaux, F. J., Bout, A., van der Velde, I., van den WoUenberg, D. J., Hehir, K. M., Keegan, J., Auger, C., Cramer, S. J., van Ormondt, H., van der Eb, A. J., Valerio, D., and Hoeben, R. C. (1998). New helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 11. Hehir, K. M., Armentano, D., Cardoza, L. M., Choquette, T. L., Berthelette, P. B., White, G. A., Couture, L. A., Everton, M. B., Keegan, J., Martin, J. M., Pratt, D. A., Smith, M. P., Smith, A. E., and Wadsworth, S. C. (1996). Molecular characterization of replication- competent variants of adenovirus vectors and genome modifications to prevent their occurrence./. Virol. 70, 8459-8467. 12. Branton, P. E. (Ed.) (1999). "Early Gene Expression." R.G. Landes, Austin, TX. 13. Vales, L. D., and Darnell, J. E. (1989). Promoter occlusion prevents transcription of aden ovirus polypeptide IX mRNA until after DNA replication. Genes Dev. 3, 49-59. 14. Penefsky, H. S., and Tzagoloff, A. (1971). Extraction of water soluble enzymes and proteins from membranes. Methods Enzymol. 22, 204-219. 15. Monica, T. (2000). In "Viral Vectors and Vaccines." WiUiamsburg Bioprocessing Foundation, Lake Tahoe, NV. 16. McGregor, W. C. (1986). Membrane separation in biotechnology. In "Bioprocessing Tech nology" (W. C. McGregor, Ed.). Dekker, New York. 17. Chase, H. A. (1998). The use of affinity adsorbents in expanded bed adsorption. / . Mol. Recognit. 11 ,217-221 . 18. Hjorth, R. (1997). Expanded-bed adsorption in industrial bioprocessing: Recent develop ments. Trends Biotechnol. 15, 230-235. 19. Thommes, J. (1987). Fluidized bed adsorption as a primary recovery step in protein purifica tion. Adv. Biochem. Eng. Biotechnol. 58, 185-230. 20. Meselson, M., Stahl, F. W., and Vinograd, J. (1957). Equilibrium sedimentation of macro- molecues in density gradients. Proc. Natl. Adam. Sci. USA 43, 581-588. 21. Burgess, R. R. (1987). "Protein Purification: Micro to Macro. In UCLA Symposia on Molecular and Cellular Biology." R. Liss, New York. 22. Deutscher, M. P. (1990). Guide to Protein Purification. In "Methods in Enzymology" (J. N. A. a. M. I. Simon, Ed.). Academic Press, New York. 23. Gagnon, P. (1996). "Purification Tools for Monoclonal Antibodies." Validated Biosystems, Tuscon, AZ. 24. Jacoby, W. B. (1984). Enzyme purification. In "Methods in Enzymology" (P. P. C. a. N. O. Chapman, Ed.), p. 528. Academic Press, New York. 2 0 2 Shabram et al. 25. Janson, J. C , and Ryden, L. (1989). Protein purification. In "Protein Purification: Principles, High ResolutionMethods, and Applications" (J. J. C. and R. L. Eds.). VCH, New York. 26. Kenny, A., and Powell, S. (1992). Practical protein chromatography. Methods Mol. Biol. 11, 1-327. 27. Wheelwright, S. M. (1991). "Protein Purification: Design and Scale up of Downstream Processing". Hanser Publishers, Munich. 28. Huyghe, B. G., Liu, X., Sutjipto, S., Sugarman, B. J., Horn, M. T., Shepard, H. M., Scandella, C. J., and Shabram, P. (1995). Purification of a type 5 recombinant adenovirus encoding human p53 by column chromatography. Hum. Gene Ther. 6, 1403-1416. 29. Snyder, L. R., and Kirkland, J. J. (1979). "Introduction to Modern Liquid Chromatography." Wiley, New York. 30. Shabram, P. W., Giroux, D. D., Goudreau, A. M., Gregory, R. J., Horn, M. T., Huyghe, B. G., Liu, X., Nunnally, M. H., Sugarman, B. J., and Sutjipto, S. (1997). Analytical anion- exchange HPLC of recombinant type-5 adenoviral particles. Hum. Gene. Ther. 8, 453-465. 31. Lehmberg, E., Traina, J. A., Chakel, J. A., Chang, R. J., Parkman, M., McCaman, M. T., Murakami, P. K., Lahidji, V., Nelson, J. W., Hancock, W. S., Nestaas, E., and Pungor, E. (1999). Reversed-phase high-performance liquid chromatographic assay for the adenovirus type 5 proteome./. Chromatogr. B 732, 411-423. 32. Blanche, F., Cameron, B., Barbot, A., Ferrero, L., Guillemin, T., Guyot, S., Somarriba, S., and Bisch, D. (2000). An improved anion-exchange HPLC method for the detection and purification of adenoviral particles. Gene Ther. 7, 1055-1062. 33. Karlsson, R. M. (1989). Ion exchange chromatography. In "Protein Purification. Protein Purification: Principles, High ResolutionMethods, and Applications" (J. C. Janson and L. Ryden, Eds.). VCH, New York. 34. Porath, J., and Olin, B. (1983). Immobilized metal ion affinity adsorption and immo bilized metal ion affinity chromatography of biomaterials. Serum protein affinities for gel-immobilized iron and nickel ions. Biochemistry 22, 1621-1630. 35. Porath, J., Carlsson, J., Olsson, I., and Belfrage, G. (1975). Metal chelate affinity chromatog raphy, a new approach to protein fractionation. Nature 258, 598-599. 36. Kagedal, L. (1989). "Immobilized Metal Ion Affinity Chromatography." VCH, New York. 37. Douglas, J. T., Miller, C. R., Kim, M., Dmitriev, I., Mikheeva, G., Krasnykh, V., and Curiel, D. T. (1999). A system for the propagation of adenoviral vectors with genetically modified receptor specificities. Nat. Biotechnol. 17, 470-475. 38. Shaltiel, S. (1984). Hydrophobic chromatography. In "Enzyme Purification and Related Techniques" (W. B. Jacoby, Ed.). Academic Press, New York. 39. Eriksson, K. O. (1989). Hydrophobic interaction chromatography. In "Protein Purification: Principles, High Resolution Methods, and Applications" (J. C. Janson and L. Ryden, Eds.). VCH, New York. 40. Kennedy, R. M. (1990). Hydrophobic chromatography. In "Guide to Protein Purification" (M. P. Deutscher, Ed.). Academic Press, New York. 41. Fischer, L. (1980). "Gel Filtration Chromatography." Elsevier, Amsterdam. 42. Hagel, L. (1989). Gel filtration. In "Protein Purification: Principles, High Resolution Methods, and Applications" (J. C. Janson and L. Ryden, Eds.). VCH, New York. 43. Coligan, J. E., Dunn, B. M., Ploegh, H. L., Speicher, D. W., and Wingfield, P. T. (1996). In "Current Protocols" (V. B. Chanda, Ed.). Wiley, New York. 44. Craig,
L. C. (1967).Techniquesforthestudy of peptides and proteins by dialysis and diffusion. In "Methods in Enzymology" (S. P. C. a. N. O. Kaplan, Ed.), pp. 870-905. Academic Press, New York. 45. McPhie, P. (1971). Dialysis. In "Methods in Enzymology" (S. P. C. a. N. O. Kaplan, Ed.), pp. 23-32. Academic Press, New York. 46. Wiseman, A. (1985). "Handbook of Enzyme Biotechnology." Halsted PressAViley, New York. 7. Purification of Adenovirus 2 0 3 47. Cheryan, M. (1986). "Ultrafiltration Handbook." Technomic, Lancaster. 48. Lynn, D. E. (1992). A BASIC computer program for analyzing endpoint assays. Biotechniques 12,880-881. 49. Finney, D. J. (1962). "Probit Analysis." Cambridge University Press, Cambridge, UK. 50. Andreadis, S., Lavery, T., Davis, H. E., Le Doux, J. M., Yarmush, M. L., and Morgan, J. R. (2000). Tov^ard a more accurate quantitation of the activity of recombinant retroviruses: Alternatives to titer and multiplicity of infection [corrected and republished article originally printed in / . ViroL 2000 Feb;74(3):1258-1266]./. Virol. 74, 3431-3439. 51. Shabram, P., and Aguilar-Cordova, E. (2000). Multiplicity of infection/multiplicity of confu sion. MoL Ther. 2, 420-421. 52. Musco, M. L., Cui, S., Small, D., Nodelman, M., Sugarman, B., and Grace, M. (1998). Comparison of flow cytometry and laser scanning cytometry for the intracellular evaluation of adenoviral infectivity and p53 protein expression in gene therapy. Cytometry 33,290-296. 53. Maizel, J. V., White, D. O., and Scharff, M. D. (1968). The polypeptides of Adenovirus. L Evidence for multiple protein components in the virion and a comparison of types2, 7A, and 12. V/Vo/og); 36, 115-125. 54. Snyder, L. R., Kirkland, J. J., and Glajch, J. L. (1997). "Practical HPLC Method Develop ment." Wiley, New York. 55. Hearn, M. T. W. (1984). Reversed phase high performance liquid chromatography. In "Enzyme Purification and Related Techniques" (W. B. Jakoby, Ed.), Part C, pp. 190-212, Academic Press, New York. 56. Rivier, J. (1984). Reversed-phase high-performance liquid chromatography: Preparative purification of synthetic peptides. / . Chromatogr. 288, 303-328. 57. Lee, M. L., and Muench, K. H. (1969). Prolyl transfer ribonucleic acid synthetase of E. coH. / . Biol. Chem. 244, 223-230. 58. Frieden, C. (1971). Protein-protein interaction and enzymatic activity. Annu. Rev. Biochem 40, 653-696. 59. Smoluchowski, M. V. (1917). Versuch einer mathematischentheorie der koagulationskinetic koUoider losungen. Z. Phy. Chem 92, 129-168. 60. Gekko, K., and Timasheff, S. N. (1981). Mechanism of protein stabilization by glycerol: Preferential hydration in glycerol-water mixtures. Biochemistry 20, 4667-4676. 61. Gekko, K., and Timasheff, S. N. (1981). Thermodynamic and kinetic examination of protein stabilization by glycerol. Biochemistry 20, 4677-4686. C H A P T E R Targeted Adenoviral Vectors I: Transductional Targeting Victor Krasnykh'̂ '̂ and Joanne T. Douglas"̂ *Division of Human Gene Therapy Departments of Medicine, Pathology, and Surgery and the Gene Therapy Center University of Alabama at Birmingham Birmingham, Alabama WectorLogics, Inc. Birmingham, Alabama I. Introduction The extensive use of human adenoviruses (Ads) for gene therapy is largely due to the fact that the biology of these viruses has been extensively studied for decades. Therefore, at the time when gene therapy emerged, these viral agents represented a rational choice as a candidate system for delivery of therapeutic genes to diseased tissues. Compared to other gene transfer vectors, both viral and nonviral, adenoviruses possess a number of properties which make them a preferred means of cell transduction. In addition to the well understood biology of Ad and extensively developed methods for the generation, propagation, and purification of these vectors, the in vivo stability of Ad, the capacity to accommodate significant amounts of heterologous DNA, and the ability to efficiently infect a wide variety of different cell types at various points of the cell cycle, have significantly facilitated progress in Ad-based gene therapy in the early stages of its development. A critical overview of the results achieved by gene therapy during the past decade clearly shows that although it has not yet lived up to most of the expectations raised at the time it was conceived and even has resulted in the death of a human being, it has, in fact, shown quite impressive results in some applications. Importantly, being a new field of experimental biology and a promising new direction in modern medical science, gene therapy has attracted a substantial additional workforce, talent ADENOVIRAL VECTORS FOR GENE THERAPY 2 0 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 2 0 6 Krasnykh and Douglas and funds to not only use the knowledge previously generated by classical virologists, but also to foster further efforts in studying the biology of Ad, thereby creating a positive feedback to basic science. Despite recent successes in employing Ad vectors for developing nev^ treatment modalities, progress in this direction has clearly been hampered by a number of deficiencies of therapeutic Ad vectors. The list of these limitations includes at least three major points. First of all, Ad vectors are not as safe as desired. Even though Ads, which are considered mild pathogens in the first place, are used for gene delivery in the form of highly attenuated derivatives of the wild-type viruses, when used at high doses they can potentially lead to quite deleterious side effects, including lethal outcomes. This is due in part to the fact that even replication-deficient versions of these vectors are capable of low-level expression of viral genes in the infected cells, thereby causing vector-associated cell toxicity and death. In addition, since Ad virions contain hundreds of copies of viral proteins, they are highly immunogenic and as such can cause acute immune responses in a patient, which result in rapid clearance of both the injected agent and the virus-infected cells. Finally, the promiscuous tropism of Ad vectors may result in the widespread dissemination of the vector upon delivery to the patient and may potentially lead to random infection of normal tissues, thereby further complicating the safety and toxicity issues. The purpose of this chapter is to demonstrate that by addressing the deficiency of Ad vectors related to their natural tropism, one can potentially improve the specificity, immunogenicity, and safety of these agents and thus further increase their overall utility for gene therapy. li. The Pathv^ay of Adenoviral Infection Strategies to retarget Ad vectors should be based on an understanding of the biology of Ad infection and the roles played by the viral capsid proteins involved in determining tropism. These topics are reviewed elsewhere in this volume and will therefore be described only briefly here. Adenoviruses are nonenveloped viruses with double-stranded DNA genomes packaged into icosahedral capsids. The major protein component of the Ad particle is the hexon protein, which forms the planes of the capsid and appears to play a predominantly structural role in the virion. At each of the 12 vertices of the capsid is a penton complex consisting of a pentameric penton base associated with a trimeric fiber protein which projects from the viral surface. The entry of Ad into susceptible cells requires two distinct, sequential steps — binding and internalization — each mediated by the interaction of a specific component of the Ad penton complex with a cellular receptor. The initial high-affinity binding of Ad to the primary cellular receptor occurs via 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 0 7 the carboxy (C)-terminal knob domain of the fiber capsid protein [1, 2]. The knob domain also initiates and maintains the trimeric configuration of the fiber molecule [3,4], which is critical for the ability of the fiber to associate with the penton base, since fiber monomers cannot be incorporated into mature viral particles [5]. The central shaft domain of the fiber serves to extend the knob away from the surface of the virion, thereby facilitating its interaction with the primary receptor. The amino (N)-terminal tail domain is associated with the penton base and also contains a nuclear localization signal, which directs the newly synthesized fiber polypeptides to the nucleus of the infected cell, where the assembly of the viral particle occurs [6]. Thus, the three domains of the fiber protein fulfill well-defined and distinct functions. The cellular fiber receptor for the two human Ad serotypes which are most commonly used as gene delivery vectors, Ad2 and Ad5 from subgroup C, has been identified as the coxsackievirus and adenovirus receptor, CAR [7, 8]. CAR also serves as the primary receptor for Ad serotypes from subgroups A, D, E, and F, but not subgroup B [9]. CAR appears to function purely as a high-affinity docking site for Ad on the cell surface: the cytoplasmic and transmembrane domains of the molecule are not essential for Ad infection [10, 11]. CAR has two extracellular immunoglobulin-fike domains, of which the N-terminal domain, D l , which is distal to the cell surface, is responsible for binding the Ad knob [12]. Following attachment, the next step in Ad infection is internalization by receptor-mediated endocytosis potentiated by the interaction of Arg-Gly-Asp (RGD) peptide sequences at the apex of protruding loops of the Ad penton base with secondary host cell receptors, integrins avP3 and av^S [13, 14]. After internalization, the virus is localized within the cellular vesicle system, initially in clathrin-coated vesicles and then in endosomes. Acidification of the endosomes allows the virions to escape and enter the cytosol. The virions are then translocated along microtubules to nuclear pore complexes where the capsid is disassembled and the DNA genome is imported into the nucleus [15]. III. Strategies and Considerations The capacity of an Ad vector to infect a given cell is therefore dictated by the CAR- and integrin-expression levels of the cell. It has been shown that cells expressing both receptors below a certain threshold level are refractory to Ad infection [16]. Recent studies have also demonstrated that a number of cell types such as endothelial, smooth muscle cells, differentiated airway epithelium cells, lymphocytes, fibroblasts, hematopoietic cells, and some others demonstrate either complete or partial resistance to Ad infection [10, 17-23]. Importantly, the employment of Ad vectors for cancer gene therapy has revealed that many types of tumor cells express CAR at marginal or even 2 0 8 Krasnykh and Douglas undetectable levels and are thus Ad-refractory [24-26]. An interesting finding in this regard was recently published by Okegawa et al.^ who demonstrated a striking inverse correlation between the level of CAR expression by prostate cancer cell lines and their tumorigenicity, thereby suggesting that in general the most aggressive tumors may be CAR-deficient and therefore refractory to therapeutic intervention utilizing unmodified Ad2- or Ad5-derived vectors [27]. The authors have also observed the same phenomenon on human breast cancer cells. If the results of this work are further corroborated by data from other laboratories, CAR deficiency in tumors may become a major obstacle in employing Ad vectors for cancer gene therapy, therefore necessitating the derivation of Ad vectors capable of infecting these tumors in a CAR- independent fashion. Another reason to develop tropism-modified Ad vectors is the fact that many normal human tissues express high levels of CAR [7] and may thus become random targets for therapeutic Ad agents. As the products of some therapeutic genes may be toxic or otherwise deleterious to normal cells, such uncontrolled transduction may result in destructive side-effects which can compromise the efficiency of the therapy. An overview of the native cell-entry pathway utilized by Ad suggests that it may be modified by altering the mechanism of the virus-cell interaction. Theoretically, this goal may be achieved by modifying the structure of the receptor-binding components of the Ad virion, the fiber and the penton base, in a way which promotes interactions of the modified capsids with cell surface- localized molecules distinct from the native Ad receptors. The accomplishment of this goal would result in Ad vectors possessing expanded tropism, which would be able to achieve cell entry by either of two routes, the natural or newly created pathway. Obviously, although such infectivity-enhanced vectors would be of utility in those clinical applications where tropism to CAR is not a confounding issue, they would still be a suboptimal means of cell-specific gene delivery in most therapeutic strategies requiring stringent control over vector dissemination in patients. Therefore, in order to achieve the maximum targeting gain, the development of truly targeted Ad vectors will necessitate the ablation of the native CAR tropism of the vector. These two goals may be realized by a variety of strategies, which differ from each other in the means utilized for
engineering the novel viral tropism and the ablation of CAR tropism. In essence, there are two conceptually different approaches, which may be referred to as conjugate-based targeting and genetic targeting. These strategies are similar in that they are both based on establishing a physical link between the Ad virion and a targeting molecule, or ligand, such that binding of the ligand to a target receptor attaches the virion to the cell expressing that receptor. The basic difference between these strategies is that whereas the conjugate-based approach employs methods of complexing the Ad vector with the targeting moieties which do not usually require any modifications of the Ad virion, and results in a multicomponent vector, in 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 0 9 genetic targeting no extraneous complexes or conjugates are involved as the targeting is achieved by genetic modification of the Ad virion itself, thereby resulting in a single-component vector. A variety of different types of molecules may be employed as targeting ligands in these tw ô approaches. Perhaps w îth the exception of small inorganic molecules which possess specificity to selected cell surface receptors, any natural receptor-binding ligand can be linked to an Ad capsid. This covers a w îde spectrum of ligands ranging from relatively simple organic substances such as folate to complex chemical conjugates or genetic fusions of antibodies (see "Conjugate-Based Targeting" belov^). How^ever, this spectrum of naturally available targeting moieties, although quite broad, cannot meet the needs of Ad targeting in the most general sense, as it is not applicable to cell surface molecules w^hich do not perform any receptor functions and thus do not have any natural ligands. To direct Ad vectors to this type of molecule, relevant targeting ligands should be engineered de novo. This task may be achieved by developing mono- or polyclonal antibodies against the target molecule and using these antibodies for Ad targeting. How^ever, this approach can be used only in a conjugate-based strategy, since the incorporation of an entire antibody molecule into the Ad capsid is not yet possible (see discussion below). Alternatively, a more versatile approach which is compatible with both targeting strategies may be employed for the identification of ligands. Specifically, phage libraries which are designed to display an enormous diversity of random peptides or single-chain antibodies may be utilized for the identification of the ligands of interest in a so-called "biopanning" procedure. Such biopanning usually involves several rounds of interactions between the phages constituting the library with the target, which may be represented either by purified target molecules or cells expressing these molecules or, in the extreme, the entire organism [28-34]. Each round of selection leads to the isolation of an enriched subpopulation of phage particles demonstrating some degree of binding to the target, which is then used in a subsequent round of selection. After being repeated several times, this sequential procedure normally results in the identification of ligands possessing specificity to selected targets, which may be used for the Ad rerouting strategies. IV. Conjugate-Based Targeting A. Bispecific Chemical Conjugates In order to restrict gene delivery exclusively to the target cells, it is necessary to prevent the interaction between the knob domain of the Ad fiber and its cellular receptor, CAR, which plays the major role in the determination of Ad tropism. Douglas et al. were the first to show that it is possible 210 Krasnykh and Douglas to redirect Ad infection by employing the Fab fragment of a neutralizing anti-knob monoclonal antibody (mAb) chemically conjugated to a receptor- specific ligand, in this case folate [35]. When complexed with Ad vector particles, the bispecific conjugates simultaneously ablate endogenous viral tropism and introduce novel tropism, thereby resulting in a truly targeted Ad vector (Fig. 1). In this approach, the Fab fragment is employed in preference to the intact anti-knob mAb, in order to prevent the two antigen-binding arms of the parent antibody cross-linking different viruses to form large complexes which might prove refractory to cellular uptake. Since native Ad entry is a two-step process in which the primary cellular receptor serves merely as a docking site for Ad on the cell surface, by analogy it is possible to retarget an Ad vector simply by redirecting binding to an alternative cellular receptor, with subsequent internalization mediated by the interaction between the penton base and cellular integrins. Flence, it has been possible to retarget Ad vectors by conjugating the anti-knob Fab fragment to a wide variety of ligands. In many cases, such bispecific conjugates have been demonstrated to enhance Ad-mediated gene transfer to A. B. / Figure 1 Strategy for targeting of adenoviral vectors using Fab fragment of a neutralizing anti-knob monoclonal antibody (mAb) chemically conjugated to a receptor-specific ligand. (A) Ad attachment to cells is accomplished by the high-affinity binding of the knob domain of the fiber to the primary cellular receptor, CAR. (B) When complexed with the Fab fragment of a neutralizing anti-knob antibody conjugated to a receptor-specific ligand, the Ad vector is unable to bind CAR and is directed to a novel target receptor on the cell surface. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 1 1 target cells which are refractory to native Ad infection due a low level of CAR. For example, a bispecific conjugate in which the anti-knob Fab fragment is chemically conjugated to basic fibroblast growth factor, FGF2, has been shown to mediate enhanced Ad infection of Kaposi's sarcoma cell Unes [36] and vascular endothelial and smooth muscle cells [37], which are only poorly infected by the unmodified vector. In these instances, retargeting of the Ad vector with FGF2 permits a given level of gene transfer to be achieved with a lower dose of virus. The Fab-FGF2 conjugate has also been employed to demonstrate that enhancement of Ad infection can be exploited for therapeutic advantage. To this end, it is well recognized that Ad vectors produce a dose-dependent inflammatory response in rodents and primates. Vector-associated toxicity has also been observed in human clinical trials and threatens to prevent Ad from realizing its full potential as a vector for human gene therapy. This suggests that it would be advantageous to reduce the number of Ad particles required for a given level of gene transfer in vivo. Preliminary in vitro and in vivo studies demonstrated that Ad-mediated gene transfer to the human ovarian cancer cell line SKOV3.ipl could be significantly enhanced by using basic fibroblast growth factor (FGF2) as the targeting ligand, permitting the transduction of a given number of target cells to be achieved by a lower dose of virus [38-40]. Rancourt et al. subsequently demonstrated that intraperitoneal administration of an FGF2-redirected Ad vector carrying the gene for herpes simplex virus thymidine kinase, AdTK, resulted in a significant prolongation of survival in a murine model of human ovarian cancer compared to the same number of particles of the unmodified vector [39]. In addition, the enhanced Ad infection permitted an equivalent therapeutic effect using a 10-fold lower dose of the vector. Similar results have been reported by other investigators [41, 42]. Moreover, intravenous administration of the FGF2-targeted AdTK vector led to markedly decreased hepatic toxicity and liver transgene expression compared with the untargeted vector [41, 42]. Thus, these findings suggest that strategies to enhance the efficiency of infection of recombinant Ad vectors may be of general clinical utility, by permitting therapeutically significant levels of gene transfer while minimizing the toxicity associated with high numbers of virus particles. These benefits are not limited to the field of cancer gene therapy: FGF2-mediated augmentation of gene transfer by an Ad vector encoding platelet-derived growth factor-B has been shown to enhance infection of target cells involved in tissue repair, resulting in an improved therapeutic outcome and potentially overcoming the safety and efficacy limitations of unmodified Ad vectors [43]. Bispecific moieties consisting of the anti-knob Fab fragment chemically conjugated to a mAb directed against the epidermal growth factor receptor (EGFR) have been employed to retarget Ad vectors to primary and established glioma cells and squamous cell carcinoma of the head and neck (SCCHN) 2 1 2 Krasnykh and Douglas cells [25, 44]. In addition to EGFR-specific infection, the retargeted vectors increased gene transfer to CAR-deficient cancer cells by up to 66-fold relative to the unmodified vector. Furthermore, retargeting enhanced the selectivity of Ad infection for tumor tissue relative to normal tissue from the same patient [44]. The value of retargeting Ad vectors to achieve efficient and specific gene transfer to cancer cells has further been demonstrated by means of a bispecific conjugate targeted to the pan-carcinoma antigen EpCAM [45]. The conjugation of the anti-knob Fab fragment to mAb CC49 permits enhanced Ad infection of primary ovarian carcinoma cells, which express the cognate TAG-72 receptor, while decreasing gene transfer to normal peritoneal mesothelial cells, relative to untargeted Ad [46]. In this case, the selectivity of the targeted vector for cancer versus normal cells was enhanced up to more than 200-fold relative to the unmodified vector. In the field of cancer immunotherapy, the relative resistance of CAR- deficient dendritic cells (DCs) to Ad infection has limited the application of gene-based vaccination. Using a bispecific antibody consisting of the anti-knob Fab fragment conjugated to an anti-CD40 mAb, Tillman et al, observed highly augmented Ad-mediated gene transfer to monocyte-derived dendritic cells [47]. Importantly, this efficient gene transfer was accompanied by the maturation of the DCs, resulting in an enhancement in the efficacy of DC-based vaccination against human papilloma virus 16-induced tumor cells in a murine model [48]. The anti-knob Fab fragment has also been chemically conjugated to the He fragment of tetanus toxin, permitting Ad vectors to be retargeted to neurons following intramuscular injection into mouse tongues [49]. This result further demonstrates the versatility of this targeting strategy, the aim of which is to redirect Ad binding to the surface of the target cells. The universality of this approach is further exemplified by the chemical conjugation of an anti-knob Fab fragment to a peptide with specificity for the lung endothelium, which was identified by in vivo phage display [50]. In an in vitro study, the redirected Ad vector exhibited specificity for cells expressing the target receptor for this peptide. Reynolds et al. have recently reported that a bispecific antibody consisting of the anti-knob Fab fragment chemically conjugated to a mAb directed against angiotensin-converting enzyme (ACE), which is preferentially expressed on pulmonary capillary endothelium, was able to mediate targeted Ad infection of pulmonary endothelial cells following tail vein injection into rats [51]. This shows that an Ad vector complexed with a bispecific conjugate maintains its targeting fidelity upon systemic vascular administration, a result which clearly has important and encouraging implications. Ad vectors have also been retargeted by bispecific antibodies in which the anti-Ad mAb is directed against the penton base. In this case, the full-length mAbs are employed, the combined length of which allows the retargeting moiety to extend beyond the fiber knob. Wickham et al, incorporated the 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 1 3 FLAG peptide epitope into the penton base and then generated bispecific antibodies comprising an anti-FLAG mAb conjugated to a mAb specific for the target receptor. The retargeting of Ad binding to av integrins augmented gene transfer to CAR-deficient endotheUal and smooth muscle cells by 7- to 9-fold [52], while retargeting of Ad to E-selectin increased gene transfer to endothelial cells by 20-fold [53]. An anti-FLAG x anti-CD3 bispecific antibody resulted in a 100- to 500-fold increase in gene transfer to T cells, another cell type poorly infected by unmodified Ad vectors [54]. Yoon et al. have described a strategy to target Ad to human hepatocellular carcinoma cells by means of a bispecific antibody comprising the Fab fragment of an anti-hexon antibody chemically conjugated to a mAb that binds to an antigen that is highly expressed on the target cells [55]. Hov^ever, the Ad vector in this case v^as not truly targeted since it retained the ability to bind the native receptor, CAR. The relatively large number of published studies in v^hich the tropism of Ad vectors has been modified by means of bispecific moieties consisting of an anti-knob Fab fragment chemically conjugated to a ligand largely reflects the historical primacy of this strategy. The chief advantage of this approach is that a variety of ligands, including vitamins, grov^th factors, antibodies, and
peptides, can be chemically conjugated to the anti-knob Fab fragment and used to redirect Ad binding. Hov^ever, the chemical conjugation results in a heterogeneous population of molecules, w^hich presents a problem in obtaining regulatory approval for a clinical trial employing these conjugates. Moreover, the yield of appropriately conjugated bispecific molecules can be low .̂ B. Bispecific Recombinant Fusion Proteins In recognition of the disadvantages associated v^ith chemical conjugation strategies, a number of groups have generated bispecific targeting moieties in the form of recombinant fusion proteins. This permits the expression and purification of a homogenous population of retargeting molecules. The principle on v^hich the design of these bispecific proteins is based is the same as that underlying the construction of chemically cross-linked targeting agents: one site of the protein is directed against an Ad capsid protein, v^hile a second site is specific for a cell surface molecule. Again, the derivation of a truly targeted vector requires that the bispecific molecule block the binding of Ad to its native primary receptor, CAR. One class of bispecific fusion proteins used to retarget Ad vectors consists of a neutralizing anti-Ad knob single-chain antibody (scFv) genetically fused to a cell receptor-specific ligand or scFv. Watkins et al, v^ere the first to describe this type of fusion protein, for w^hich they coined the term "adenobody"[56]. They isolated a neutralizing anti-Ad5 knob scFv, designated s l l , from a phage library and then fused epidermal grow^th factor (EGF) to its C-terminal. The resultant fusion protein w âs expressed in bacteria and purified from the 2 1 4 Krasnykh and Douglas periplasmic fraction. As expected, this adenobody bound both the Ad5 knob and the EGFR on target cells, and was therefore able to redirect Ad infection via this target receptor [56]. Nicklin et al. fused this anti-Ad5 knob scFv with a heptapeptide identified by biopanning a phage display library on human umbilical vein endothelial cells (HUVECs) [57]. The fusion protein retargeted Ad infection of HUVECs, resulting in a 15-fold increase in the efficiency of transduction of these CAR-deficient cells, relative to the unmodified vector. Haisma et al. constructed a bispecific scFv by fusing the anti-Ad5 knob scFv s l l to an scFv directed against EGFR [58]. Two versions of the bispecific scFv were constructed, with the anti-EGFR scFv at either the N- or C-terminal of s l l . In this case, the bispecific scFvs were expressed in mammalian COS-7 cells and purified from the conditioned medium. Both forms of the scFv were able to retarget Ad infection via EGFR. One disadvantage of the adenobody approach is that the incorporation of different targeting moieties can have a big impact on the solubility properties on the resultant fusion protein. Hence, it can be difficult to predict whether the fusion of a given targeting scFv or ligand to the anti-Ad5 knob scFv will yield a soluble molecule which can be purified and will be functional. A second class of bispecific fusion proteins permitting the derivation of a truly targeted Ad vector consists of the extracellular domain of CAR genetically fused to a receptor-targeting moiety. By definition, once complexed with a CAR-ligand fusion protein, an Ad vector will not be able to bind to its native primary receptor on the cell surface. Dmitriev et al. genetically fused EGF at the C-terminal of the extracellular domain of CAR [59]. The soluble CAR-EGF fusion protein was expressed in insect cells using a baculovirus expression system. The bispecific fusion protein mediated EGFR-specific, CAR- independent Ad infection of target cells [59]. In a similar approach, Ebbinghaus et al. fused the extracellular domain of CAR to the Fc region of human immunoglobulin 1 [60]. When complexed with an Ad vector, this fusion protein mediated up to a 250-fold increase of transgene expression in CAR- negative. Fey receptor I-positive human monocyte cell lines. The third class of bispecific fusion protein employed to retarget Ad infection is rather different from those described above. Li et al. chose to exploit the common signaling pathways triggered by ligation of av integrins and growth factor receptors [61]. Consequently, they fused a mAb specific for the integrin-binding site on the Ad2/5 penton base to recombinant growth factors and cytokines (TNF-a, IGF-1, and EGF) which trigger the activation of phosphatidylinositol-3-OH kinase (PI3K), a signaling molecule involved in Ad internalization. The bifunctional antibodies were expressed in insect cells as secreted proteins. Ad vectors complexed with these bispecific molecules increased gene delivery 10- to 50-fold to human melanoma cells lacking av integrins [61]. Thus, whereas other strategies to retarget Ad vectors are based on redirecting Ad binding, with internalization mediated by av integrins, the 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 1 5 use of bispecific molecules to trigger alternative cell signaling pathways enabled the native secondary Ad receptors to be bypassed. How^ever, it would appear that the range of receptors which could be targeted in this manner is somewhat limited and lacking in cell specificity. C. Bispecific Peptides Hong et al. have retargeted Ad infection by means of a bispecific 35- mer oligopeptide comprising two distinct peptide domains [62]. One domain was a 20-mer peptide isolated from a phage library on the basis of its ability to recognize the receptor-binding region of the Ad5 knob, while the second domain corresponded to the gastrin-releasing peptide (GRP). The authors demonstrated that the relative orientation of the two domains of the bispecific peptide was crucial: only the peptide with the GRP domain at the N- terminal was capable of mediating Ad infection in a GRP receptor-dependent manner [62]. In contrast to other targeting strategies in which the bispecific molecules were complexed with the Ad vector prior to infection, in this case the bifunctional peptide was bound to the target cellular receptors prior to the addition of Ad. It is not clear whether this approach was mandated by the small size of the oligopeptide. D. Polymer-Mediated Coupling of Ligands to Ad Capsid Proteins An alternative strategy to link receptor-specific targeting peptides to the Ad capsid involves the use of polyethylene glycol (PEG). Romanczuk et aL used bifunctional PEG to couple Ad to a peptide identified by biopanning a phage display library against differentiated, ciliated airway epithelial cells [63]. Similarly, Drapkin et a\, used PEG to couple Ad to a seven-residue peptide derived from urokinase plasminogen activator [64]. In both cases, infection of the CAR-deficient target cells by the modified vector was significantly enhanced over the unmodified vector. However, the modified vectors were still able to infect HeLa cells in a CAR-dependent manner: hence, the native tropism of the modified vectors had not been abolished. Nevertheless, now that the residues of the Ad5 knob responsible for binding CAR have been identified, a truly targeted vector could readily be generated by coupling peptides to the capsid of a virion whose knob domain had been mutagenized to prevent binding to CAR. A significant advantage of the use of PEG to couple ligands to the Ad capsid is that PEGylation partially protects the virus from neutralizing antibodies both in vitro and in vivo \(iS\. In a similar approach, Fisher et al. have shown that incorporation of targeting ligands such as basic FGF and vascular endothelial growth factor on to Ad vectors coated with a multivalent hydrophilic polymer leads to ligand-mediated, CAR-independent gene transfer to target cells \(i(i\. Importantly, the polymer-coated, retargeted vector was resistant to neutralizing antibodies. 2 1 6 Krasnykh and Douglas E. Biotinylated Ad/Avidin Bridge/Biotinylated Ligand Whereas the targeting complexes described above have comprised two components, three-component complexes have also been described. In this case, an avidin or streptavidin molecule serves as a bridge to link a biotinylated Ad vector to a biotinylated ligand. Smith et al. used this strategy to enhance Ad infection of CAR-negative primitive hematopoietic cells which express the c-Kit receptor on the cell surface [67]. Biotinylated Ad vectors were linked via an avidin bridge to the biotinylated cognate ligand for the c-Kit receptor, stem cell factor. Ad-mediated gene transfer was targeted specifically to c- Kit-positive hematopoietic cell lines, resulting in up to a 2440-fold increase in gene expression. In a second example of the versatility of this strategy. Smith et al. infected CAR-negative primary T cells with Ad vectors targeted with biotinylated antibodies to CD44 (resting and activated T cells) or with biotinylated IL-2 (activated T cells only) [67]. Kreda et al. have employed a streptavidin bridge to link a biotinylated Ad vector to a small molecule agonist of the G-protein-coupled P2Y2 receptor [68]. The tropism-modified vector was able to infect Ad-resistant, well-differentiated airway epithelia cells in a VlYi receptor-specific manner. A key attribute of this targeting strategy is that it is fairly straightforward to biotinylate a range of molecules. One disadvantage is the potential problem of scaling up the procedure, but the major limitation is the fact that three components are involved, each of which would have to meet the standards laid down by the regulatory authorities before the targeted vectors could be employed in a clinical context. Overall, conjugate-based targeting of Ad vectors possesses the advantage that major structural alterations of the Ad capsid are not involved. Conse quently, a preexisting Ad vector can be complexed with a variety of bispecific targeting molecules in order to redirect infection to a number of cell or receptor types. However, the major problem is that this targeting approach employs at least two components, vector and targeting moiety, which must be produced independently and then complexed together. This can lead to significant variation between batches of tropism-modified vector. In contrast, a single-component targeted vector can be derived by genetic modification of the Ad capsid. V. Genetic Targeting As mentioned above, this Ad targeting strategy involves genetic ablation of the virus' tropism to CAR and simultaneous engineering of an alternative receptor-binding specificity to the vector by genetic engrafting of target ing ligands into protein components of the Ad capsid. Whereas the means for accomplishing the first of these tasks was a real challenge until just a 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 1 7 couple of years ago, nowadays it may be achieved rather trivially. This has become possible largely due to systematic efforts undertaken at the Brookhaven National Laboratory (BNL) and GenVec, Inc., to identify those amino acids in the Ad fiber knob domain w^hich mediate the interaction v^ith CAR. Specif ically, the BNL team used recombinant forms of the Adl2 fiber knob and the Dl domain of CAR protein to obtain crystal structures of knob-Dl com plexes [69]. The resultant three-dimensional model of the complex has allow^ed the identification of CAR-binding residues v^ithin the knob. The importance of those amino acids in CAR recognition by Ad v^as then confirmed by the genera tion of Ad virions incorporating mutated fiber proteins. The same goal has been reached by Roelvink et aL in a large-scale project on Ad5 knob mutagenesis v\rhich w âs rationalized by the identification of amino acid residues conserved in the fiber knobs of CAR-binding human Ad serotypes [70]. Although these groups utilized totally different approaches, the results of the tw ô studies corroborate each other quite nicely. It has been shov^n that the CAR-binding site w^ithin the Ad5 knob domain involves the AB- and DE- loop, as v\̂ ell as P-strands B, E, and F (Fig. 2, see color insert). Mutations of the key amino acids identified in these studies quite dramatically decrease the capacity of recombinant knob proteins or complete Ad virions bearing such mutations to bind CAR, thereby providing a simple means to ablate native Ad tropism to CAR. While this knob mutagenesis represented a universal approach to CAR ablation, engineering of novel Ad tropism may be achieved in a variety of distinct strategies. These targeting maneuvers are distinguished by genetic modifications of different components of the Ad capsid. It has been demon strated that genetic modifications of the three major proteins constituting an Ad virion, the hexon, the fiber and the penton base, may be employed to redirect the virus. A. Ad-Targeting Strategies Involving Genetic Manipulations of the Fiber Protein Logically, as the fiber normally plays the role of primary attachment of the virion to the cell, the majority of Ad targeting efforts have been based on fiber modification. To date, at least three distinct strategies of Ad targeting involving fiber modification have been used:
fiber or knob shuffling, fiber modifications via the incorporation of targeting ligands, and fiber- or knob-replacement strategies. 1. Fiber- and Knob-Shuffling Approaches This is the most obvious and straightforv^ard strategy, w^hich is based on the overall structural similarity of the fibers of different Ad serotypes and is further rationalized by the fact that representatives of these serotypes 2 1 8 Krasnykh and Douglas use different receptors to infect permissive cells. In this regard, the high degree of homology between fiber tail domains suggests that the penton base protein of a given Ad serotype may associate quite efficiently with fibers derived from different serotypes. Furthermore, the junctions between the tail and shaft, and shaft and knob, domains within the fiber protein represent convenient fusion points in those instances when a mosaic fiber protein incorporating individual domains derived from different Ad serotype fibers is designed. These considerations have resulted in a number of studies employing Ad vectors whose fibers have been either completely replaced with heterologous fiber proteins or modified to contain knobs originating from other Ad serotype fibers. The feasibility of Ad retargeting via fiber shuffling was demonstrated in pioneering work by Gall et al. who showed that by replacing the fiber gene in Ad5 genome with the gene from Ad7, a chimeric Ad vector incorporating Ad7 fibers may be generated [71]. By using two types of competition assays, the authors demonstrated that this fiber substitution resulted in the alteration of the tropism of the Ad vector. It was thus shown that exchange of the fiber is a strategy that may be used to manipulate native Ad tropism. This approach was later utilized in collaborative work conducted by researchers at the University of Iowa and Genzyme Corp. to develop better Ad vectors for human gene therapy. To this end, by screening a number of Ad serotypes for an enhanced ability to infect either the well-differentiated ciliated human airway epithelia (CHAE) or fetal rat central nervous system (CNS) cells, the authors identified Ad 17 as one of the best agents for transduction of both types of cell targets [72, 73]. Based on these data, an Ad2 vector was then genetically modified to contain the Ad 17 fiber in place of the native Ad2 fiber. The resultant virus possessed the receptor specificity and infection capacity of Ad 17. Specifically, the levels of reporter gene expression directed by this modified vector in CHAE cells were 15- to 95-fold higher than those achieved by the parental Ad2 vector [73]. Additionally, this tropism-modified vector was sevenfold more efficient than its unmodified Ad2 counterpart in transducing CNS cells in vitro [72]. These findings provide a rationale for the utilization of similar Ad vectors incorporating Adl7 fiber proteins for gene therapy approaches to the treatment of cystic fibrosis and CNS disorders. The poor transducibility of human hematopoietic stem cells (HSCs) by commonly used Ad vectors was addressed by the utilization of the fiber swapping approach in work by Shayakhmetov et al. [22]. An analysis of the binding and internalization of six different Ad serotypes (3, 4, 5, 9, 35, and 41) performed on CD34^ cells identified Ad35 as the best overall vehicle for transduction of HSCs. The subsequent generation of an Ad5 vector incorporating the Ad35 fiber protein and evaluation of its transduction capacity on CD34+ cells showed that this vector was several-fold more efficient than a control vector incorporating Ad5 fibers. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 1 9 Another example of the successful use of the fiber shuffling strategy is the result of extensive studies originated at Crucell Holland (Leiden, The Netherlands). A panel of Ad5-based vectors incorporating fibers from other serotypes v^as employed in order to identify those Ad fibers which v^ould be the most efficient in mediating infection of human DCs and cardiovascular or synovial tissues [22, 74-76], An initial screening resulted in the Ad35 fiber being the most efficient in directing Ad binding to DCs, while synovial and cardiovascular tissues were most sensitive to a chimeric vector containing Adl6 fibers. A chimeric Ad5/35 vector proved to be 100-fold more potent than an Ad5 control for gene transfer and expression in human DCs [76]. However, no maturation of the DCs was observed, in marked contrast to the studies in which Ad was targeted to CD40 [47]. In a parallel study, an Ad5 vector carrying the fiber of Adl6, showed on average, an 8- and 64-fold increase in the reporter gene expression in endothelial and smooth muscle cells, compared to the parental Ad5 vector [75]. Therefore, these findings suggest that Ad5/16 may serve as a prototype for the generation of derivative vectors carrying relevant therapeutic transgenes, which may be quite efficient as a means to treat cardiovascular disorders. According to a study by Goosens et al.^ the same vector platform shows promise as an efficient system for gene delivery to synoviocytes which do not express CAR and thus are refractory to infection by Ad5-based vectors [74]. Specifically, the authors demonstrated that an Ad5/16 vector was more potent in transducing cultured synoviocytes compared to Ad5. An observed 150-fold increase in transgene expression was caused by both the transduction of a higher percentage of synoviocytes and higher level of gene expression per transduced cell. An approach similar to fiber shuffling was realized in studies which employed genetic replacement of the Ad5 fiber knob domain with the Ad3 knob as a way to achieve the goal of Ad5 rerouting via an alternative Ad receptor [77^ 78]. In these reports, the retargeting of the vector to the, as yet unidentified, Ad3 fiber receptor suggested the utility of this knob-swapping approach in those instances where preferential expression of the Ad3 fiber receptor favors infection of Ad5-refractory cells. For instance, the vector- containing chimeric fibers outperformed the control vector incorporating Ad5 fibers in gene delivery to human fibroblasts and head and neck cancer cells [78]. Similarly, in their efforts to develop a gene delivery system for treatment of lymphoproliferative disorders. Von Seggern et al. also derived an Ad vector containing Ad5/Ad3 fiber chimeras and demonstrated its superior gene transfer properties on Epstein-Barr virus-transformed B lymphocytes [79]. Despite their attractive simplicity, the fiber- and knob-shuffling approaches are limited in their utility for gene therapy and may hardly be viewed as universal strategies with the potential to direct Ad vectors to any given type of cell target. This is due to the fact that the repertoire of target receptors is dictated by the diversity of targeting ligands available. However 2 2 0 Krasnykh and Douglas significant the transduction efficiency gains achieved in the pubfished studies, they cannot be further improved after all available Ad serotypes have been tested in the cell system of interest and the best overall candidate fiber has been identified. Whereas in the context of the fiber- or knob-shuffling approaches an investigator is strictly limited in the capacity to improve upon the vector specificity, this problem may be overcome by expanding the repertoire of targeting ligands beyond the limits of the natural diversity of Ad fibers. This concept is realized in strategies of Ad targeting based on the incorporation of targeting ligands into the Ad fiber protein or fiber-replacing molecules. 2. Ad Fiber Modifications The most significant advantage of this approach compared to the fiber- or knob-shuffling strategies is that it potentially permits the utilization of a wide range of ligands for Ad targeting. As mentioned above, these may be the natural ligands for target receptors, or alternatively they may be identified via the use of phage display technology. From a theoretical standpoint, if these tw ô methodologies are utilized in a rational manner, a virtually unlimited number of targeted Ad vectors may be derived. There are, how^ever, practical considerations v^hich may limit the usefulness of this approach. Evidently, the genetic fusion of a targeting ligand w îth the fiber protein should be accomplished in a v^ay w^hich would retain a functional configuration of both fusion partners. Therefore, the specific site in the fiber protein chosen for ligand insertion should not play any vital function which could potentially be abrogated by the ligand insertions. Furthermore, the configuration of such a site should favor the presentation of a ligand on the surface of the fiber molecule, thereby facilitating its interaction with the cognate receptor. In addition, the architecture of an Ad virion in general and the receptor-binding function of the knob in particular imply that of the three structural domains of the fiber protein, the knob is the most logical locale for presentation of targeting ligands. Thus, the configuration of the knob may apply additional limitations on the design of functional fiber-ligand fusions. Although these consideration are quite obvious, they were of little use at the time when the first attempts to modify the fiber were undertaken, as the work was initiated well before the three-dimensional model of the fiber knob domain became available. Modification of the Ad5 fiber protein was first endeavored by Michael et al.^ who demonstrated that a short peptide ligand, the gastrin-releasing peptide (GRP), genetically fused to the C-terminal of a recombinant fiber protein does not interfere with fiber trimerization and is available for binding with a GRP-specific antibody [80]. In the absence of any structural information about the knob domain, the choice of the C- terminal was rationalized by previous findings that the N-terminal of the protein is embedded in the capsid, while the C-terminal is exposed outside 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 2 1 the virion. Wickham et al. subsequently derived an Ad vector incorporating a fiber extended at the C-terminal v^ith a stretch of lysine residues in order to target this vector to heparin-containing cellular receptors [17]. This tropism expansion maneuver resulted in a vector which was able to efficiently transduce a number of Ad5-refractory cells, thereby establishing the feasibility of this genetic approach to Ad targeting. Specifically, the transduction capacity of this new vector on endothelial cells, glioblastomas, smooth muscle cells, and fibroblasts was 9- to 311-fold higher than that of unmodified control vector bearing wild-type Ad5 fibers. The same group of investigators subsequently redesigned the oligo-lysine modified vector by making AdZ.F(pK7), a vector containing seven C-terminal lysine residues, and also constructed a similar vector, designated AdZ.F(RGD), incorporating an RGD-containing peptide at the C-terminal of the fiber [18]. The latter vector was designed to target av-integrins expressed by a number of cell targets whose infection with unmodified Ad vectors is inefficient. Evaluation of these two vectors on a panel of cells which are poorly infected with Ad5 shbwed that they both were equally efficient in transducing endothefial cells, while AdZ.F(pK7) clearly outperformed AdZ.F(RGD) on smooth muscle cells and macrophages [18]. The highly augmented transduction efficiency of AdZ.F(pK7) on smooth muscle cells in tissue culture encouraged the authors to employ this vector to transduce pig iliac arteries injured by a balloon catheter. As expected from the data obtained in the in vitro studies, AdZ.F(pK7) proved to be more efficacious than its unmodified counterpart in delivering a transgene to the target tissue. This proof of concept work led to a number of spin-off studies utilizing AdZ.F(pK7) and AdZ.F(RGD) for gene delivery to a variety of CAR-deficient tissues. For instance, AdZ.F(RGD) showed superior in vivo gene transfer to the cortical vasculature in rats [81], whereas AdZ.F(pK7) proved to be useful for transduction of muscle cells at all stages of differentiation as well as mature skeletal muscle [82], myeloma cells [83], myeloid leukemic cells [84], and malignant glioma cells [85]. However, the magnitude of enhancement achieved by AdZ.F(pK7) in vivo was somewhat less than might have been anticipated from the in vitro augmentation. A series of Ad vectors similar to AdZ.F(pK7) designed by Hamada's group was used in extensive work aimed to develop gene therapy for gliomas. All the vectors used in these studies were designed on an Ad5 platform and incorporated a fiber protein with a stretch of 20 lysine residues fused via a peptide linker to the C-terminal of the fiber. The employment of this prototype vector for delivery of genes encoding cytokines IL-2 and IL-12 [86], the p53 tumor suppressor [86], prodrug-converting herpes simplex virus thymidine kinase [87], or a conditionally replicative Ad genome [88] has led to significant improvements of transgene expression and Ad-mediated killing of glioma cells. Despite the fact that the utility of C-terminal
modifications of the fiber for Ad targeting has been clearly demonstrated, it has also been reported that some 2 2 2 Krasnykh and Douglas of the attempted modifications employing rather long targeting peptides did not result in viable Ad virions [18]. Moreover, fiber modification studies performed by Hong and Engler shov^ed that the addition of a 27-amino-acid residue peptide sequence to the C-terminal of the fiber resulted in a protein incapable of assembly into trimers [4]. This led to the hypothesis that ligands exceeding a threshold of about 30 amino acids in length cannot be successfully incorporated into this locale in the fiber protein w^ithout detrimental consequences for the structure of the fiber. Evidently, these findings w^ould limit the applicability of the fiber modi fication approach should the C-terminal of the fiber be the only locale within the molecule suitable for the presentation of ligands. Fortunately, the three- dimensional model of the Ad5 fiber knob proposed by Xia et al, [89] provided the rationale for the evaluation of other sites w îthin this domain for the purpose of ligand incorporation. According to this model, the loops which connect the P-sheets R and V within each fiber knob monomer may function well as ligand- presenting structures. These loops are localized on the surface of the knob and are thus readily accessible for interactions with potential receptors (Fig. 2). The flexibility of the loops suggests that ligands incorporated within the loops would be able to assume the proper configuration required for the interac tion with their cognate receptors. The loops are not involved in intramolecular interactions; therefore, modifications of their structure should not affect the sta bility of the fiber. Additionally, alignment of the primary sequences of the knob domains of various Ad serotypes reveals that the length and amino acid compo sition of the loops varies quite significantly, implying that the incorporation of targeting ligands into the loops would be well tolerated by the knob structure. These considerations encouraged Krasnykh et ah to conduct a proof of concept study aimed to show the feasibility of Ad targeting via genetic modification of the loops within the fiber knob [90]. This was achieved by genetic incorpora tion of a ligand-mimicking octapeptide FLAG tag into the HI loop of the knob domain. First, it was shown that a fiber protein incorporating the FLAG tag expressed in baculovirus-infected insect cells retains its native trimeric config uration and binds to an affinity matrix containing an anti-FLAG antibody. It was then shown that incorporation of the peptide did not affect the ability of the modified fiber to bind to CAR-positive cells. Hence, the two key features of the fiber, trimerization and receptor binding, were both preserved in the fiber- FLAG protein, thereby rationalizing the generation of an Ad vector containing such fibers. A virus containing chimeric fiber-FLAG proteins was shown to be viable and was able to infect cells via CAR-mediated pathway. Importantly, the FLAG peptide engrafted in the virion retained its ability to bind an anti-FLAG mAb, suggesting that a peptide of a similar size possessing targeting properties should function well in the context of the HI loop of the fiber. This concept was proved in a subsequent study by the same team of investigators [91], who derived an Ad vector, Ad5lucRGD, incorporating 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 2 3 within the HI loop of the fiber knob the targeting peptide CDCRGDCFC, known as RGD-4C. This Hgand was chosen for Ad targeting based on its small size and well-documented ability to bind quite efficiently with a number of cellular integrins, which were used as target receptors in these studies. Therefore, the rationale behind this work was to target the virus directly to integrins, which normally function as the secondary Ad receptors. It was expected that the resultant virus would thus possess the capacity to enter the cell via a CAR-independent, integrin-mediated pathway. The employment of the resultant virus for gene transfer to a panel of cell targets expressing various levels of CAR and integrins proved that the HI loop-localized RGD-4C peptide was indeed able to direct the vector to integrins, thereby expanding its tropism. Importantly, it was demonstrated that as a result of this tropism expansion, the virus gained a significant advantage over its unmodified counterpart in transducing cell targets which are low in CAR expression. This infectivity enhancement was most dramatic when both viruses were applied to primary tumor cells isolated from patients with ovarian cancer. In this experiment, the reporter gene expression detected in Ad5lucRGD-transduced cells was two orders of magnitude higher than that in the cells infected with the control vector. The superior transduction efficiency of Ad5lucRGD was subsequently exploited in more extensive studies in established cell lines and primary samples of ovarian tumors 192]. Furthermore, it was later demonstrated that this vector offers another advantage in the treatment of ovarian cancer by circumventing the inhibition of Ad infection of tumor cells by neutralizing anti-fiber antibodies present in ascitic fluids in the patient's peritoneum [93]. The successful utilization of AdilucRGD to augment gene transfer to squamous cell carcinoma of head and neck cell lines [94], myelomonocytic leukemia cells [95], rhabdomyosarcoma cells [96], and glioma cells [97] by up to three orders of magnitude suggests that this vector may serve as a prototype for the derivation of agents suitable for gene therapy of various types of cancer, where CAR deficiency of target tumors undermines the efficacy of unmodified Ad5 vectors. A recent report by Asada-Mikami et al. showed another use for Ad vectors based on the AdSlucRGD platform by demonstrating the improved capacity of this vector to transduce dendritic cells [98]. A further demonstration of the utility of HI loop modifications for Ad tar geting, as well as the compatibility of this approach with the ligand definition strategy based on phage library biopanning, was provided by Xia et al. [99]. In order to design an Ad vector suitable for transduction of brain microcapillary endothelium (BME) via the transferrin receptor (TfR)-mediated pathway, these investigators screened a phage library displaying linear, nonconstrained non- apeptides on a recombinant form of the extracellular domain of human TfR and isolated a total of 42 phage clones demonstrating significant binding to 2 2 4 Krasnykh and Douglas this target. Ten of these peptides were then incorporated into the HI loop of the fiber as potential targeting ligands. Notably, the authors succeeded in rescuing only 7 of the 10 viral vectors; moreover, 2 of the rescued vectors w êre only amplified quite poorly on 293 cells. The rescued vectors v^ere then employed for gene transfer to CAR-negative cells expressing TfR. These experiments show^ed that by using TfR as a primary binding receptor, the peptide-modified Ad vectors w êre 3- to 34-fold more efficient than unmodified vectors in trans ducing the target TfR-positive cells. The successful use of these vectors for gene delivery to human BME cells proved the suitability of these agents for the purposes of gene therapy of inherited metabolic disorders causing malfunction of the central nervous system. Since the w^ork v^ith Ad vectors incorporating fibers w îth C-terminal modifications revealed the limitations relating to the size of the figands w^hich could be incorporated at this locale, it w^ould be logical to address this ligand size issue in the context of HI loop modifications of the fiber. In this regard, a pilot study using incremental increases in the size of this loop via the incorporation of heterologous protein sequences v^ith the subsequent characterization of the yields and infectivities of the resultant vectors v^ould be of high relevance. This task has been achieved in a recent study by Belousova and Krasnykh [100], w ĥo generated a panel of Ad vectors incorporating w îthin the HI loop a series of fragments of the RGD-containing loop of the Ad5 penton base protein. The results of this study shovŝ ed that heterologous protein sequences up to at least 83 amino acids long may be incorporated into the HI loop of the fiber protein v^ îthout any significant negative consequences on the viability, yield, and infectivity of the resultant vector. How^ever, these studies also revealed that the stepw^ise increments in the insert size have some adverse effects on these properties of the vector. These findings led to the conclusion that although the capacity of the HI loop to accommodate targeting ligands of moderate size is superior to that of the C-terminal of the fiber, ligands vŝ hose size exceeds a certain limit v îll not fit into this loop. Additionally, not only the size but also the configuration of a targeting ligand may become an issue w^hen the HI loop is used for ligand presentation. For instance, the functional configuration of some ligands may conflict with the framework of the HI loop. This conflict may arise when the C-terminal of a ligand needs to be directly involved in receptor binding: if this is the case, then the covalent bond between the ligand and the loop would prevent the efficient interaction of the modified Ad vector with the target cell. These considerations, together with the problems with the rescue and propagation of the Ad vectors observed in the work by Xia et al. [99], suggest that in order to increase the likelihood of the successful generation of fiber- modified Ad vectors, it will be necessary to develop an approach which would allow for the easy and fast high-throughput evaluation of newly identified targeting ligands in the context of the Ad fiber knob. The development of such 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 2 5 a method would streamline the generation of targeted Ad vectors by narrowing the range of candidate ligands to those which have maximum probability of functioning upon engrafting into the Ad capsid. Perhaps the most rational way to solve this problem would involve the generation of ligand display libraries using Ad as the vector. In such libraries, a variety of ligands would be randomly incorporated into specific locales of the Ad fiber protein and, upon rescue, the resultant diverse repertoire of modified Ad vectors would be screened for specificity for the receptors or cells of interest. However, at the present stage of development of the technology for the generation and characterization of recombinant Ad vectors, the derivation and screening of such a library presents a challenge of enormous complexity and is hardly achievable. Nevertheless, recent advances in the field have shown that there may exist some alternative approaches potentially useful in the rationalization and facilitation of the selection of ligands for Ad targeting via fiber modification. A first step in this direction was taken by Jakubczak et al. who described a method which allows the fast and easy generation of fiber-modified Ad vectors without the need to construct recombinant viral genomes and rescue recombinant virions [101]. This approach capitalizes on two key advances previously made in the Scripps Research Institute by Von Seggern et al. [79, 102]. First, the strategy takes advantage of a plasmid vector designed to express high levels of Ad fiber protein in eukaryotic cells [79]. This plasmid is used to direct the expression of the candidate modified fiber protein. Second, a helper Ad vector containing a fiber gene-deleted genome packaged into the wild type Ad5 capsid by propagation in the fiber-complementing cell line (for details see below) is used to produce fiberless Ad capsids into which the plasmid-encoded modified fiber proteins will be incorporated. The method works in the following manner: (i) a candidate fiber gene is cloned into the expression plasmid; (ii) the plasmid is then used for transfection of 293 cells, resulting in the expression of the fiber protein of interest; (iii) the transfected cells are infected with wild-type Ad virions encapsidating fiber gene-deleted genomes. If the fiber protein expressed by the plasmid retains the configuration necessary for its efficient incorporation into an Ad capsid, it transcomplements the deletion in the genome of the helper virus and is incorporated into Ad virions. The resultant virions may then be subjected to screening on a target of interest. Although the throughput of the system cannot match that of the phage display library, this strategy provides an excellent means for the generation of genetically modified fibers and their preliminary characterization in the context of complete Ad particles. Another promising approach addressing the same
issue of the ligand-fiber compatibility was developed in a recent study by Pereboev et al. [103]. The rationale for this work is to expand the utility of a traditional phage display system for the identification of targeting ligands by tailoring its format such that 2 2 6 Krasnykh and Douglas it closely mimics the ligand presentation by the Ad fiber protein. In contrast to the classical approach, where randomized ligands are genetically incorporated into one of the phage coat proteins, in this novel strategy a diversity of targeting ligands is created within the Ad5 fiber knob domain attached to the surface of the phage particle by Jun and Fos leucine zippers. Therefore, the subsequent screening of the library leads to the identification of ligands which demonstrate the ability to bind to a target receptor while engrafted directly in the fiber knob. This approach thereby counterselects against those ligands which could be identified in a biopanning experiment employing a traditional phage library, but would then fail to recognize the target upon incorporation into the Ad fiber. Further development of this proof of concept study should result in the derivation of phage libraries which would meet the most stringent criteria of selection for Ad targeting ligands. 3. Fiber- and Knob-Replacement Strategies While the new approaches developed to facilitate the identification of fiber-compatible targeting ligands may be very efficient and useful, they cannot solve the problem of the structural incompatibility of the ligand and the fiber. Furthermore, extensive use of these methods may soon show that a significant proportion of ligands is not suitable for fiber modification because of serious structural conflicts between the fiber and the ligand. The high rate of failures in documented attempts to incorporate a targeting ligand into the rather complex framework of the fiber knob domain makes these expectations quite real. Therefore, it is rational to hypothesize that the tropism of the Ad vector might be manipulated more easily and much more efficiently, if the receptor binding function in the resultant fiber molecule were structurally disengaged from the trimerization function. This goal may be achieved by generating a fiber-derived molecule in which the functions of receptor recognition and trimerization would be delegated to distinct domains within the protein. Therefore, the trimerization of such a fiber would be secured by a protein moiety introduced into the design of the "platform" fiber and would not be affected by subsequent modifications of the other domain of the chimera, which would define the vector tropism. The practical realization of this strategy would dramatically expand the range of targeting ligands compatible with the fiber modification strategy, thereby diversifying the repertoire of target receptors and target cells. Obviously, the knob domain, whose complex structure seems to restrict the range of targeting ligands and targeting approaches, should be deleted from the resultant protein. In a more general sense, only the fiber tail domain which anchors the fiber in the capsid and is thus indispensable, should be retained in the modified protein, implying that the shaft of the fiber may be replaced too. In order to maintain the trimeric structure of a knob-deleted protein, the loss of the trimerization function normally provided by the knob should be compensated by the incorporation of a heterologous protein moiety 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 2 7 into this protein. This may be achieved by designing a knob-deleted fiber containing a protein or peptide motif known to form stable homotrimers upon self-association. Two recent studies illustrate this general concept. The work by Krasnykh et al. [104] involved the generation of an Ad vector whose capsid lacked wild-type fibers but instead incorporated chimeric molecules designed to fulfill the functions normally performed by the Ad fiber. These chimeras comprised the N-terminal portion of the Ad5 fiber protein, including the tail domain and two pseudorepeats of the shaft domain, genetically fused to the bacteriophage T4 fibritin protein deleted at the N- terminal. The entire knob domain and most of the shaft domain of the fiber were deleted in this protein. Truncated fibritin was incorporated into this chimeric protein in order to provide trimerization of the resultant molecule. Previous studies on the structure of fibritin showed that, owing to the presence of the C-terminal "foldon" domain, fibritin is capable of forming homotrimers which are extremely stable under a variety of different conditions. Most importantly, it had also been demonstrated that the trimeric structure of fibritin is not compromised by either extensive N-terminal deletions or extensions of its C-terminal, thereby making fibritin an ideal "stuffer" between the fiber tail and the targeting ligand positioned at the C-terminal of the resultant chimera. A sequence of six histidine residues connected to the fibritin protein via a short peptide linker was used to demonstrate the feasibility of targeting of fibritin- containing Ad vectors to alternative cell-surface receptors by directing the modified vector to an artificial receptor, whose extracellular domain consists of an anti-His scFv [105]. First, it was shown that the fiber-fibritin 6H chimera expressed in bacteria is trimeric and binds to affinity matrix via the 6His ligand present in the protein. The subsequent incorporation of this chimera into the Ad5 capsid resulted in a stable virion capable of infecting target cells expressing the complementary receptor in a CAR-independent manner. Although fiber replacement did not affect the stability of the virus or its yield, the efficiency of infection by the new virus was lower than that by the control Ad vector containing wild-type Ad5 fibers. This decrease in infectivity may be due to the previously reported low affinity of interaction between the targeting ligand, 6His, and the ligand-binding scFv component of the artificial receptor used in the study. Fortunately, the ligand-accommodating capacity of the described fiber-fibritin chimera extends well beyond the 6His sequence, thereby allowing utilization of a wide variety of targeting ligands in the context of this prototype molecule. To this end, it has been previously demonstrated that C-terminal insertions up to at least 163 amino acids long are well tolerated by the fibritin structure [106]. A similar study was reported by Van Beusechem et al. [107], who attempted to replace the fiber knob domain with trimerizing a-helical coiled- coil domain of the Moloney murine leukemia virus p i5 envelope protein. Since p l5 is known to have low thermostability, the resultant fiber chimeras were 2 2 8 Krasnykh and Douglas rather unstable with only 5-10% of the protein being assembled into trimers. Expression of these proteins by the El-deleted Ad vectors, which also expressed the wild-type fiber, demonstrated their nuclear localization and some degree of incorporation into complete Ad virions. Importantly, the knob- or fiber-replacement strategies allow for the simultaneous fulfillment of the two tasks required for the generation of truly targeted Ad vectors: ablation of native Ad tropism to CAR and introduction of novel tropism. Equally importantly, these approaches may be applied for the generation of truly targeted vectors derived from any Ad serotype without the prior identification and ablation of the receptor-binding site within a given fiber. Although the studies described herein have demonstrated only the fea sibility of the fiber- and knob-replacement approaches for Ad targeting, the further development of these novel technologies may eventually result in significant improvements to the utility of the present generation of Ad vectors. 4. Strategies to Rescue and Propagate Truly Targeted Ad Vectors Regardless of the approach chosen for the derivation of truly targeted Ad vectors, the resultant virus should somehow be rescued and propagated. This constitutes a serious technical problem, as such a vector is, by definition, not able to infect cells via the native cell entry pathway and thus cannot be amplified in any of the cell lines normally used for this purpose. It would theoretically be possible to solve this problem on a case-by-case basis by first deriving an El-complementing cell line expressing the target receptor and then using this cell line for the rescue of the targeted Ad vector of interest. However, the practical execution of this strategy would be extremely laborious, cumbersome and thus highly inefficient. In addition, this approach would not work in those instances when an Ad vector targeted to unknown cell surface molecule was being derived. Therefore, a universal solution to the problem would be highly desirable. At least two distinct approaches have been developed to address this problem. The first strategy involves the generation of a packaging cell line which expresses the wild-type Ad fiber and may be used in the rescue and initial propagation of truly targeted Ad vectors (Fig. 3). Ideally, this cell fine should be designed to express an Ad fiber whose receptor is naturally produced by this cell line. The utilization of such a cell line will result in the production of mosaic Ad virions randomly incorporating both wild-type and modified fibers. The presence of the wild-type fiber in the resultant virions will allow the efficient infection of any cell line expressing native Ad fiber receptor, including the packaging line. After a sufficient amount of mosaic virus has been generated, this vector may then be converted into the truly targeted configuration by a final amplification step on a cell line which does not express any Ad fiber, for 8. Targeted Adenoviral Vectors I: Transductional Targeting 229 Infection Figure 3 Strategy employing a packaging cell line which expresses the wild-type Ad fiber to enable the rescue and initial propagation of truly targeted Ad vectors. In this approach, 211B cells, a derivative of 293 cells which constitutively express the Ad5 fiber protein, are transfected with an Ad5 genome containing a modified fiber gene. This results in the production of mosaic Ad virions randomly incorporating both wild-type and modified fibers. The presence of the wild-type fiber in the resultant virions allows the efficient infection of any cell line expressing native Ad fiber receptor, including the packaging line. After a sufficient amount of mosaic virus has been generated, this vector may then be converted into the truly targeted configuration by a final amplification step on a cell line which does not express any Ad fiber, for example 293 cells. example 293 [108], 911 [109], or PerC6 [110]. The feasibility and utility of this approach was first demonstrated by two groups of investigators [102, 111] who designed derivatives of the El-complementing 293 cell line, designated 211 and 293-Fib, respectively, which constitutively express the wild-type Ad5 fiber protein to enable the propagation of fiber-deleted Ad vectors. Both cell lines allowed the efficient rescue and amplification of Ad virions containing fiber gene-deleted genomes. Therefore, this strategy is quite efficient and may be used for the generation of Ad targeting vectors derived from virtually any Ad serotype. The only drawback of this approach, although purely hypothetical at this point, is that homology between the modified fiber gene contained in the genome of the targeted Ad vector and the wild-type fiber gene incorporated into the genome of the packaging cell may result in recombination and restoration of the wild-type fiber gene in the viral genome, thereby negating the whole targeting effort. In an alternative strategy, the targeted Ad vector is designed to have two different tropisms. One of the receptor specificities engineered into the virion provides virus binding to an artificial receptor, which is expressed by the 230 Krasnykh and Douglas A. B. Wild type Targeted Targeted Ad vector Ad vector Ad vector Cell expressing artificial receptor Target cell Figure 4 Strategy for utilization of an artificial receptor to provide a CAR-independent pathway of cellular entry to enable propagation of truly targeted Ad vector lacking native tropism. (A) In contrast to the wild-type vector, targeted Ad cannot utilize CAR for cell attachment and, therefore, achieves cell entry during rescue and amplification in cell culture via binding to artificial receptor. This attachment is mediated by a propagation ligand (five-pointed star) incorporated into the Ad capsid. (B) For gene delivery to target cells, the vector employs a targeting ligand (four-pointed star), which recognizes cognate receptor molecule distinct from the artificial receptor. Reproduced in modified form with permission from [141]. correspondingly modified packaging cell line (Fig. 4). This feature of the vector is only used during vector amplification in the laboratory. The other receptor specificity defines the vector tropism in the context of targeted gene delivery for gene therapy purposes. Therefore, the resultant vector contains tw ô targeting ligands of v^hich
one (the "propagation ligand") is needed during vector rescue and amplification, w^hereas the second (the "targeting ligand") directs the vector to a receptor naturally expressed by the target tissue. Importantly, the receptor chosen to facilitate Ad propagation should be entirely artificial and should not have any natural analogs. Othervs^ise, the propagation ligand may compromise the truly targeted status of the vector by randomly binding in vivo to receptors analogous to the artificial receptor expressed by the packaging cells. This approach has been realized by Douglas et al. [105], w ĥo generated a number of cell lines expressing an artificial receptor (AR), w^hich binds proteins containing C-terminal 6His tags. This receptor v^as designed by genetically fusing an anti-6His single chain antibody, scFv, v^ith the transmembrane domain of the platelet-derived grov^th factor receptor. The functional utility of this receptor w âs demonstrated by constructing an Ad vector containing 6His tag at the C-terminal of the fiber and using this vector for gene delivery to AR-expressing cells as w êll as to the parental cells lacking the AR. These studies shov^ed that the 6His-modified Ad vector can efficiently infect AR-expressing cells in a CAR-independent fashion. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 3 1 A similar system employing a hemagglutinin (HA) epitope incorporated into the Ad capsid and a complementary receptor embodying an anti-HA scFv was generated by Einfeld et al. and used for the rescue and amplification of Ad vectors lacking tropism to CAR [112]. The disadvantage of the approach using artificial receptor-expressing cell lines is that it requires additional modification of the Ad vector to carry a propagation ligand. How^ever, this is just a minor hmitation of an otherw^ise very efficient strategy, as the propagation tag may first be incorporated into the capsid of the prototype Ad vector, v^hich can subsequently be used for the generation of various targeted derivatives. B. Ad-Targeting Strategies Involving Genetic Manipulations of the Hexon and Penton Base Proteins The genetic targeting of Ad virions via modifications of the hexon or penton base proteins has not been studied as extensively as fiber-based targeting. This is primarily due to the fact that these proteins do not play a significant role in the attachment of Ad to the primary cellular receptors. Therefore their utility for Ad targeting is not immediately apparent. However, a number of considerations imply that attempts to modify Ad vector tropism by alterations to these proteins may be successful. Although the accessibility of both proteins for binding to a putative target receptor may be an issue because of structural interference with the fiber protein, it may be significantly improved by shortening the shaft of the fiber by genetic means, thereby reducing the length of the entire fiber protein. The direct binding with cellular integrins of the penton base protein of human Ad9 [113], whose fibers are significantly shorter than those in Ad5 or Ad2 virions, suggests that shortening of the fiber may be a general strategy to facilitate interactions between the penton base and a cellular receptor. The fact that Ad2 binds to P2 integrins via its penton base protein [114] indicates that under certain circumstances the shortening of the fiber is not even required for such direct binding to occur. This is further supported by the finding by Einfeld et al. that a peptide ligand incorporated into the RGD-containing loop within the penton base of Ad5 vector binds quite efficiently to an artificial receptor expressed by the target cell [112]. It has also been previously reported that genetic modifications of recombinant penton base proteins result in alterations of their binding specificity [115]. Although the hexon protein does not play a documented role in the cell entry pathway used by Ad, its abundance in the Ad capsid makes the hexon a very attractive candidate as a ligand-presenting molecule. In addition, a comparison of the amino acid sequences of several known hexons reveals the presence of a number of hypervariable regions (HVRs) in these otherwise highly conserved proteins [116]. There are significant differences in the length and amino acid composition of these regions, strongly suggesting that they 2 3 2 Krasnykh and Douglas may be used as sites for genetic alterations of the protein. A recent study by Rux and Burnett further rationahzed the use of these HVRs as potential sites for the incorporation of targeting ligands by showing their localization on the surface of the Ad virion [117]. A practical demonstration of the feasibility of Ad targeting via hexon modification was performed by Vigne et al.^ who replaced HVR5 in the Ad5 hexon protein with an RGD-containing peptide flanked with flexible linkers and demonstrated the ability of an Ad vector incorporating the modified hexon to achieve fiber-independent transduction of vascular smooth muscle cells [118]. In the aggregate, it appears that genetic modifications of the penton base and hexon proteins may eventually develop into an alternative strategy of Ad targeting, which may be used instead of, or in addition to, the fiber-based targeting approaches. VI. Transductionally Targeted Ad Vectors for Clinical Gene Therapy Applications As discussed above, the poor efficiency of Ad-mediated gene transfer in several human gene therapy trials has been correlated with a low level of expression of CAR by the target cells. Strategies to accomplish efficient cell-specific gene transfer by Ad vectors in vivo merely by exploiting physical methods to confine vector administration to isolated body compartments have proven inadequate. For example, locally administered Ad vectors carrying the herpes simplex virus thymidine kinase (HSV-TK) gene have been shown to disseminate, probably as a result of leakage into the bloodstream, resulting in a high level of liver-associated toxicity [119]. Substantial hepatic toxicity related to the absence of tumor cell-specific targeting has also been demonstrated in Ad- mediated transfer of the HSV-TK gene in an ascites model of human breast can cer [120]. Thus, targeted Ad vectors capable of efficient and cell-specific CAR- independent gene transfer are required for clinical gene therapy applications. The benefits accrued in preclinical studies using tropism-modified Ad vectors provide a strong rationale for the immediate employment of these vectors in clinical trials. As discussed above. Ad vectors modified to contain the integrin-targeting RGD motif within the HI loop of the fiber knob have permitted levels of gene transfer to CAR-deficient primary cells to be enhanced more than two orders of magnitude over unmodified vectors. Based on these observations, the University of Alabama at Birmingham is currently employing this vector backbone in Phase I clinical trials for ovarian cancer and recurrent cancer of the oral cavity and oropharynx. These trials are the first to employ tropism-modified viral vectors in human patients. It is hypothesized that the tropism-modified vectors will allow augmented transfer of the herpes simplex virus thymidine kinase and cytosine deaminase genes, respectively. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 3 3 at lower vector doses, thereby leading to increased efficacy and reduced toxicity. These two diseases represent ideal opportunities to perform the initial studies of tropism-modified Ad vectors in the clinical context. In this regard, ovarian cancer is generally confined to the peritoneal cavity, permitting vector administration by injection into that body compartment. Cancer of the oral cavity and oropharynx is a locoregional disease accessible to direct intratumoral injection of Ad vectors. Thus, the anatomical isolation of the disease targets facilitates vector administration. However, it is apparent that additional requirements will be imposed upon targeted Ad vectors designed for clinical use in disease settings for which systemic vector administration is mandated. It has been reported that intravenous administration of untargeted Ad5 vectors delivers more than 90% of the input virus to the liver, thereby reducing the titer of virus particles available for transduction of the target disease cells [121-123]. Importantly, several studies have shown that the intravenous administration of Ad vectors leads to liver toxicity [124, 125]. Thus, one of the barriers to intravenous delivery of Ad vectors in vivo is the high degree of sequestration by the liver. Zinn et al, have demonstrated that the liver uptake of intravenously administered technetium (Tc)-99m-labeled recombinant Ad5 knob in mice is significantly reduced upon coinjection of unlabeled Ad5 knob, but is not affected by Ad3 knob, which recognizes a different primary receptor [126]. This indicates that the liver possesses specific receptors for the Ad5 knob, an observation supported by the subsequent reports of high levels of CAR mRNA in the liver [7, 8]. These findings seemed to suggest that successful strate gies to reduce liver sequestration and achieve cell-specific targeting following intravenous injection of Ad vectors will necessitate modifications to the knob domain to prevent recognition of CAR. In support of this, Printz et al. [42] and Reynolds et al, [51] have observed significantly reduced transgene expression in the livers of mice injected with Ad5 vectors which are retargeted by bispecific conjugates which prevent binding to CAR. However, the effect of the conju gates in reducing hepatocytes transgene expression may not be due to CAR blockade alone. It is possible that the size of the antibody-complexed vector contributes to the reduction in hepatocyte transduction by effectively enlarging the vector particle such that it less readily transverses the small fenestrations of the mouse liver sinusoidal epithelium. The reasons for hypothesizing a mechanism other than (or in addition to) CAR blockade stem from the emerging results of studies using Ad vectors whose fibers have been genetically modified so that they no longer recognize CAR. Somewhat surprisingly, Leissner et al. observed that hepatic transgene expression mediated by CAR-ablated vectors following intravenous adminis tration into the tail vein of mice was not significantly reduced compared to unmodified vectors [127]. While the CAR-ablated vectors used in this study were suboptimal in that they did not contain a targeting ligand with specificity 2 3 4 Krasnykh and Douglas for an alternate receptor (and thus may eventually have accumulated in the liver "by default"), these results have called into question the notion that liver transduction by Ad vectors is purely due to the high level of CAR on hepato- cytes. We have in fact found that complexing Ad w îth the Fab fragment of a neutralizing anti-knob mAb was not sufficient to reduce liver transgene expres sion, w^hereas w^hen conjugated to a ligand, the same Fab fragment achieved the desired reduction. Whether this is due to particle size or the need for an effective alternate ligand is as yet unclear. Hence, modification of Ad vectors to avoid hepatocyte transduction does not appear to be as straightforw^ard as first thought. Additional mutations such as ablating the RGD motif in the penton base to avoid interaction w îth cellular integrins have been proposed and are currently under evaluation, as are studies using vectors genetically modified to increase particle size by extending shaft length with a view to diminishing viral penetration of the hepatic fenestrations. The combination of "liver untargeting" approaches with a genetically incorporated, truly specific ligand are eagerly awaited. It is clear that the development of rational strategies to facilitate the clinical application of systemically administered Ad vectors will be dependent on a better understanding of the biological basis of hepatic vector localization. The problem of liver sequestration of Ad vectors is not an issue which relates only to hepatocytes. In this regard, Reynolds et al. showed that while transductional targeting of Ad led to a reduction in hepatic transgene expres sion, the biodistribution of viral DNA 1.5 h after intravenous administration was not significantly altered [51]. The authors hypothesized that this could reflect nonspecific phagocytic uptake by Kupffer cells. It has previously been shown that 90% of Ad DNA is eliminated by the liver within 24 h in an early innate immune response and does not lead to transgene expression [128]. Inhibition of Kupffer cells reduces the elimination of Ad DNA from the liver and leads to a three- to fourfold increase in hepatic transgene expression [129, 130]. This suggests that further improvements in the use of targeted Ad vec tors for systemic gene delivery might necessitate strategies to mitigate against nonspecific sequestration of the vector by the reticuloendothelial system (RES). In accordance with this, Tao et al. have generated data in mice suggesting that low doses of Ad (1-3 x 10^^ viral particles) are efficiently taken up by the RES/Kupffer cells, whereas high doses (1 x 10^^ viral particles) saturate these cells [131]. While
the hepatic sinusoids and their fenestrations constitute a highly favorable anatomic environment for Ad entry and are thus a problem in the context of liver sequestration of the vector, anatomical factors in other tissues may actually impede Ad transduction. In support of this idea, Fechner et al. have reported that expression of CAR and av integrins does not correlate with Ad vector-mediated gene delivery in vivo [132], suggesting that anatom ical barriers, in particular the endothelium and the subendothelial matrix. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 3 5 need to be overcome in order to achieve organ-specific gene delivery. Thus, efficient gene transfer by targeted Ad vectors might require the implementation of additional methods to permeabilize anatomical barriers. In this regard, Maillard et al. have shov^n that pretreatment of the rabbit iliac artery w îth elastase could enhance Ad-mediated gene transfer to arterial smooth mus cle cells after balloon abrasion [133]. In a similar approach, Kuriyama et al. have reported that the administration of proteases to degrade the fibrous proteins of the extracellular matrix prior to intratumoral injection of Ad vec tors leads to increased Ad infection [134]. An in vitro study by Nevo et al, demonstrated that the endothelial cell monolayer presents a physical barrier to Ad infection of myocytes, which could be partially overcome by increasing endothelial permeability v^ith a-thrombin [135]. Protease digestion might also prove a rational strategy to increase the permeability of the basal lamina, which has been shown by Huard's group to present a physical barrier to the transduction of mature skeletal muscle by both untargeted and tropism- expanded Ad vectors [136, 137]. In a quite different approach, Cho et al. demonstrated that the efficiency of transduction of mature skeletal muscle could be enhanced by administering Ad vectors in a large solvent volume, thereby increasing the hydrostatic pressure and favoring vector egress out of the intravascular compartment [138]. In contrast to the anatomical situations described above, the "leaky" vasculature associated with solid tumors [139] is hypothetically favorable for the vascular egress of Ad tumor-targeted Ad vectors. Thus, it is apparent that the success of systemic administration of targeted Ad vectors will depend on a greater understanding of the receptor-independent biological factors such as vascular pharmacodynamics and anatomical barriers limiting their utility, which should, in turn, facilitate the development of rational strategies whereby these obstacles might be overcome. VII. Conclusion Key to the realization of the full potential of gene therapy is the devel opment of gene delivery vectors possessing the requisite level of efficiency and specificity. Despite a number of important biological features that make human adenoviruses a promising vector system for gene therapy, the CAR-dependence of Ad infection has been recognized as one of the major disadvantages of this vector system. In order to overcome this limitation, the concept of targeted Ad vectors capable of delivering therapeutic genes to specific subsets of cells affected by a disease was proposed in the early 1990s. A number of suc cessful studies in recent years have shown the feasibility of the concept and provided the rationale for further improvements to the currently available vectors. Moreover, the degree of specificity and efficiency of Ad-mediated 2 3 6 Krasn/kh and Douglas gene transfer from currently available vectors could be refined by combining existing strategies. For example, Ad-mediated gene transfer to a heteroge neous population of cells, such as found in a tumor, could be increased by simultaneous targeting with tw ô or more vectors targeted against distinct cell surface receptors, as described by Grill et al. [97]. Furthermore, a more exquisite level of specificity could be imposed on a transductionally targeted Ad vector by placing the expression of the transgene under the control of a tumor- or tissue-selective promoter, as described elsew^here in this volume. Additionally, v^hile this chapter has focused on the transductional targeting of replication-defective Ad vectors, it is also recognized that strategies to redirect replicating adenoviruses to achieve CAR-independent infection w îll be nec essary to realize the full potential of replicating adenoviruses in the clinical setting [140]. The studies described in this chapter have taken the field of Ad targeting from its conceptual stage to the state of a rapidly evolving branch of exper imental virology. It is novŝ becoming apparent that anatomical barriers w îll need to be overcome to enhance the utility of tropism-modified Ad vectors in the context of systemic delivery. Future w^ork should lead to the derivation of truly targeted Ad vectors suitable for a variety of clinical applications requiring highly efficient, cell-specific delivery of therapeutic genes in vivo. References 1. Henry, L. J., Xia, D., Wilke, M. E., Deisenhofer, J., and Gerard, R. D. (1994). Characteriza tion of the knob domain of the adenovirus type 5 fiber protein expressed in Escherichia coH. / . Virol 68, 5239-5246. 2. Louis, N., Fender, P., Barge, A., Kitts, P., and Chroboczek, J. (1994). Cell-binding domain of adenovirus serotype 2 fiber. / . Virol. 68, 4104-4106. 3. Novelli, A., and Boulanger, P. A. (1991). Deletion analysis of functional domains in baculovirus-expressed adenovirus type 2 fiber. Virology 185, 365-376. 4. Hong, J. S., and Engler, J. A. (1996). Domains required for assembly of adenovirus type 2 fiber trimers./. Virol 70, 7071-7078. 5. Novelli, A., and Boulanger, P. A. (1991). Assembly of adenovirus type 2 fiber synthesized in cell-free translation system./. Biol Chem. 266, 9299-9303. 6. Hong, J. S., and Engler, J. A. (1991). The amino terminus of the adenovirus fiber protein encodes the nuclear localization signal. Virology 185, 758-767. 7. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horv^itz, M. S., Crov^ell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 8. Tomko, R. P., Xu, R., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl Acad. Scu USA 94, 3352-3356. 9. Roelvink, P. W., Lizonova, A., Lee, J. G., Li, Y., Bergelson, J. M., Finberg, R. W., Brough, D. E., Kovesdi, I., and Wickham, T. J. (1998). The coxsackievirus-adenovirus receptor protein can function as a cellular attachment protein for adenovirus serotypes from subgroups A, C, D, E, and F. / . Virol 72, 7909-7915. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 3 7 10. Leon, R. P., Hedlund, T., Meech, S. J., Li, S., Schaack, J., Hunger, S. P., Duke, R. C , and DeGregori, J. (1998). Adenoviral-mediated gene transfer in lymphocytes. Proc. Natl Acad. ScL USA 95, 13,159-13,164. 11. Wang, X., and Bergelson, J. M. (1999). Coxsackievirus and adenovirus receptor cytoplasmic and transmembrane domains are not essential for coxsackievirus and adenovirus infection. / . Virol. 73, 2559-2562. 12. Freimuth, P., Springer, K., Berard, C , Hainfeld, J., Bew l̂ey, M., and Flanagan, J. (1999). Coxsackievirus and adenovirus receptor amino-terminal immunoglobulin V- related domain binds adenovirus type 2 and fiber knob from adenovirus type 12. / . Virol. 73, 1392-1398. 13. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerov^, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73,309-319. 14. Bai, M., Campisi, L., and Freimuth, P. (1994). Vitronectin receptor antibodies inhibit infection of HeLa and A549 cells by adenovirus type 12 but not by adenovirus type 2. / . Virol. 68, 5925-5932. 15. Dales, S., and Chardonnet, Y. (1973). Early events in the interaction of adenoviruses with HeLa cells. IV. Association with microtubules and the nuclear pore complex during vectorial movement of the inoculum. Virology 56, 465-483. 16. Freimuth, P. (1996). A human cell line selected for resistance to adenovirus infection has reduced levels of the virus receptor, / . Virol. 70, 4081-4085. 17. Wickham, T. J., Roelvink, P. W., Brough, D. E., and Kovesdi, L (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570-1573. 18. Wickham, T. J., Tzeng, E., Shears, L. L., Roelvink, P. W., Li, Y., Lee, G. M., Brough, D. E., Lizonova, A., and Kovesdi, I. (1997). Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. / . Virol. 71, 8221-8229. 19. Zabner, J., Freimuth, P., Puga, A., Fabrega, A., and Welsh, M.J . (1997). Lack of high affinity fiber receptor activity explains the resistance of ciliated airway epithelia to adenovirus infection./. Clin. Invest. 100, 1144-1149. 20. Pickles, R. J., McCarty, D., Matsui, H., Hart, P. J., Randell, S. H., and Boucher, R. C. (1998). Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer./. Virol. 72, 6014-6023. 21. Nalbantoglu, J., Pari, G., Karpati, G., and Holland, P. C. (1999). Expression of the primary coxsackie and adenovirus receptor is downregulated during skeletal muscle maturation and limits the efficacy of adenovirus-mediated gene delivery to muscle cells. Hum. Gene Ther. 10, 1009-1019. 22. Shayakhmetov, D. M., Papayannopoulou, T., Stamatoyannopoulos, G., and Lieber, A. (2000). Efficient gene transfer into human CD34(+) cells by a retargeted adenovirus vector. / . Virol. 74, 2567-2583. 23. Wan, Y. Y., Leon, R. P., Marks, R., Cham, C. M., Schaack, J., Gajewski, T. F., and DeGregori, J. (2000). Transgenic expression of the coxsackie/adenovirus receptor enables adenoviral-mediated gene delivery in naive T cells. Proc. Natl Acad. Sci. USA 97, 13,784-13,789. 24. Hemmi, S., Geertsen, R., Mezzacasa, A., Peter, I., and Dummer, R. (1998). The presence of human coxsackievirus and adenovirus receptor is associated with efficient adenovirus- mediated transgene expression in human melanoma cell cultures. Hum. Gene Ther. 9, 2363-2373. 25. Miller, C. R., Buchsbaum, D. J., Reynolds, P. N., Douglas, J. T., Gillespie, G. Y., Mayo, M. S., Raben, D., and Curiel, D. T. (1998). Differential susceptibility of primary and estab lished human glioma cells to adenovirus infection: targeting via the epidermal growth factor receptor achieves fiber receptor-independent gene transfer. Cancer Res. 58, 5738-5748. 2 3 8 Krasnykh and Douglas 26. Li, Y., Pong, R. C , Bergelson, J. M., Hall, M. C , Sagalowsky, A. I., Tseng, C. P., Wang, Z., and Hsieh, J. T. (1999). Loss of adenoviral receptor expression in human bladder cancer cells: a potential impact on the efficacy of gene therapy. Cancer Res. 59, 325-330. 27. Okegawa, T., Li, Y., Pong, R. C , Bergelson, J. M., Zhou, J., and Hsieh, J. T. (2000). The dual impact of coxsackie and adenovirus receptor expression on human prostate cancer gene therapy. Cancer Res. 60, 5031-5036. 28. O'Neil, K. T., Hoess, R. H., Jackson, S. A., Ramachandran, N. S., Mousa, S. A., and DeGrado, W. F. (1992). Identification of novel peptide antagonists for GPIIb/IIIa from a conformationally constrained phage peptide library. Proteins 14, 509-515. 29. Doorbar, J., and Winter, G. (1994). Isolation of a peptide antagonist to the thrombin receptor using phage display. / . Mol. Biol. 244, 361-369. 30. Goodson, R. J., Doyle, M. V., Kaufman, S. E., and Rosenberg, S. (1994). High-affinity urokinase receptor antagonists identified with bacteriophage peptide display. Proc. Natl. Acad. Sci. USA 91, 7129-7133. 31. Barry, M. A., Dower, W. J., and Johnston, S. A. (1996). Toward cell-targeting gene therapy vectors: Selection of cell-binding peptides from random peptide-presenting phage libraries. Nat. Med. 2, 299-305. 32. Pasqualini, R., Koivunen, E., and Ruoslahti, E. (1997). Alpha v integrins as receptors for tumor targeting by circulating ligands. Nat. BiotechnoL 15, 542-546. 33. Arap, W., Pasqualini, R., and Ruoslahti, E. (1998). Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 279, 377-380. 34. Pasquahni, R., Koivunen, E., Kain, R., Lahdenranta, J., Sakamoto, M., Stryhn, A., Ashmun, R. A., Shapiro, L. H., Arap, W., and Ruoslahti, E. (2000). Aminopeptidase N is a receptor for tumor-homing peptides and a target for inhibiting angiogenesis. Cancer Res. 60, 111-111. 35. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel, D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. BiotechnoL 14, 1574-1578. 36. Goldman, C. K., Rogers, B. E., Douglas, J. T., Sosnowski, B. A., Ying, W., Siegal, G. P., Baird, A., Campain, J. A., and Curiel, D. T. (1997). Targeted gene delivery to Kaposi's sarcoma cells via the fibroblast growth factor receptor. Cancer Res. 57, 1447-1451. 37. Reynolds, P. N., Miller, C. R., Goldman, C. K., Doukas, J.,
Sosnowski, B. A., Rogers, B. E., Gomez-Navarro, J., Pierce, G. F., Curiel, D, T., and Douglas, J. T. (1998). Targeting adenoviral infection with basic fibroblast growth factor enhances gene delivery to vascular endothelial and smooth muscle cells. Tumor Target. 3, 156-168. 38. Rogers, B. E., Douglas, J. T., Ahlem, C , Buchsbaum, D. J., Frincke, J., and Curiel, D. T. (1997). Use of a novel cross-linking method to modify adenoviral tropism. Gene Ther. 4, 1387-1392. 39. Rancourt, C , Rogers, B. E., Sosnowski, B. A., Wang, M., Piche, A., Pierce, G. F., Alvarez, R. D., Siegal, G. P., Douglas, J. T., and Curiel, D. T. (1998). Basic fibroblast growth factor enhancement of adenovirus-mediated delivery of the herpes simplex virus thymidine kinase gene results in augmented therapeutic benefit in a murine model of ovarian cancer. Clin. Cancer Res. 4 ,1455-1461. 40. Rogers, B. E., Douglas, J. T., Sosnowski, B. A., Ying, W., Pierce, G., Buchsbaum, D. J., DellaManna, D., Baird, A., and Curiel, D, T. (1998). Enhanced in vivo gene delivery to human ovarian cancer xenografts utilizing a tropism-modified adenovirus vector. Tumor Target. 3,15-31. 41. Gu, D. L., Gonzalez, A. M., Printz, M. A., Doukas, J., Ying, W., D'Andrea, M., Hoganson, D. K., Curiel, D. T., Douglas, J. T., Sosnowski, B. A., Baird, A., Aukerman, S. L., and Pierce, G. F. (1999). Fibroblast growth factor 2 retargeted adenovirus has redirected cellular tropism: Evidence for reduced toxicity and enhanced antitumor activity in mice. Cancer Res. 59,2608-2614. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 3 9 42. Printz, M. A., Gonzalez, A. M., Cunningham, M., Gu, D.-L., Ong, M., Pierce, G. F., and Aukerman, S. L. (2000). Fibroblast growth factor 2-retargeted adenoviral vectors exhibit a modified biolocalization pattern and display reduced toxicity relative to native adenoviral vectors. Hum. Gene Ther. 11, 191-204. 43. Chandler, L. A., Doukas, J., Gonzalez, A. M., Floganson, D. K., Gu, D. L., Ma, C , Nesbit, M., Crombleholme, T. M., Herlyn, M., Sosnowski, B. A., and Pierce, G. F. (2000). FGF2- targeted adenovirus encoding platelet-derived growth factor-B enhances de novo tissue formation. Mol. Ther. 2, 153-160. 44. Blackwell, J. L., Miller, C. R., Douglas, J. T., Li, H., Peters, G. E., Carroll, W. R., Strong, T. v. , and Curiel, D. T. (1999). Retargeting to EGFR enhances adenovirus infection efficiency of squamous cell carcinoma. Arch. Otolaryngol. Head Neck Surg. 125, 856-863. 45. Haisma, H., Pinedo, H., Rijswijk, A., der Meulen-Muileman, I., Sosnowski, B., Ying, W., Beusechem, V., Tillman, B., Gerritsen, W., and Curiel, D. (1999). Tumor-specific gene transfer via an adenoviral vector targeted to the pan-carcinoma antigen EpCAM. Gene Ther. 6, 1469-1474. 46. Kelly, F. J., Miller, C. R., Buchsbaum, D. J., Gomez-Navarro, J., Barnes, M. N., Alvarez, R. D., and Curiel, D. T. (2000). Selectivity of TAG-72-targeted adenovirus gene transfer to primary ovarian carcinoma cells versus autologous mesothelial cells in vitro. Clin. Cancer Res. 6, 4323-4333. 47. Tillman, B. W., Gruijl, T. D., Bakker, S. A., Scheper, R. J., Pinedo, H. M., Curiel, T. J., Gerritsen, W. R., and Curiel, D. T. (1999). Maturation of dendritic cells accompanies high-efficiency gene transfer by a CD40-targeted adenoviral vector. / . Immunol. 162, 6378-6383. 48. Tillman, B. W., Hayes, T. L., DeGruijl, T. D., Douglas, J. T., and Curiel, D. T. (2000). Adenoviral vectors targeted to CD40 enhance the efficacy of dendritic cell-based vaccination against human papillomavirus 16-induced tumor cells in a murine model. Cancer Res. 60, 5456-5463. 49. Schneider, H., Groves, M., Muhle, C , Reynolds, P. N., Knight, A., Themis, M., Carvajal, J., Scaravilli, F., Curiel, D. T., Fairweather, N. F., and Coutelle, C. (2000). Retargeting of adenoviral vectors to neurons using the He fragment of tetanus toxin. Gene Ther. 7, 1584-1592. 50. Trepel, M., Grifman, M., Weitzman, M. D., and Pasqualini, R. (2000). Molecular adaptors for vascular-targeted adenoviral gene delivery. Hum. Gene Ther. 11, 1971-1981. 51. Reynolds, P. N., Zinn, K. R., Gavrilyuk, V. D., Balyasnikova, I. V., Rogers, B. E., Buchs baum, D. J., Wang, M., Miletich, D. J., Grizzle, W. E., Douglas, J. T., Danilov, S. M., and Curiel, D. T. (2000). A targetable, injectable adenoviral vector for selective gene delivery to pulmonary endothefium in vivo. Mol. Ther. 2, 562-578. 52. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, L (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies./. Virol. 70, 6831-6838. 53. Harari, O. A., Wickham, T. J., Stocker, C. J., Kovesdi, L, Segal, D. M., Huehns, T. Y., Sarraf, C , and Haskard, D. O. (1999). Targeting an adenoviral gene vector to cytokine-activated vascular endothelium via E-selectin. Gene Ther. 6, 801-807. 54. Wickham, T. J., Lee, G. M., Titus, J. A., Sconocchia, G., Bakacs, T., Kovesdi, L, and Segal, D. M. (1997). Targeted adenovirus-mediated gene delivery to T cells via CD3. / . Virol. 71, 7663-7669. 55. Yoon, S. K., Mohr, L., O'Riordan, C. R., Lachapelle, A., Armentano, D., and Wands, J. R. (2000). Targeting a recombinant adenovirus vector to HCC cells using a bifunctional Fab-antibody conjugate. Biochem. Biophys. Res. Commun. 272, 497-504. 56. Watkins, S. J., Mesyanzhinov, V. V., Kurochkina, L. P., and Hawkins, R. E. (1997). The 'adenobody' approach to viral targeting: Specific and enhanced adenoviral gene delivery. Gene Ther. 4, 1004-1012. 2 4 0 Krasnykh and Douglas 57. Nicklin, S. A., White, S. J., Watkins, S. J., Hawkins, R. E., and Baker, A. H. (2000). Selective targeting of gene transfer to vascular endothelial cells by use of peptides isolated by phage display. Circulation 102, 231-237. 58. Haisma, H. J., Grill, J., Curiel, D. T., Hoogeland, S., van Beusechem, V. W., Pinedo, H. M., and Gerritsen, W. R. (2000). Targeting of adenoviral vectors through a bispecific single-chain antibody. Cancer Gene Ther. 7, 901-904. 59. Dmitriev, I., Kashentseva, E., Rogers, B. E., Krasnykh, V., and Curiel, D. T. (2000). Ectodomain of coxsackievirus and adenovirus receptor genetically fused to epidermal grov^th factor mediates adenovirus targeting to epidermal grow^th factor receptor-positive cells. / . Virol. 74, 6875-6884. 60. Ebbinghaus, C., Al-Jaibaji, A., Operschall, E., Schoffel, A., Peter, L, Greber, U. F., and Hemmi, S. (2001). Functional and selective targeting of adenovirus to high-affinity Fcgamma receptor I-positive cells by using a bispecific hybrid adapter. / . Virol. 75, 480-489. 61. Li, E., Brown, S. L., Von Seggern, D. J., Brown, G. B., and Nemerow, G. R. (2000). Signaling antibodies complexed with adenovirus circumvent CAR and integrin interactions and improve gene delivery. Gene Ther. 7, 1593-1599. 62. Hong, S. S., Galaup, A., Peytavi, R., Chazal, N., and Boulanger, P. (1999). Enhancement of adenovirus-mediated gene delivery by use of an oligopeptide with dual binding specificity. Hum. Gene Ther. 10, 2577-2586. 63. Romanczuk, H., Galer, C. E., Zabner, J., Barsomian, G., Wadsworth, S., and O'Riordan, C. R. (1999). Modification of an adenoviral vector with biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hum. Gene Ther. 10, 2615-2626. 64. Drapkin, P. T., O'Riordan, C. R., Yi, S. M., Chiorini, J. A., Cardella, J., Zabner, J., and Welsh, M. J. (2000). Targeting the urokinase plasminogen activator receptor enhances gene transfer to human airway epitheHa. / . Clin. Invest. 105, 589-596. 65. O'Riordan, C. R., Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S. C , Smith, A. E., and Francis, G. E. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum, Gene Ther. 10, 1349-1358. 66. Fisher, K. D., Stallwood, Y., Green, N. K., Ulbrich, K., Mautner, V., and Seymour, L. W. (2001). Polymer-coated adenovirus permits efficient retargeting and evades neutralising antibodies. Gene Ther. 8, 341-348. 67. Smith, J. S., Keller, J. R., Lohrey, N. C , McCauslin, C. S., Ortiz, M., Cowan, K., and Spence, S. E. (1999). Redirected infection of directly biotinylated recombinant aden ovirus vectors through cell surface receptors and antigens. Proc. Natl Acad. Sci. USA 96, 8855-8860. 68. Kreda, S. M., Pickles, R. J., Lazarowski, E. R., and Boucher, R. C. (2000). G-protein- coupled receptors as targets for gene transfer vectors using natural small-molecule ligands. Nat. Biotechnol. 18, 635-640. 69. Bewley, M. C , Springer, K., Zhang, Y. B., Freimuth, P., and Flanagan, J. M. (1999). Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579-1583. 70. Roelvink, P. W., Mi Lee, G., Einfeld, D. A., Kovesdi, I., and Wickham, T.J. (1999). Identification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571. 71. Gall, J., Kass-Eisler, A., Leinwand, L., and Falck-Pedersen, E. (1996). Adenovirus type 5 and 7 capsid chimera: Fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes./. Virol. 70, 2116-2123. 72. Chillon, M., Bosch, A., Zabner, J., Law, L., Armentano, D., Welsh, M. J., and Davidson, B. L. (1999). Group D adenoviruses infect primary central nervous system cells more efficiently than those from group C. / . Virol. 73, 2537-2540. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 4 1 73. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector v^ith a type 17 fiber enhances gene transfer to human airway epithelia. / . Virol. 73, 8689-8695. 74. Goossens, P. H., Havenga, M. J., Pieterman, E., Lemckert, A. A., Breedveld, F. C., Bout, A., and Huizinga, T. W. (2001). Infection efficiency of type 5 adenoviral vectors in synovial tissue can be enhanced with a type 16 fiber. Arthritis Rheum. 44, 570-577. 75. Havenga, M. J., Lemckert, A. A., Grimbergen, J. M., Vogels, R., Huisman, L. G., Vale- rio, D., Bout, A., and Quax, P. H. (2001). Improved adenovirus vectors for infection of cardiovascular tissues./. Virol. 75, 3335-3342. 76. Rea, D., Havenga, M. J., van Den Assem, M., SutmuUer, R. P., Lemckert, A., Hoeben, R. C., Bout, A., Melief, C. J., and Offringa, R. (2001). Highly efficient transduction of human monocyte-derived dendritic cells with subgroup B fiber-modified adenovirus vectors enhances transgene-encoded antigen presentation to cytotoxic T cells. / . Immunol. 166, 5236-5244. 77. Krasnykh, V. N., Mikheeva, G. V., Douglas, J. T., and Curiel, D. T. (1996). Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. / . Virol. 70, 6839-6846. 78. Stevenson, S. C., Rollence, M., Marshall-Neff, J., and McClelland, A. (1997). Selective targeting of human cells by a chimeric adenovirus vector containing a modified fiber protein. / . Virol. 71, 4782-4790. 79. Von Seggern, D. J., Huang, S., Fleck, S. K., Stevenson, S. C., and Nemerow, G. R. (2000). Adenovirus vector pseudotyping in fiber-expressing cell lines: Improved transduction of epstein-barr virus-transformed B cells. / . Virol. 74, 354-362. 80. Michael, S. L, Hong, J. S., Curiel, D. T., and Engler, J. A. (1995). Addition of a short peptide ligand to the adenovirus fiber protein. Gene Ther. 2, 660-668. 81. McDonald, G. A., Zhu, G., Li, Y., Kovesdi, I., Wickham, T. J., and Sukhatme, V. P. (1999). Efficient adenoviral gene transfer to kidney cortical vasculature using a fiber modified vector. / . Gene Med. 1,103-110. 82. Bouri, K., Feero, W. G., Myerburg, M. M., Wickham, T. J., Kovesdi, L, Hoffman, E. P., and Clemens, P. R. (1999). Polylysine modification of adenoviral fiber protein enhances muscle cell transduction. Hum. Gene Ther. 10, 1633-1640. 83. Gonzalez, R., Vereecque, R., Wickham, T. J., Facon, T., Hetuin, D., Kovesdi, I., Banters, F., Fenaux, P., and Quesnel, B. (1999). Transduction of bone marrow cells by the AdZ.F(pK7) modified adenovirus demonstrates preferential gene transfer in myeloma cells. Hum. Gene Ther. 10,2709-2717. 84. Gonzalez, R., Vereecque, R., Wickham, T. J., Vanrumbeke, M., Kovesdi, I., Banters, F., Fenaux, P., and Quesnel, B. (1999). Increased gene transfer in acute myeloid leukemic cells by an adenovirus vector containing a modified fiber protein. Gene Ther. 6, 314-320. 85. Staba, M. J., Wickham, T. J., Kovesdi, I., and Hallahan, D. E. (2000). Modifications of the fiber in adenovirus vectors increase tropism for malignant glioma models. Cancer Gene Ther. 7 ,13-19 . 86. Yoshida, Y., Sadata, A., Zhang, W., Saito, K., Shinoura, N., and Hamada, H. (1998). Generation of fiber-mutant recombinant adenoviruses for gene therapy of malignant glioma. Hum. Gene Ther. 9, 2503-2515. 87. Shinoura, N., Sakurai, S., Asai, A., Kirino, T., and Hamada, H. (2000). Transduction of a fiber-mutant adenovirus for the HSVtk gene highly augments the cytopathic
effect towards gliomas.//?«./. Cancer Res. 91 , 1028-1034. 88. Shinoura, N., Yoshida, Y., Tsunoda, R., Ohashi, M., Zhang, W., Asai, A., Kirino, T., and Hamada, H. (1999). Highly augmented cytopathic effect of a fiber-mutant ElB-defective adenovirus for gene therapy of gUomas. Cancer Res. 59, 3411-3416. 89. Xia, D., Henry, L. J., Gerard, R. D., and Deisenhofer, J. (1994). Crystal structure of the receptor-binding domain of adenovirus type 5 fiber protein at 1.7 A resolution. Structure 2, 1259-1270. 2 4 2 Krasnykh and Douglas 90. Krasnykh, V., Dmitriev, I., Mikheeva, G., Miller, C. R., Belousova, N., and Curiel, D. T. (1998). Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. / . Virol. 72, 1844-1852. 91. Dmitriev, I., Krasnykh, V., Miller, C. R., Wang, M., Kashentseva, E., Mikheeva, G., Belousova, N., and Curiel, D. T. (1998). An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism./. Virol. 72, 9706-9713. 92. Vanderkwaak, T. J., Wang, M., J, G. m.-N., Rancourt, C , Dmitriev, I., Krasnykh, V., Barnes, M., Siegal, G. P., Alvarez, R., and Curiel, D. T. (1999). An advanced generation of adenoviral vectors selectively enhances gene transfer for ovarian cancer gene therapy approaches. Gynecol. Oncol. 74, 227-234. 93. Blackwell, J. L., Li, H., Navarro, J., Dmitriev, I., Krasnykh, V., Richter, C. A., Shaw, D. R., Alwarez, R. D., Curiel, D. T., and Strong, T. V. (2000). Using a tropism-modified adenoviral vector to circumvent inhibitory factors in ascites fluid. Hum. Gene Ther. 11, 1657-1669. 94. Kasono, K., Blackwell, J. L., Douglas, J. T., Dmitriev, I., Strong, T. V., Reynolds, P., Kropf, D. A., Carroll, W. R., Peters, G. E., Bucy, R. T., Curiel, D. T., and Krasnykh, V. (1999). Selective gene delivery to head and neck cancer cells via an integrin targeted adenovirus vector. Clin. Cancer Res. 5, 2571-2579. 95. Garcia-Castro, J., Segovia, J. C , Garcia-Sanchez, F., Lillo, R., Gomez-Navarro, J., Curiel, D. T., and Bueren, J. A. (2001). Selective transduction of murine myelomonocytic leukemia cells (WEHI-3B) with regular and RGD-adenoviral vectors. Mol. Ther. 3, 70-77. 96. Gripe, T. P., Dunphy, E. J., Holub, A. D., Saini, A., Vasi, N. H., Mahller, Y. Y., Collins, M. H., Snyder, J. D., Krasnykh, V., Curiel, D. T., Wickham, T. J., DeGregori, J., Bergelson, J. M., and Currier, M. A. (2001). Fiber knob modifications overcome low, heterogeneous expression of the coxsackievirus-adenovirus receptor that limits adenovirus gene transfer and oncolysis for human rhabdomyosarcoma cells. Cancer Res. 61, 2953-2960. 97. Grill, J., Van Beusechem, V. W., Van Der Valk, P., Dirven, C. M., Leonhart, A., Pherai, D. S., Haisma, H. J., Pinedo, H. M., Curiel, D. T., and Gerritsen, W. R. (2001). Combined targeting of adenoviruses to integrins and epidermal growth factor receptors increases gene transfer into primary glioma cells and spheroids. Clin. Cancer Res. 7, 641-650. 98. Asada-Mikami, R., Heike, Y., Kanai, S., Azuma, M., Shirakawa, K., Takaue, Y., Krasnykh, v., Curiel, D. T., Terada, M., Abe, T., and Wakasugi, H. (2001). Efficient gene transduction by RGD-fiber modified recombinant adenovirus into dendritic cells. Jpn. J. Cancer Res. 92, 321-327. 99. Xia, H., Anderson, B., Mao, Q., and Davidson, B. L. (2000). Recombinant human ade novirus: Targeting to the human transferrin receptor improves gene transfer to brain microcapillary endothelium. J. Virol. 74, 11359-11366. 100. Belousova, N., and Krasnykh, V., unpublished data. 101. Jakubczak, J. L., Rollence, M. L., Stewart, D. A., Jafari, J. D., Von Seggern, D. J., Nemerow, G. R., Stevenson, S. C , and Hallenbeck, P. L. (2001). Adenovirus type 5 viral particles pseudotyped with mutagenized fiber proteins show diminished infectivity of coxsackie B-adenovirus receptor-bearing cells./. Virol. 75, 2972-2981. 102. Von Seggern, D. J., Kehler, J., Endo, R. I., and Nemerow, G. R. (1998). Complementation of a fibre mutant adenovirus by packaging cell lines stably expressing the adenovirus type 5 fibre protein./. Gen. Virol. 79, 1461-1468. 103. Pereboev, A., Pereboeva, L., and Curiel, D. T. (2001). Phage display of adenovirus-5 fiber knob as a tool for specific ligand selection and vafidation./. Virol. 75, 7107-7113. 104. Krasnykh, V., Belousova, N., Korokhov, N., Mikheeva, G., and Curiel, D. T. (2001). Genetic targeting of an adenovirus vector via replacement of the fiber protein with the phage T4 fibritin./. Virol. 75,4176-4183. 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 4 3 105. Douglas, J. T., Miller, C. R., Kim, M., Dmitriev, I., Mikheeva, G., Krasnykh, V., and Curiel, D. T. (1999). A system for the propagation of adenoviral vectors v^ith genetically modified receptor specificities. Nat. Biotechnol. 17, 470-475. 106. Mesyanzhinov, V., pers. commun. 107. van Beusechem, V. W., van Rijsv^ijk, A. L., van Es, H. H., Haisma, H. J., Pinedo, H. M., and Gerritsen, W. R. (2000). Recombinant adenovirus vectors w îth knobless fibers for targeted gene transfer. Gene Ther. 7, 1940-1946. 108. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-74. 109. Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houv^eling, A., Van Ormondt, H., Hoeben, R. C , and Van Der Eb, A. J. (1996). Characterization of 911: a new helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Hum. Gene Ther. 7, 215-222. 110. Fallaux, F. J., Bout, A., van der Velde, I., van den WoUenberg, D. J., Hehir, K. M., Keegan, J., Auger, C , Cramer, S. J., van Ormondt, H., van der Eb, A. J., Valerio, D., and Hoeben, R. C. (1998). Nev^ helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 111. Legrand, V., Spehner, D., Schlesinger, Y., Settelen, N., Pavirani, A., and Mehtafi, M. (1999). Fiberless recombinant adenoviruses: Virus maturation and infectivity in the absence of fiber. / . Virol. 73, 907-919. 112. Einfeld, D. A., Brough, D. E., Roelvink, P. W., Kovesdi, L, and Wickham, T.J. (1999). Construction of a pseudoreceptor that mediates transduction by adenoviruses expressing a ligand in fiber or penton base. / . Virol. 73, 9130-9136. 113. Roelvink, P. W., Kovesdi, I., and Wickham, T. J. (1996). Comparative analysis of adenovirus fiber-cell interaction: Adenovirus type 2 (Ad2) and Ad9 utilize the same cellular fiber receptor but use different binding strategies for attachment. / . Virol. 70, 7614-7621. 114. Huang, S., Kamata, T., Takada, Y., Ruggeri, Z. M., and Nemerow, G. R. (1996). Adenovirus interaction v^ith distinct integrins mediates separate events in cell entry and gene delivery to hematopoietic cells. / . Virol. 70, 4502-4508. 115. Wickham, T. J., Carrion, M. E., and Kovesdi, I. (1995). Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 2, 750-756. 116. Crawford-Miksza, L., and Schnurr, D. P. (1996). Analysis of 15 adenovirus hexon proteins reveals the location and structure of seven hypervariable regions containing serotype-specific residues./. Virol. 70, 1836-1844. 117. Rux, J. J,, and Burnett, R. (2000). Type-specific epitope locations revealed by X-ray crystal- lographic study of adenovirus type 5 hexon. Mol. Ther. 1, 18-30. 118. Vigne, E., Mahfouz, I., Dedieu, J. F., Brie, A., Perricaudet, M., and Yeh, P. (1999). RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knob-independent pathway for infection./. Virol. 73, 5156-5161. 119. Brand, K., Arnold, W., Bartels, T., Lieber, A., Kay, M. A., Strauss, M., and Dorken, B. (1997). Liver-associated toxicity of the HSV-tk/GCV approach and adenoviral vectors. Cancer Gene Ther. 4, 9-16. 120. Yee, D., McGuire, S. E., Brunner, N., Kozelsky, T. W., Allred, D. C , Chen, S. H., and Woo, S. L. (1996). Adenovirus-mediated gene transfer of herpes simplex virus thymidine kinase in an ascites model of human breast cancer. Hum. Gene Ther. 7, 1251-1257. 121. Herz, J,, and Gerard, R. D. (1993). Adenovirus-mediated transfer of low density lipoprotein receptor gene acutely accelerates cholesterol clearance in normal mice. Froc. Natl Acad. Sci. U5A 90, 2812-2816. 122. Kass-Eisler, A., Falck-Pedersen, E., Elfenbein, D. H., Alvira, M., Buttrick, P. M., and Leinwand, L. A. (1994). The impact of developmental stage, route of administration and the immune system on adenovirus-mediated gene transfer. Gene Ther. 1, 395-402. 2 4 4 Krasnykh and Douglas 123. Huard, J., Lochmuller, H., Acsadi, G., Jani, A., Massie, B., and Karpati, G. (1995). The route of administration is a major determinant of the transduction efficiency of rat tissues by adenoviral recombinants. Gene Ther. 2, 107-115. 124. O'Neal, W. K., Zhou, H., Morral, N., Aguilar-Cordova, E., Pestaner, J., Langston, C., Mull, B., Wang, Y., Beaudet, A. L., and Lee, B. (1998). Toxicological comparison of E2a-deleted and first-generation adenoviral vectors expressing alpha 1-antitrypsin after systemic delivery. Hum. Gene Ther. 9, 1587-1598. 125. Lozier, J. N., Metzger, M. E., Donahue, R. E., and Morgan, R. A. (1999). Adenovirus- mediated expression of human coagulation factor IX in the rhesus macaque is associated with dose-limiting toxicity. Blood 94, 3968-3975. 126. Zinn, K. R., Douglas, J. T., Smyth, C. A., Liu, H. G., Wu, Q., Krasnykh, V. N., Mountz, J. D., Curiel, D. T., and Mountz, J. M. (1998). Imaging and tissue biodistribution of 99mTc-labeled adenovirus knob (serotype 5). Gene Ther. 5, 798-808. 127. Leissner, P., Legrand, V., Schlesinger, Y., Hadji, D. A., van Raaij, M., Cusack, S., Pavirani, A., and Mehtali, M. (2001). Influence of adenoviral fiber mutations of viral encapsidation, infectivity and in vivo tropism. Gene Ther. 8, 49-57. 128. Worgall, S., Wolff, G., Falck-Pedersen, E., and Crystal, R. G. (1997). Innate immune mechanisms dominate elimination of adenoviral vectors following in vivo administration. Hum. Gene Ther. 8, 37-44. 129. Lieber, A., He, C. Y., Meuse, L., Schowalter, D., Kirillova, I., Winther, B., and Kay, M. A. (1997). The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors. / . Virol. 71, 8798-8807. 130. Wolff, G., Worgall, S., van Rooijen, N., Song, W. R., Harvey, B. G., and Crystal, R. G. (1997). Enhancement of in vivo adenovirus-mediated gene transfer and expression by prior depletion of tissue macrophages in the target organ. / . Virol. 71, 624-629. 131. Tao, N., Gao, G.-P., Parr, M., Johnston, J., Baradet, T., Wilson, J. M., Barsoum, J., and Fawell, S. E. (2001). Sequestration of adenoviral vector by Kupffer cells leads to a nonlinear dose response of transduction in liver. Mol. Ther. 3, 28-35 . 132. Fechner, H., Haack, A., Wang, H., Wang, X., Eizema, K., Pauschinger, M., Schoemaker, R. G., van Veghel, R., Houtsmuller, A. B., Schultheiss, H.-P., Lamers, J. M. J., and Poller, W. (1999). Expression of Coxsackie adenovirus receptor and alphav-integrin does not correlate with adenovector targeting in vivo indicating anatomical vector barriers. Gene Ther. 6, 1520-1535. 133. Maillard, L., Ziol, M., Tahlil, O., Le Feuvre, C , Feldman, L. J., Branellec, D., Bruneval, P., and Steg, P. (1998). Pre-treatment with elastase improves the efficiency of percutaneous adenovirus-mediated gene transfer to the arterial media. Gene Ther. 5, 1023-1030. 134. Kuriyama, N., Kuriyama, H., Julin, C. M., Lamborn, K., and Israel, M. A. (2000). Pre- treatment with protease is a useful experimental strategy for enhancing adenovirus-mediated cancer gene therapy. Hum. Gene Ther. 11, 2219-2230. 135. Nevo, N., Chossat, N., Gosgnach, W., Mercadier, J.-J., and Michel, J.-B. (2001). Increasing endothelial cell permeability improves the efficiency of myocyte adenoviral vector infection. / . Gene Med. 3, 42-50. 136. van Deutekom, J. C. T., Cao, B., Pruchnic, R., Wickham, T. J., Kovesdi, I., and Huard, J. (1999). Extended tropism of an adenoviral vector does not circumvent the maturation- dependent transducibility of mouse skeletal muscle. / . Gene Med. 1, 393-399. 137. Feero, W. G., Rosenblatt, J. D., Huard, J., Watkins, S. C , Epperly, M., Clemens, P. R., Kochanek, S., Glorioso, J. C , Partridge, T. A., and Hoffman, E. P. (1997). Viral gene delivery to skeletal muscle: insights on maturation-dependent loss of fiber infectivity for adenovirus and herpes simplex type 1 viral vectors. Hum. Gene Ther. 8, 371-380. 138. Cho, W. K., Ebihara, S., Nalbantoglu, J., Gilbert, R., Massie, B., Holland, P., Karpati, G., and Petrof, B. J. (2000). Modulation of Starling forces and muscle fiber maturity permits 8. Targeted Adenoviral Vectors I: Transductional Targeting 2 4 5 adenovirus-mediated gene transfer to adult dystrophic (mdx) mice by the intravascular route. Hum. Gene Ther. 11, 701-714.
139. Brown,]. M., and Giaccia, A. J. (1998).Theuniquephysiology of solid tumors: opportunities (and problems) for cancer therapy. Cancer Res 58, 1408-16. 140. Douglas, J. T., Kim, M., Sumerel, L. A., Carey, D. E., and Curiel, D. T. (2001). Efficient oncolysis by a replicating adenovirus (Ad) in vivo is critically dependent on tumor expression of primary Ad receptors. Cancer Res. 61, 813-817. 141. Krasnykh, V. N., Douglas, J. T., and van Beuschem, V. W. (2000). Genetic targeting of adenoviral vectors. Mol. Ther. 1, 391-405. C H A P T E R Targeted Adenoviral Vectors II: Transcriptional Targeting Sudhanshu P. Raikvsfar, Chinghai H. Kao, and Thomas A. Gardner Department of Urology, Microbiology, and Immunology Indiana University Medical Center Indianapolis, Indiana 46202 I. Introduction: Rationale of Transcriptional Targeting Gene therapy is an innovative approach aimed at introducing genetic material into an organism for therapeutic intent. Still in its infancy, this novel concept has witnessed fundamental preclinical success with numerous ongoing clinical trials to confirm these findings. Critical to the success of gene therapy trials are issues relating to specific delivery of physiologically active biomolecules at therapeutically significant concentrations. Initially this was achieved by using direct intralesional injections of vectors to localize the delivery to the target tissue and universal promoters to maximize expression at that site. Over the past several years, we and several other investigators have investigated the potential of tumor-specific promoters to transcriptionally regulate gene expression in the laboratory and in clinical trials. The safety demonstrated by these trials using tumor/tissue-specific promoters has led to the recent approval of a trial administering a conditionally replicative adenovirus systemically for the treatment of metastatic prostate cancer. In order for gene therapy to be widely applicable, there is an urgent need to develop a new generation of viral vectors capable of achieving these goals of targeted delivery and controlled gene expression at the target site. The aim of this chapter is to discuss various potential strategies that have been utilized to achieve tissue/tumor-specific expression using adenoviral vectors. A better understanding of tissue specific gene expression necessitates a basic review of the eukaryotic transcription process at the molecular level. Consequently, we ADENOVIRAL VECTORS FOR GENE THERAPY 2 4 7 Copyright 2002, Elsevier Science (USA). All rights reserved. 2 4 8 Gardner ef al. begin by examining the molecular architecture of DNA and its relationship with the transcriptional mechanism. li. Regulation of Transcription in Eukaryotes To fully understand the complexity underlining transcriptional targeting a brief review of the mammalian transcriptional process follows: A. Molecular Organization of DNA During interphase the genetic material in association with proteins is dispersed throughout the nucleus in the form of chromatin. At the onset of mitosis, chromatin condensation takes place and during prophase it undergoes further compression into recognizable chromosomes. The associated proteins are basic, positively charged (lysine- and arginine-containing) histones and less positively charged nonhistones including high-mobility group (HMG) proteins. Histones play a key role in chromatin structural organization and are subject to various posttranslational modifications like acetylation, phosphorylation, and ubiquitination. Histones constitute nearly half of all the chromatin protein by weight and can be divided into six types: HI , H2A, H2B, H3, H4, and H5. DNA is incorporated into a 100 A nucleosomal fiber comprising of two molecules each of H2A, H2B, H3, and H4 which form the core histone octamer along with one linker histone HI or H5. The nucleosome core particle consists of 146 base pairs of DNA while the core histone octamer interacts with about 200 base pairs of DNA. While the histones function by interacting with DNA to form nucleosome, the nonhistone proteins are responsible for performing diverse functions including tissue-specific transcription. The 100-A nucleosomal fiber is arranged into a higher order structure termed a 300-A supercoiled filament or solenoid. Evidence indicates that certain nonhistone proteins including topoisomerase II bind to chromatin every 60-100 kilobases and tether the supercoiled, 300-A filament into structural loops. Further interaction with other nonhistone proteins leads to gathering of loops into rosettes, which in association with additional nonhistones undergo condensation forming a scaffold. This is known as the radical loop-scaffold model of compaction. Special, irregularly spaced repetitive base sequences associate with nonhistone proteins to define chromatin loops. These stretches of DNA are known as scaffold-associated regions (SARs). In order to be competent for transcription, the 300-A chromatin filament must undergo decondensation. B. The Central Dogma According to the central dogma, the genetic information flows from (1) DNA to DNA during genomic replication and (2) DNA to protein during 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 4 9 gene expression. Gene expression can be simply defined as a phenomenon by which the genetic information stored in DNA is transferred to a protein. It involves tw ô distinct processes. The process by w^hich cells convert genetic information from DNA to RNA is called transcription and the decoding of RNA information to generate a specific sequence of amino acids is called translation. In addition, the flow^ of genetic information from RNA to DNA has been demonstrated in the case of retroviruses. Thus, the flov\̂ of genetic information from DNA to RNA is sometimes reversible. How^ever, this flow^ is unidirectional from RNA to protein and irreversible since, normally, the genetic information v^ithin the messenger RNA (mRNA) intermediate is not altered. How^ever, a itw exceptions in the form of RNA editing seem to challenge the present concept. RNA editing has been shov^n to alter the information content of the gene transcripts by changing the structures of individual bases and by inserting or deleting uridine monophosphate residues. Gene expression in eukaryotes is a spatially and temporally regulated process. Gene expression is regulated at multiple levels including transcription, posttranscriptional processing, nucleocytoplasmic transport, mRNA stability, translation, posttranslational modification, and intracellular trafficking of the protein. C. Transcription (Fig. 1) In eukaryotes, transcription occurs in the nucleus with the help of RNA polymerase to generate a single-stranded RNA molecule that is complementary in base sequence to the DNA template strand. There are three different types of RNA polymerases for the transcription of different types of genes. RNA polymerase I functions to transcribe ribosomal RNA (rRNA) genes to generate a large rRNA primary transcript which undergoes processing within the nucleolus to generate a 28S rRNA, a 5.8S rRNA, and an 18S rRNA. RNA polymerase II transcribes all of the protein coding genes into primary transcripts called pre-mRNAs that upon posttranscriptional processing generate mRNAs. While RNA polymerase III is known to transcribe transfer RNAs (tRNAs), 5S rRNA, and small nuclear RNAs (snRNAs). There are two main types of c/s-acting elements in all polll-transcribed genes: promoters and enhancers. The promoter, which is in close proxim ity to the protein coding region, consists of nucleotide sequences spanning approximately —40 and +50 nucleotides relative to a transcription initia tion site. A typical core promoter consists of four distinct elements: (1) A unique sequence called Goldberg-Hogness or the TATA box which has a consensus sequence TATAAAA and is located about —25 to —30 nucleotides upstream of the transcription initiation site. The TATA box alone is sufficient for independently directing a low-level polll-mediated transcription. (2) An initiator element that is functionally analogous to the TATA box and directly 250 Gardner ef o/. Figure 1 The transcriptional process of the RNA polymerase I, II, and transcribing unwound DNA to rRNA, mRNA, and tRNA, respectively. overlaps the transcription start site and has the loose consensus sequence PyPyA+lNT/APyPy. (3) The downstream core promoter element which is located approximately at position +30 downstream of the initiation site and acts in conjunction with the initiator element to direct transcription initia tion. (4) The TFIIB recognition element, which has the consensus sequence ^ / C ^ / C ^ / A C G C C and is located from - 3 2 to - 3 8 upstream of the TATA box. Another cis-acting element called the CAAT box has a consensus sequence GGCCAATCT and is located near position —70 to —80 relative to transcrip tion initiation site. Mutagenesis studies suggest a critical role of the CAAT box in modulating the promoter's ability to facilitate transcription. In addition, polll promoters often contain two conserved sequences, the SPl or GC box (GGGCGG) at about position —110 and the octamer box (ATTTGCAT); however, their positions are variable and they may occur either singly or in multiple copies. These consensus sequences are known to influence 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 5 1 the efficiency of the promoter in initiating transcription. In addition, the regu latory regions termed enhancers are located farther upstream, downstream, or within the gene. The activity of the enhancers is independent of the location, ori entation, and gene type. Although they may not be involved directly in template binding, they are capable of modulating highly efficient transcription initiation. The promoter regions are normally sequestered within the nucleosome and thus are rarely able to bind to basal transcription factors and RNA poly merase, thereby leading to transcriptional repression or silencing. In order for transcription initiation to occur, the sequestered promoter must be exposed so that it can readily bind basal factors and this is achieved by chromatin remodeling. The DNA in highly compacted chromatin is relatively resistant to nuclease DNasel digestion. Thus, sensitivity of the DNA to DNasel reveals the degree of chromatin condensation and is directly proportional to the transcrip tional activity of a particular gene. Chromatin remodeling by acetylation and deacetylation of the histone proteins represents a major regulatory mechanism during gene activation and repression, respectively. The acetylation of histones by histone acetylase causes neutralization of the lysine basic charge, which in turn causes relaxation of contacts between the histones and the DNA. Thus, acetylated histones are preferentially found in active or potentially active genes where the chromatin is less tightly packed. Further, treatment of cultured cells with compounds like sodium butyrate, which enhances histone acetylation, leads to activation of previously silenced cellular genes. The normal chromatin in the nucleosomal conformation can be converted into highly condensed heterochromatin which is transcriptionally inactive by the addition of methyl groups to a series of cytosine residues in the CpG din- ucleotides found in tissue-specific genes. Thus, methylation and demethylation may play a crucial role in tissue-specific gene regulation. Locus control regions (LCRs) are specialized regulatory sequences located several kilobases upstream of the gene and capable of modulating transcription of gene clusters by influenc ing the chromatin structure. An assembled LCR-transcription factor complex is called an enhanceosome and if any of the components of this complex are missing, transcriptional activation of the gene cluster cannot occur. Insula tors or boundary elements are regulatory sequences located in the vicinity of junctions between condensed and decondensed chromatin, which repre sent transcriptionally active and inactive loci, respectively. Insulators do not enhance transcription and are responsible for position-independent effects, but can prevent transcription when placed between an enhancer and a promoter. D. Mechanism of Transcription Eukaryotic transcription by RNA polll involves five stages: (a) formation of the preinitiation complex, (b) initiation, (c) promoter clearance, (d) elonga tion, and (e) termination. RNA polll cannot interact directly with the promoter to initiate transcription but requires recruitment to the promoter by interacting 2 5 2 Gardner et aL with transcription factors. Transcription initiation is precisely controlled by the binding of a variety of trans-acting proteins termed transcription factors to the promoter and the enhancer. Transcription factors that assist the binding of RNA polymerase II to the promoter and initiate low levels of transcription are called basal factors, while other transcription factors are termed activators and repressors by binding to the enhancers. The transcription factors that bind to the TATA box are known as the TATA-binding protein (TBP) and are essential to the initiation of transcription from all pol II genes. A number of other basal factors that associate with TBP are called TBP-associated factors (TAF//s) and help in the assembly and binding of the complex to the promoter, which in turn leads to transcription initiation. The first event in the formation of preinitiation complex involves recogni tion of the TATA box by a multisubunit TFIID complex. A complex consisting of TBP and TAF/js called TFIID specifically binds to the TATA box to induce conformational changes that favor the binding of other transcription factors like TFIIA and TFIIB, both of which can interact directly with TFIID. TFIIB
serves two critical roles in transcription initiation: (a) It acts as a bridge and recruits TFIIF/RNA polll to the promoter; and (b) it aids in the selection of the transcriptional start site. TFIIB interacts asymmetrically with TFIID-DNA and contacts the phosphodiester backbone of DNA both upstream and down stream of TATA box. The position of the amino terminus of TFIIB in the DNA-TFIID-TFIIB complex is located near the transcription start site, which might explain the role of TFIIB in stabilizing the melting of the promoter prior to RNA synthesis. Following the assembly of the DNA-TFIID-TFIIA-TFIIB complex, RNApolII is recruited to the promoter by TFIIF. TFIIF has two subunits: (1) the larger subunit, RAP74, which has an ATP-dependent DNA helicase activity which may catalyze the local unwinding of the DNA to initiate transcription, and (2) the smaller subunit, RAPS8, by which it binds tightly to the RNA polll. This is followed by binding of TFIIF to the DNA downstream from the transcriptional start point. Two other factors, TFIIH and TFIIJ are recruited to the initiation complex but their locations in the complex are unknown. The interaction of the preinitiation complex with the core promoter alone is not sufficient to initiate transcription. A sequence of events beginning with the phosphorylation of the carboxy-terminal domain of RNApolII by TFIIF followed by ATP hydrolysis set the stage for DNA melting, initiation of synthesis and promoter clearance. Most of the TFII factors dissociate before RNApolII leaves the promoter. The carboxy-terminal domain coordinates processing of RNA with transcription. The general process of transcription initiation is similar to that catalyzed by bacterial RNA polymerase. Binding of the RNApolII generates a closed complex, which is converted at a later stage to an open complex in which the DNA strands have been separated. TFIIF and TFIIH are involved in an 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 5 3 extension of the unwound region of the DNA to allow the polymerase to begin transcription elongation. Several elongation factors including TFIIF, SII, SIII, ELL, and P-TEFb function to suppress or prevent premature pausing of RNApolII as it traverses the DNA template. Early in the elongation process when the growing RNA chains are about 30 nucleotides long, the 5̂ ends of the pre-mRNAs are modified by the addition of 7-methyl guanosine caps. The 7- methyl guanosine cap contains an unusual 5^-5' triphosphate linkage and two methyl groups are added posttranscriptionally. The 7-methyl guanosine caps are recognized by protein factors involved in the initiation of translation and also help by protecting the growing RNA chains from degradation by nucleases. The 3̂ ends of the RNA transcripts are produced by endonucleolytic cleavage of the primary transcripts rather than by the termination of tran scription. The transcription termination occurs at multiple sites located 1000 to 2000 nucleotides downstream from the site that will eventually become the 3̂ end of the mature transcript. The endonucleolytic cleavage occurs 11 to 30 nucleotides downstream from the conserved consensus sequence AAUAAA, which is located near the end of the transcription unit. Following endonucleolytic cleavage, the enzyme poly(A) polymerase adds about a 200- nucleotide-long poly(A) tail to the 3̂ ends of the transcript in a process termed polyadenylation. E. Structural Motifs (Fig. 2) The transcription factors are modular in nature and contain characteristic structural motifs. The DNA binding domain as the name implies, binds to the DNA sequences present in the promoters and enhancers while the trans-actwsition domain is responsible for the activation of transcription via protein-protein interactions. The DNA binding domains have characteristic three-dimensional motifs, which result from associations between amino acids present within the polypeptide chains. Thus far, at least five types of DNA binding motifs have been extensively characterized. These include (1) helix-turn-helix (HTH) motif, (2) leucine zipper motif, (3) helix-loop-helix (HLH) motif, (4) zinc-finger motif, and (5) steroid hormone-binding motif. 1. Helix-turn-helix motif (HTH) was first discovered as the DNA- binding domain of phage repressor proteins. It is characterized by a geometric conformation that consists of two a-helical regions separated by a turn of several amino acids, which enable it to bind to DNA. Unlike other DNA binding motifs, HTH cannot function alone, but as part of a larger DNA- binding domain it fits well into the major groove of the DNA. The HTH motif has been identified in a 180-bp sequence called the homeobox, which specifies a 60-amino-acid homeodomain sequence in a large number of eukaryotic transcription factors involved in developmentally regulated genes. 254 Gardner ef a/. a. HTH b> Zinc fingers Sheet Zinc Ion a Helix Recognition helix c. bLZip Leucine side chain Leucine zipper domain Loop (dimerization domain) DNA Basic region (contacts DNA) Basic region (contacts DNA) Figure 2 The structural nnotifs exhibited by transcriptional factors. 2. Leucine zipper motif consists of a stretch of amino acids with a leucine residue in every seventh position. The leucine-rich regions form an ot-hehx v^ith a leucine residue protruding at every other turn and when two such molecules dimerize, the leucine residues zip together. The dimer contains two alpha- helical regions adjacent to the zipper, which bind to phosphate residues and specific bases in DNA, giving it a scissors-like appearance. The transcription factor API has two major components: Jun and Fos polypeptides encoded by c-jun and c-fos genes, respectively. Both Jun and Fos contain leucine zippers in their dimerization domains. A Jun leucine zipper can interact with another Jun leucine zipper to form a homodimer or with a Fos leucine zipper to form a heterodimer; however, a Fos leucine zipper is unable to interact with another Fos leucine zipper to form a homodimer. Neither Jun nor Fos alone can bind to DNA and thus in their monomeric forms, they are unable to act as transcription factors. However, Jun-Jun homodimers or Jun-Fos heterodimers are both transcription factors and bind to DNA with the same target specificity but with different affinities. The ability to form homo- or heterodimers greatly increases the repertoire of potential transcription factors a cell can assemble from a limited number of gene products. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 5 5 3. Helix-loop-helix motif consists of a stretch 40-50 amino acids con taining two amphipathic a-helices separated by a 12- to 28-amino-acid long nonhelical loop. The proteins bearing HLH form both homodimers and het- erodimers by means of interactions between the hydrophobic residues on the corresponding faces of the two helices. The HLH proteins that contain a stretch of highly basic amino acids adjacent to the HLH motif are termed bHLH proteins. These bHLH proteins are of two types: Class A consists of proteins that are ubiquitously expressed (e.g., mammalian E12/E47), while, Class B consists of proteins that are expressed in a tissue-specific manner (e.g., mammalian MyoD, myogenin, and Myf-5). 4. Zinc-finger motif was first recognized in the Xenopus RNA polIII transcription factor TFIIIA. There are several types of zinc-finger proteins, however, the classic zinc-finger consists of about 23 amino acids with a loop of 12 to 14 amino acids between the Cys and His residues and a 7-8-amino-acid linker between the loops. The consensus sequence of a typical zinc finger is Cys-X2-4-Cys-X3-Phe-X3-Leu-X2-His-X3-His. The interspersed cysteine and histidine residues covalently bind a single zinc ion to form a tetrahedral structure thereby folding the amino acids into loops. The crystal structure analysis of DNA bound by zinc fingers suggests that the C-terminal part of each finger forms a-helices that bind DNA while the N-terminal part forms a P-sheet. Three a-helices fit into one turn of the major groove and each a-helix makes two sequence-specific contacts with DNA. A zinc finger transcription factor may contain anywhere from 2 to 13 zinc fingers. Thus zinc fingers bind to DNA and also control the specificity of dimerization. Therefore, a zinc finger motif offers a novel strategy to design an artificial sequence-specific DNA-binding protein aimed at regulating specific gene expression. Recent studies indicate that it is possible to engineer zinc finger protein- based gene switches for precise and specific regulation of gene expression. Beerli et al[l] have utilized zinc-finger domains to design a polydactyl protein specif ically recognizing 9- or 18-bp sequences in the 5̂ untranslated region of the erbB-2/HER-2 promoter. They have evaluated the efficacy of gene regulation by converting the polydactyl finger into a transcriptional repressor by fusion with Kruppel-associated box (KRAB), ERF repressor domain (ERD), or mSIN3 interaction domain (SID) repressor domains. Transcriptional activators were generated by fusion with the HSV VP16 activation domain or with a tetrameric repeat of VP16's minimal activation domain, termed VP64. Their results indi cate that both gene repression and activation can be achieved by targeting designed proteins to a single site within the transcribed region of a gene. Kang and Kim [2] examined the ability of designer zinc-finger transcription factors to regulate transcription in vitro using an ecdysone-inducible system. They con structed a 268/NRE chimeric peptide by linking the three-finger peptide from Zif268, which recognizes the site 5^-GCGTGGGCG-3\ and the three-finger NRE peptide (a variant of the Zif268 peptide), which binds specifically to part 2 5 6 Gardner et aL of a nuclear hormone response element 5^-AAGGGTTCA-3^ By incorporating a 19-bp binding site for the 268/NRE near the transcriptional start site in the luciferase reporter vectors >99% repression of activated transcription was observed in vivo. Earlier studies have shown that 268/NRE peptide binds to the 19-bp recognition sequence about 6000-fold more tightly than the Zif268 peptide [3]. Imanishi et al. [4] utilized zinc fingers to create six-zinc-finger pro teins SplZF6(Gly)n by connecting two DNA-binding domains of transcription factor Spl with flexible polyglycine peptide linkers. These peptides were capa ble of inducing specific DNA bending by binding to two GC boxes and may provide an optimized approach to control gene expression by changing the DNA bending direction. Corbi et al [5] engineered a novel gene, "Jazz," that encodes for a three-zinc-finger peptide capable of binding the 9-bp DNA sequence 5 -̂ GCTGCTGCG-3^ present in the promoter region of the human and murine utrophin genes. Chimeric transcription factors Gal4-Jazz and Spl-Jazz were able to drive the expression of luciferase from the human utrophin promoter. Moore et al. [6] addressed the issue of zinc-finger DNA-binding specificity by altering the way in which zinc-finger arrays are constructed. Their results suggest that by linking three two-finger domains rather than two three-finger units, far greater target specificity and binding with picomolar affinity can be achieved through increased discrimination against mutated or closely related sequences. Taken together, the overall results suggest the potential utility of zinc-finger-based designer transcription factors in achieving regulation of gene- specific expression in diverse applications including gene therapy, functional genomics, and transgenic organisms. F. Regulation of Adenoviral DNA Transcription Process The adenovirus is a double-stranded DNA virus that has evolved to infect a host cell, transport its DNA into the nucleus of the host, replicate its DNA, use the host transcriptional apparatus to produce necessary structural proteins for replication, assemble itself, and destroy the host to release the newly formed infectious particles to perpetuate the process further. This process has been described in detail in Chapter 3. III. Approaches of Transcriptional Regulation A. Prior Rationale: Universal Promoters Several universal promoters have been utilized to attempt to maximize gene expression. The LTR, CMV, and RSV promoters were isolated from Maloney retrovirus, cytomegalovirus, and Rous sarcoma virus, respectively. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 5 7 These promoter elements were used because of the universal transcriptional activation over a broad host range. This universal transcription allowed for excellent but nondiscriminatory gene transcription and subsequent transgene expression. Because of the high levels of gene expression within several DNA constructs (i.e., viruses, cosmids, plasmids, etc.), these promoters are still used daily throughout the scientific community to test hypotheses which require uniform and high-level gene transcription. These were the promoters utilized in the first wave of gene therapy clinical trials, which focused on maximal gene expression and used local injection techniques to control the region of gene expression achieved. The LTR promoter was used to control herpes simplex virus thymidine kinase (HSV-TK) expression in a retroviral vector by placing retroviral producer cells into residual brain tumors to confer TK expression to the brain tumor, which could lead to conversion of a prodrug and subsequent tumor cell death. The CMV promoter was used in a replication- deficient adenovirus to deliver p53
gene expression after intralesional delivery to patients with both lung and head and neck tumors and is still under clinical investigation. The RSV promoter was employed to express HSV-TK after intralesional delivery in patients with several different tumor types. B. Current Rationale of Tissue-Specific Promoters A major challenge facing gene therapy is to generate vectors capable of achieving tissue- or tumor-specific expression. Initial gene therapy strate gies utilized universal promoters that demonstrated gene transfer, but were associated with toxicity associated with nonspecific gene transduction (section III.A, above). Tissue-specific promoters offer a novel approach to developing transcriptionally targeted viral vectors with enhanced potential for human gene therapy applications as described below. Several important characteristics are required to develop a tissue/tumor-specific strategy for a particular disease. Fortunately, the recent explosion in our understanding of molecular events that are present in a variety of disease processes has simplified the identification of suitable promoters. Additionally the completion of the genome project and the utilization of microarray technology have enhanced the development of tissue- or tumor-specific promoters by allowing for the identification of novel but specific molecules associated with a particular disease (e.g., cancer). The advancements in molecular cloning techniques (e.g., PCR) has allowed the investigator to extract regulatory sequences from genomic DNA and evaluate each component through site directed mutagenesis analysis in plasmid expres sion vectors. Additionally, the development of luciferase and green fluorescent protein as well as other quantifiable transgenes has enabled the investigator to test the tissue- or tumor-specific nature of a particular promoter. To illustrate the concept and utility of a tissue/tumor-specific promoter five such promoters have been selected from Table I. The basic rationale for 258 Gardner ef o/. Table I Gene Therapy Applications Of Tissue-Specific Promofers for Transcriptional Targeting Promoter Tissue-Specificity Transgene Vector References AFP HCC HSV-TK Adenoviral [27,126, 134] CD, IL-2 Adenoviral [28, 30] ElA Adenoviral [133] Albumin Liver factor VIII Adenoviral [135, 136] a-Actin Muscle GHRH Nonviral [137] a-Lactalbumin Breast cancer CD Adenoviral [138] p-Lactoglobulin Breast cancer HSV-TK Adenoviral [139] P-Globin Erythroid cells p-globin Retroviral [140] c-erbB2 Breast and HSV-TK Adenoviral [141, 142] pancreatic cancer CEA Breast, pancreatic, HSV-TK, Cre Adenoviral [15,19,21] lung, and H-ras mutant colorectal carcinoma Egr-1 Radiation induced TNF-a, LacZ Adenoviral [143, 144] E-Selectin Tumor endothelium TNF-a Retroviral [145] Flt-1 Vascular endothelial Luciferase Adenoviral [146] growth factor receptor type-1 GFAP Glial cells FasL Adenoviral [147, 148] TH Retroviral Grp78 (BIP) Anoxic/acidic tumor HSV-TK Adenoviral [149, 150] tissue HSV-TK Retroviral hAAT Hepatocytes FactorIX Nonviral [151] HGH and HGPH-a Pituitary HSV-TK, Adenoviral [152, 153] HIF-la/HRE Hypoxia inducible Erythropoietin Nonviral [154] hK2 Prostate EGFP, ElA, ElB Adenoviral [132, 155, 156] HSP Heat induced p53, TNF-a Nonviral [157] Hybrid ERE-HRE Breast Cancer Harakiri Adenoviral [158] L-Plastin Epithelial tumors LacZ Adenoviral [159] MBP Oligodendrocytes Caspase 8 Adenoviral 1160] GFP AAV [161] MCK Undifferentiated LacZ Adenoviral [162] muscle MMTV-LTR Prostated cancer antisense Retroviral [163] c-myc MN/CA9 Renal cell carcinoma ElA Adenoviral [164, 165] MUCl (DF3) Breast cancer ElA Adenoviral [166] HSV-TK Retroviral [167] Nestin Glioma, Cre, LacZ Adenoviral [168] glioblastoma 9 . Targeted Adenoviral Vectors II: Transcriptional Targeting 259 Table 1 {continued) Promoter Tissue-Specificity Transgene Vector References NSE Neurons FasL, Adenoviral [169] BDNF AAV [170] Osteocalcin Osteosarcoma HSV-TK Adenoviral [77, 79, 171-173] Prostate HSV-TK Adenoviral [174-176] ElA Adenoviral [177] PEPCK Hepatocytes Insulin Adenoviral [178] PSA Prostate Nitroreductase Adenoviral [46, 48, 49] HSV-TK, PNP Adenoviral Preproenkephalin CNS LacZ HSV [179] Probasin Prostate ElA Adenoviral [156, 180] Caspase 9 Prolactin Pituitary HSV-TK Adenoviral [181] lactotrophic cells SLPI Ovarian, cervical HSV-TK Nonviral [182] carcinoma SM22a Smooth muscle cells LacZ Adenoviral [183] Surfactant protein C Respiratory HSV-TK Adenoviral [184] epithelium Tyrosinase Melanocytes Luc, PNP Nonviral [185, 186] GALV-FMG Retroviral Tyrosine hydroxylase Sympathetic nervous LacZ HSV [122] system selection, in vitro and in vivo laboratory investigation and the clinical testing associated with each, will be briefly reviewed below. 1. Carcinoembryonic Antigen (CEA) Promoter a. Rationale Carcinoembryonic antigen is a 180-kDa cell surface gly coprotein overexpressed in 90% of gastrointestinal malignancies, including colon, gastric, rectal, and pancreatic tumors, 70% of lung cancers, and about 50% of breast cancers [7]. Thompson et al. [8] initially reported on the molec ular cloning of the CEA gene from a human genomic library. Subsequently, Schrewe et al. [9] also isolated and characterized a cosmid clone containing the entire coding region of the CEA gene including its promoter. The CEA promoter region encompasses 400 bp upstream of the translational start site and is known to confer tissue-specific CEA expression. Hauck and Stan- ners [10] demonstrated that the CEA promoter region located between —403 and —124 bp upstream of the translational initiation site is capable of directing high levels of gene expression in CEA-expressing human colon cancer CRC cells. Chen et al. [11] showed the CEA promoter region to lie between —123 and —28 bp upstream from the transcriptional start site and have demonstrated 2 6 0 Gardner et al. the presence of SPl and upstream stimulatory factor binding sites. According to Richards et al. [12] the CEA promoter is located between —90 and +69 bp upstream from the transcriptional start site and the essential sequences of the CEA promoter reside between —90 and —17 bp upstream of the transcriptional start site of the CEA gene. Cao et al. [13] compared the CEA core promoter regions between —135 and +69 bp isolated from human colorectal carcinoma and normal adjacent mucosa and found that both the sequences were identical and without any mutations. Taking advantage of this fact, various studies have suggested the potential utility of the CEA promoter for restricted expression of heterologous genes (14, 10, 12). b. In Vitro and in Vivo Experiments with CEA Promoter Takeuichi et al. [15] demonstrated that an adenoviral vector encoding a CEA promoter- driven N116Y dominant-negative H-Ras mutant was capable of suppressing liver metastasis by the human pancreatic cancer cell line PCI-43 in a nude mice model. Lan et al. [16, 17] demonstrated successful adenoviral-mediated transduction of E. coli cytosine deaminase (CD) in vitro as well as in an immunodeficient in vivo model of MKN45 gastric carcinoma. As compared to an adenoviral vector in which CD expression is driven by the constitutive CAG promoter, the expression of CD under the control of CEA promoter was confined to tumor xenografts. However, the reduction in tumor burden by AdCEA-CD/5-fluoro-cytosine (5FC), although significant, was not as great as that induced by AdCAG-CD/5FC. In fact, the CEA promoter was shown to be 200 times less active than the CAG promoter. Similar results have been described in mice bearing xenografts that were transfected with CEA-CD constructs and subsequently treated with 5-FC (18, and 12). Tanaka and colleagues [19] have used the CEA promoter sequence located between —424 and —2 bp upstream of translational start site to generate an adenoviral vector expressing HSV-TK and examined its efficacy in killing CEA-producing cancer cells in vitro and in vivo. By employing intratumoral Ad-CEA-TK injection and gancyclovir (GCV) administration, the growth of the tumors was inhibited by 20% as compared to untreated tumors. Brand et al. [20] have used the CEA promoter (—296 to +102 bp with respect to transcriptional start site) to drive the expression of HSV-TK in an adenoviral vector. Their results indicate that the CEA promoter was active in several human and rat tumor-derived cell lines but not in rat primary hepatocytes and in mouse liver, while the CMV promoter was highly active in all cell types. Although the CEA promoter-driven TK expression was less, it was sufficient to kill 100% of cancer cells, indicating a significant bystander effect. Treatment of subcutaneous tumors in SCID mice with Ad-CEA-TK was able to significantly reduce tumor growth and the tail vein injection of a high dose of this virus caused no side-effects in the liver. Kijima et al. [21] have utilized a novel Cre-lox-based strategy to achieve enhanced antitumor effect against CEA-producing human lung and colon 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 6 1 cancer cell lines. Their strategy involved generation of tw ô recombinant aden oviral vectors: one expressing the Cre recombinase gene under the control of the CEA promoter w^hile the second adenoviral vector is designed to express HSV-TK gene from the CAG promoter only after Cre excises the neomycin resistance gene (inserted betw^een the CAG promoter and HSV-TK) in a loxP site-specific manner. (Cre recombinase derived from bacteriophage PI mediates site-specific excisional deletion of a DNA sequence that is flanked by a pair of loxP sites composed of 34 nucleotides.) This novel approach requires simulta neous infection of a cell by the tv^o adenoviral vectors. Using this approach, a CEA-producing human cancer cell line w âs rendered 8.4-fold more sensitive to GCV than infection by Ad-CEA-TK alone. Intratumoral injection of Ad-CEA- Cre along v^ith Ad-lox-TK follow^ed by GCV treatment almost completely eradicated CEA-producing tumors in an athymic subcutaneous tumor model, v^hereas intratumoral injection of Ad-CEA-TK with GCV treatment shov^ed reduced tumor grow^th. 2. a-Fetoprotein (AFP) Promoter a. Rationale The human AFP gene is developmentally regulated and is expressed at high levels in the fetal liver but its transcription declines rapidly after birth and is barely detectable in adult life [22, 23]. However, overexpression of the AFP gene is a characteristic feature of human hepatocell ular carcinoma. The human AFP gene is about 20 kb long and contains 15 exons and 14 introns [24]. The cap site is located 44 nucleotides upstream of the translation initiation site and the TATA box is located 27 nucleotides upstream from the cap site and is flanked by sequences with dyad symmetry. Other sequences in the S' untranslated region include a CCAAC pentamer, a 14-bp enhancer-like sequence, a 9-bp sequence homologous to the gluco corticoid responsive element, a 90-bp direct repeat, and several alternating purine/pyrimidine sequences. The AFP promoter is 200 bp upstream of the transcriptional start site. It is regulated by hepatocyte nuclear factor 1 (HNFl), nuclear factor 1 (NFl), and CCAAT/enhancer binding protein (C/EBP). The human AFP enhancer is located between —4.9 and — 3.0 kb upstream of the transcriptional start site and consists of at least two functional domains designated A and B which have binding sites for at least four transcription factors, including HNFl , HNF3, HNF4, and C/EBP. The domain B is located at —3.7 to —3.3 kb upstream of the transcriptional start site and is solely responsible for typical enhancer effects, but maximum enhancer activity is observed together with domain A located at —5.1 to —3.7 kb. A hepatoma-specific nuclear factor termed AFPl is known to bind to an AT-rich sequence, TGATTAATAATTACA, in the B domain of the human AFP enhancer. The AFP enhancer plays a critical role in enhancing AFP gene expression in the fetal liver as well as in hepatocellular carcinoma. The AFP silencer, which is a negative c/s-acting element with a consensus sequence, 5^-CTTCATAACCTAATACTT- 3^ has been identified [25]. Two 2 6 2 Gardner ef aL transcriptional silencer elements have been identified: the proximal silencer which contains a single copy of the consensus sequence at —0.31 kb and the distal silencer at —1.75 kb which carries four copies of the consensus sequence. Of the two silencers, the distal silencer, exhibits a higher suppressive activity than the proximal silencer. The silencer activity is manifested only when the silencer is located downstream of the enhancer and upstream of the promoter. An inverse correlation exists between the silencer activity and the AFP expression levels in hepatocellular carcinoma cell lines, thereby suggesting the role of the silencer in downregulating the level of AFP expression. b. In Vitro and in Vivo Experiments with the AFP Promoter Because of its tissue-specific nature, the AFP promoter has been used in adenoviral vectors for transcriptional targeting of suicide genes in AFP-producing hepatocellular carcinoma (HCC) cells in vitro as well as in vivo. Kaneko et al, [26] developed adenoviral vectors using either the 4.9-kb AFP promoter (AvlAFPTKl) or RSV promoter (AvlTKl) to express HSV-TK gene. In vitro and in vivo cell-specific killing was observed in AFP-producing HuH7 hepatocellular carcinoma cells transduced with AvlAFPTKl and treated with GCV. In contrast to HuH7 tumors, AFP-nonproducing hepatocellular carcinoma SK-Hep-1 cells did not show complete regression when treated with AvlAFPTKl. AvlTKl was able to cause complete regression in SK-Hep-1 tumors. Using a similar approach, Kanai et al. [27] developed adenoviral vectors by incorporating AFP enhancer domains A and B (—4.0 to —3.3 kb) and a
0.17-kb AFP promoter to drive the expression of HSV-TK. These vectors conferred cell-specific killing in AFP- producing HuH-7 and HepG2 cell lines but not in non-AFP-producing HLE and HLF cell lines. Kanai et al. [28] have also reported on the development of adenoviral vectors in which the expression of £. coli CD is driven by the AFP promoter. These vectors were capable of causing regression of HCC xenografts following treatment with 5FC. Arbuthnot et al. [29] analyzed in vitro and in vivo cell-specific expression of the nuclear p-galactosidase using adenoviral vectors containing transcriptional elements derived from either rat AFP or the human insulin-like growth factor II genes. Their results indicate hepatoma cell- specific expression using AFP promoter; however, primary hepatoma cells were poorly infected by these adenoviral vectors. Bui et al. [30] compared adenoviral vector-mediated expression of IL-2 under the transcriptional control of murine AFP promoter and CMV promoters for the treatment of established human hepatocellular xenografts in CB-17/SCID mice. Intratumoral injection of these adenoviral vectors resulted in growth retardation and regression in a majority of animals but with a wider therapeutic index and less systemic toxicity using the AFP vector. Using the AFP promoter and cre-lox based approach Sato et al. [31] were able to achieve strictly tissue-specific expression of LacZ in AFP- producing cells in vitro as well as in vivo in nude mice bearing AFP-producing tumor xenografts. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 6 3 3. Prostate-Specific Antigen (PSA) Promoter a. Rationale The gene for prostate-specific antigen, a member of the glandular kallikrein family, was independently characterized by Riegman et al. [32, 33] and Lundwall [34] from a human genomic library. The gene contains five exons and is located on the long arm of chromosome 19, in the region ql33-qtQr [33]. The gene is 7130 bp long and includes 633 bp of 5̂ and 639 bp of 3̂ flanking sequence. The promoter region contains a variant TATA box (TTTATA) at position - 2 8 to - 2 3 , a GC box at - 5 3 to - 4 8 , a CACCC box at - 1 2 9 to - 1 2 5 . An imperfect palindromic sequence (AGAACAGCAAGTGCT) closely related to the reverse complement of the consensus sequence for steroid hormone receptor binding (TGTACANNNTGTC/TCT), is found at position — 170 to —156. In addition, GGGAGGG and CAGCCTC repeats are located in the region —123 to —72. Expression of PSA is primarily detected in human prostate [35-37]. Further, PSA expression has been shov^n to be androgen- responsive [38]. This is achieved by several transcription factors that are involved in regulating prostate-specific antigen gene. Tw ô functionally active androgen receptor-binding sites or androgen response elements (AREs) have been identified at positions —170 (ARE- I) and - 3 9 4 (ARE-II) [38-41]. Cleutjens et al. have identified a complex, androgen-regulated 440-bp enhancer (—4366 to —3874) w^hich contains a high-affinity AR-binding site, ARE-III (5^-GGAGGAACATATTGTATCGAT- 3^), at position —4200. In subsequent studies, a 6-kb PSA promoter fragment has been show^n to confer prostate-specific and androgen-regulated expression of P-galactosidase in transgenic mice [42]. Pang et al. [43] identified an 822-bp PSA gene regulatory sequence, PSAR w^hich w^hen combined v^ith the PSA promoter (PCPSA-P) exhibited an enhanced luciferase activity in LNCaP cells. Upon stimulation v^ith 10 to 100 nM dihydrotestosterone, a more than 1000- fold increase in expression w âs observed as compared to androgen-negative controls. Their studies further suggest that this 822-bp sequence alone could serve as a promoter, thereby indicating that the complete PSA promoter contains tw ô functional domains: a proximal promoter and a distal promoter, w^hich can also function as an enhancer. Yeung et al. [44] have identified tv^o ds-acting elements w^ithin the 5.8- kb PSA promoter that are essential for the androgen-independent activity of the PSA promoter in prostate cancer cells. Their studies provide evidence that androgen-independent activation of the PSA promoter in the androgen- independent prostate cancer cell line C4-2 involves tw ô distinct regions, a 440-bp AREc and a 150-bp pN/H, which are responsible for upregulation of the PSA promoter activity by employing two different pathways. AREc confers high basal PSA promoter activity in C4-2 cells, while pN/H is a strong AR-independent positive-regulatory element of the PSA promoter in both LNCaP and C4-2 cells. Further, a 17-bp RI fragment within the pN/H region was identified as the key cis element, which interacts with a 45-kDa 2 6 4 Gardner ef al. prostate cancer cell-specific transcription factor to mediate androgen- and AR- independent transcriptional activation of the PSA promoter. By juxtaposing AREc and pN/H, a chimeric PSA promoter has been created that exhibits 2- to 3-fold higher activity than wild-type PSA promoter in both LNCaP and C4-2 cells. Oettgen et al. [45] have identified a novel prostate epithelial-specific Ets transcription factor, PDEF, that is involved in PSA gene regulation and acts as a coregulator of AR. PDEF acts as an androgen-independent transcriptional activator of the PSA promoter. It also directly interacts with the DNA- binding domain of AR and enhances androgen-mediated activation of the PSA promoter. Thus, strong tissue-specificity of the PSA promoter makes it an ideal candidate for prostate cancer gene therapy. Latham [46] compared tissue- specific expression of luciferase reporter vectors by employing PSA, human glandular kallikrein (hKLK2), and CMV promoters in PSA-positive LNCaP and PSA-negative CoLo320, DG75, A2780, and Jurkat cells. Their studies revealed that minimal 628-bp PSA and hKLK2 promoters showed only low-level androgen-independent expression in both PSA-positive and PSA-negative cell lines. Tandem duplication of the PSA promoter slightly increased expression in LNCaP cells. Addition of the CMV enhancer upstream of the PSA or hKLK2 promoter led to substantially enhanced and nonspecific luciferase expression in all the cell lines. By placing a 1455-bp PSA enhancer sequence upstream of either the PSA or the hKLK2 promoter, a 20-fold increase in tissue-specific luciferase expression was observed. Tandem duplication of the PSA enhancer increased the expression 50-fold higher than either promoter while retaining tissue specificity. The expression from all the enhancer constructs was 100-fold above the basal levels upon induction with androgen dihydrotestosterone. b. In Vitro and in Vivo Experiments with the FSA Promoter These enhancer sequences were incorporated in adenoviral vectors to express enhanced green fluorescent protein (EGFP) and nitroreductase. The results indicate low-level expression of EGFP by PSA enhancer promoter in LNCaP cells and no expression in non-PSA-producing EJ cells when compared with CMV promoter-driven EGFP. However, the PSA enhancer promoter was able to direct expression of comparable levels of nitroreductase in a tissue-specific manner in LNCaP cells alone. These transduced LNCaP cells upon treatment with CB1954 exhibited cytotoxicity. A replication-competent adenoviral vector CN706 in which the El A gene is under the transcriptional control of the PSA enhancer/promoter has been shown to exhibit selective toxicity toward PSA- expressing prostate cancer cells [47]. Martinello-Wilks et al. [48] examined the efficacy of adenoviral vectors with a 630-bp PSA promoter-driven HSV-TK and E. coli purine nucleoside phosphorylase (PNP) genes for their ability to kill androgen-insensitive prostate cancer cell line PC-3 tumor xenografts in a nude mouse model. Both HSV-TK and E. coli PNP-expressing adenoviral vectors were able to achieve significant tumor regression in vivo following 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 6 5 GCV or 6MPDR treatment. Gotoh et al. [49] developed transcriptionally targeted recombinant adenoviral vectors by incorporating either 5837-bp long or 642-bp short PSA promoter elements to drive the expression of HSV- TK. The long PSA promoter w âs shown to have superior activity over the short promoter and was more active in C4-2 cells than in LNCaP cells. In vitro expression of TK conferred marked killing of C4-2 cells upon acyclovir treatment. Administration of this virus in an in vivo subcutaneous C4-2 tumor model, followed by acyclovir treatment, revealed significant inhibition of tumor burden. Lee et al. [50] demonstrated tissue-specific growth suppression of PSA- positive and -negative cell lines by transfecting PSA promoter enhancer-driven p53 tumor-suppressor genes. Recently, human prostate cancer- and tissue- specific genes P503, P540S, and P510S have been identified using a combination of cDNA library subtraction and high-throughput microarray screening by Xu et al. [51]. It would be interesting to characterize the promoter region of these genes and use it in developing transcriptionally targeted adenoviral vectors. 4. Osteocalcin (OC) Promoter (Fig. 3) a. Rationale Osteocalcin (bone y-carboxyglutamic acid (Gla)- containing protein (BGP)) is a 50-amino-acid, 5.8-kDa, major noncollagenous protein found in adult bone and has been shown to be transcriptionally regulated by 1,25-dihydroxyvitamin D3 [52, 53]. The human, rat, and murine osteocalcin genes have been cloned and each consists of four exons and three introns [54-57]. Montecino [58] reported that the key promoter elements are located in two DNase I-hypersensitive sites. The proximal hypersensitive site ( — 170 to —70) includes sequence motifs that specifically interact with basal transcription factors such as Msx [59-61], HLH protein Id-1 [62], AP-1 [63], a bone-specific nuclear-matrix-associated protein, NMP-2 [64], Nonprostatic Cell Prostate Cancer Cell ^ T - - . Trgi^ Tumor-specific ^^""^""^^^^;;;'' ' " ^ ^ S . transcription # ' ' ' :" - - ^ . factors f OCpmmolar ' - TK - m \ f OC promoter Figure 3 The specific ability of a tissue specific promoter such as the osteocalcin promoter to produce HSV-TK in a prostate cancer allowing cell death on prodrug (ACV) administration while sparing nonprostate cell by not allowing osteocalcin promoter activation. 2 6 6 Gardner ef al. and a member of the AML family of transcription factors [65^ 66, 71]. The distal hypersensitive domain (—600 to —400) contains the vitamin D-responsive element (VDRE, —465 to —437), which interacts with the VDR- RXRa complex in a ligand-dependent manner [67-69]. Montecino et al, [70] have demonstrated that the promoter segment —343 to —108 is critical for inducing both proximal nuclease hypersensitivity and basal transcriptional activity and the DNase I hypersensitivity at —600 is not essential for vitamin D-dependent transcriptional upregulation. Two additional NMP-2 sites (site A, - 6 0 4 to -599 ; site B, - 4 4 0 to -435) have been identified in the sequences flanking the distal DNase I-hypersensitive domain that might support specific interactions between the nuclear matrix and the OC gene promoter [64, 71]. Analysis of the 5' flanking sequence of rat osteocalcin gene reveals a modular organization of the promoter consisting of the TATAAAA sequence between —31 and —25 and the CCAAT sequence between —92 and — 88 [72]. Lian et al. [55] identified a 24-nucleotide regulatory sequence, 5'- ATGACCCCCAATTAGTCCTGGCAG-3^ in the proximal promoter region with a CAAT motif as a central element, and have designated this sequence as an osteocalcin (OC) box since only two nucleotide substitutions are found in the rat and human osteocalcin genes in this region. Hoffman et al. [59] reported that the OC box is located at nucleotide positions between —99 and —76 and TATA box containing a consensus glucocorticoid-responsive element (GRE) between —44 and —31. The stimulation of osteocalcin gene expression by 1,25- dihydroxyvitamin D3 is associated with sequence-specific binding of nuclear factors to a 26-bp sequence, 5^-CTGGGTGAATGAGGACATTACTGACC- 3', located between —462 and —437. This sequence contains a region of hyphenated dyad symmetry and shares homology with consensus steroid- responsive elements.The promoter region has been shown to contain two sites of an E-box motif (a consensus binding site for HLH proteins) termed OCEl (CACATG at -102) and OCE2 (CAGCTG at -149) [62]. Mutagenesis studies have indicated that osteoblastic-specific gene transcription is regulated via the interaction between certain E-box binding transcription factors in osteoblasts and the OCEl sequence in the promoter region of the osteocalcin gene. Banerjee et al. [63] demonstrated that an AML-1 binding sequence within the proximal promoter (nt —138 to —130) contributes to 75% of the level of osteocalcin gene expression. The promoter region is not GC-rich and does not contain a consensus sequence for the SPl binding site [73]. Theofan et al. [74] performed a detailed analysis of the BGP promoter region. Three regulatory elements that share partial homology with the consensus sequence for the GRE have been identified at nucleotide positions —356, —178, and —68, respectively. In addition, two sequences related to the consensus sequence for the metal ion-responsive element (MRE) have been identified at positions — 190 and —143. An octanucleotide sequence, TGCAGTCA, is located directly adjacent 3̂ to the second MRE. Two
other sequences that share homology 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 6 7 with the cAMP-responsive element are found at —437 (TGAGGACA) and —392 (TCACGGCA). The BGP promoter region also contains several pairs of inverted repeat sequences that form regions of dyad symmetry. Three particularly long regions of imperfect dyad symmetry are located between - 5 2 3 and -504 , - 2 3 4 and -214 , and - 5 1 and - 2 8 . An octanucleotide palindromic sequence from —134 to —127 partially overlaps both a putative MRE and a cAMP-responsive element. A short sequence, GCAG, or its complement, CTGC, is repeated 17 times. A region of alternating purines and pyrimidines at location —90 to —81 from the CAT box has the potential to form a Z-DNA structure which may be important in gene regulation. A 7-bp osteocalcin silencer element, 5^-TGGCCCT-3^, has been located between +29 and +35 position in the first exon of the human osteocalcin gene, while two silencer elements, 5'-CCTCCT-3^ (nt +106 to +111 and +135 to +140) and 5'-TTTCTTT-3' (nt +118 to +124), have been located in the first intron of the rat osteocalcin gene [75^ 76]. b. In Vitro and in Vivo Experiments with the OC Promoter Ko et al, [77] developed an osteocalcin-promoter-driven TK-expressing recom binant adenoviral vector to achieve tissue-specific killing of osteosarcoma cells in experimental animal model. Administration of this vector followed by acyclovir treatment led to a significant growth inhibition of osteosarcoma in an experimental animal model. Cheon et al. [78] used a chemogene therapy approach by combining OC-promoter-driven TK expression and acyclovir with a methotrexate treatment regimen in nude mice bearing either subcutaneous human osteosarcoma (MG-63) or rat osteosarcoma (ROS) xenografts. Their results indicate that osteosarcoma tumor growth was more efficiently inhibited due to synergistic effects of combined methotrexate and acyclovir treatment. Shirakawa et al. [79] further demonstrated the potential utility of an aden oviral osteocalcin promoter-mediated suicide gene therapy for osteosarcoma pulmonary metastasis in nude mice. Hou et al. [80] demonstrated osteoblast- specific gene expression in adherent bone marrow cells using a 1.7-kb rat OC-CAT gene. Recipient mice were shown to be positive for osteoblast-specific expression following bone marrow transplantation. Using a replication-defective adenovirus, Ad-OC-TK, we have completed a phase I clinical trial that demonstrated the expected safety profile and gene transfer that we expected. Eleven men with recurrent or metastatic prostate cancer were enrolled in a phase I intralesional dose-escalating trial, combining two Ad-OC-TK injections with 3 weeks of valacyclovir administration. In sum mary, this was well tolerated at all doses reaching a maximum of 5 x 10^^ pfu (or 1 X 10^^ vp) in patients in the high-dose group. Viral distribution stud ies revealed that after intralesional administration the patients demonstrated a measurable viremia for 2 - 3 days. Despite the presence of viral particles at these time points, no patient demonstrated hepatotoxity with valacyclovir admin istration. This is in direct contrast to intralesional delivery of Ad-RSV-TK 2 6 8 Gardner ef al. to the prostatic recurrence, in which patients experience hepatotoxicity upon prodrug administration. Finally, comparison of biopsy specimens prior to the first (day 0) and second (day 7) injection and at the end of the study (day 30) revealed successful gene transfer at day 7 by immunohistochemical stain ing for HSV-TK and some evidence of tumor destruction by day 30. These expected and encouraging results have led us to propose a phase I trial to test the transcriptional ability of the osteocalcin promoter to regulate adenoviral replication in a similar format. 5. MN/CA9 Promoter a. Rationale The human MN/CA9 gene has been isolated, sequenced, and characterized by Opavsky [81]. This gene is a member of the carbonic anhydrase (CA) family, which codes for a diverse group of catalysts of the reversible conversion of carbon dioxide to carbonic acid. MN/CA9 expression has been detected in several types of carcinomas including renal, ovarian, and cervical, as well as in normal gastric mucosa [82-85]. The complete genomic sequence of the MN/CA9 gene including the 5^-flanking region encompasses 10.9 kb with a coding sequence comprising of 11 exons. The MN/CA9 protein contains 459 amino acids with a molecular weight ranging from 54 to 58 kDa. MN displays CA activity and binds zinc [86]. The nucleotide sequence close to the 5' end shows 91.4% sequence homology to the U3 region of the long terminal repeats (LTRs) of the human HERV-K endogenous retroviruses [87]. This LTR-like sequence is 222 bp long with an A-rich tail at its 3̂ end. Analysis of the MN/CA9 promoter region between —507 and +1 upstream of the transcription initiation site indicates that despite the presence of 60% GC residues, the additional features of TATA-less promoters are absent, but the presence of consensus sequences for API, AP2, and p53 transcription factor binding sites has been demonstrated [88-90]. Functional characterization of the 3.5-kb MN 5' upstream region by deletion analysis led to the identification of —173 to +31 fragment as the MN promoter. The promoter region lacks the CpG-rich islands that are typical for TATA-less promoters but contains two nonoverlapping consensus initiator sequences required for promoter activity. b. In Vitro and in Vivo Experiences with MN Initial in vitro studies with this promoter driving luciferase expression demonstrated tumor specificity for both renal cell carcinoma and cervical carcinoma. Based on the expression assays, we have constructed an oncolytic adenovirus with the MN promoter which has demonstrated 40- to 100-fold increased killing in human renal cell carcinomas compared to control cell lines not expressing this promoter activity. We are currently evaluating this oncolytic vector in animal models of human renal cell carcinoma. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 6 9 C. Inducible Transcription The ability to precisely regulate spatial and temporal expression of a particular gene is likely to have a significant impact in the field of human gene therapy. In order to be effective, such an approach must necessarily fulfill several criteria, including: (1) biological safety, (2) ease of administration, (3) low^ basal expression, (4) high and gene-specific inducibility, (5) reversibility, and (6) (preferably) of human origin to minimize immunogenicity. A w îde variety of inducible systems for regulating gene expression have been developed. These include the use of metal response promoter [91], heat-shock promoter [92], the glucocorticoid-inducible promoter [93], IPTG-inducible lac repressor/operator system [94, 95], tetracycline-inducible system [96], RU486-inducible system [97], ecdysone- inducible system [100], FK506/rapamycin-inducible system [101], hypoxia- inducible factor 1 system [102], radiation-inducible system [103], and the tamoxifen-inducible system [104]. It is beyond the scope of this chapter to provide in-depth information on all of the above-mentioned inducible systems. Consequently, v̂ e v îll focus on those inducible systems that might have the greatest potential for human gene therapy applications. 1. Tetracycline-Inducible System The tet-inducible system originally developed by Bujard and cow^ork- ers [94, 105] is v^idely used to regulate gene expression. The tet-inducible system is based on the tetracycline resistance operon of E. colt. The system utilizes the specificity of the tet repressor (tetR) for the tet operator sequence (tetO), the sensitivity of tetR to tetracycline, and the potent transactivator function of herpes simplex virus protein VP16. The system is based upon the concept of negatively regulating the transcription of the bacterial resistance gene by tetR protein binding to tetO DNA sequences. Addition of tetracycline or doxycycline causes derepression by binding to the tetR protein, thereby allow^ing transcription to proceed. This has been achieved by employing a tet transactivator (tTA) v\̂ hich is a chimeric tetracycline-repressed transactivator generated by fusing the carboxy terminal of tetR protein to the carboxy ter minal 127 amino acids of VP16. The tTA, w^hen bound to tetracycline, is prevented from binding to seven copies of tetO sequences, v^hich are jux taposed upstream of a minimal human cytomegalovirus promoter, thereby selectively turning off the transcription of the gene in question. Removal of tetracycline results in binding of tTA to the tetO sequences in the tet-inducible promoter, follov^ing which the VP16 moiety of tTA transactivates the target gene by promoting assembly of a transcriptional initiation complex, thereby selectively turning on the gene expression. A recent modification of this system allow^s for selective induction of gene expression in the presence of tetracycline. In this strategy, a mutated tetR, called reverse tTA (rtTA), has been generated by incorporating 4 amino acid changes into tTA, thereby facilitating rtTA 2 7 0 Gardner ef a/. binding to the tetO sequence in the presence of tetracycHne. Another variation involves fusion of tTA v^ith the KRAB repressor domain of the human zinc- finger protein Koxl. Upon binding to tetO sequences, this protein is capable of blocking transcription as far as 3 kb dov^nstream [106]. A further variation has revealed that by placing two minimal promoters in opposite orientations on either side of the tetO sequences, it is possible to simultaneously regulate the expression of tw ô genes from a single plasmid [107]. Massie et al. [108] used the tet-inducible system to generate a recombinant adenoviral vector encoding a deletion in the Rl subunit of the herpes simplex virus type 2 ribonucleotide reductase. Topical and tetracycline-inducible gene expression in transgenic mice carrying a gene under the tet-inducible promoter has been achieved by adenovirus mediated gene transfer and expression of tTA [109]. Rubinchik et al. [110] developed a tet-inducible, double recombinant adenoviral vector expressing a fusion of murine FasL and green fluorescent protein. In this virus, the tet-responsive element and the transactivator element are built into opposite ends of the same vector to avoid enhancer interference. The in vitro expression of FasL-GFP in various cell lines could be conveniently regulated by tetracycline or doxycycline in a dose-dependent manner. 2. FK506/Rapamycin-Inducible System The latest in the armamentarium of inducible gene expression systems are the chemical dimerizers that rely upon drug-dependent recruitment of a transactivation domain to a basal promoter to drive the expression of the ther apeutic gene. The strategy is based upon generating a genetic fusion composed of a heterologous DNA-binding domain and an activation domain v^ith the drug binding domain, thereby enabling a bivalent drug to crosslink the tw ô proteins and reconstitute an active transcription factor. This is achieved by using small cell-permeable immunosuppressive molecules, FK506, rapamycin, and cyclosporine, to bind members of the immunophilin family. The FK506 molecule binds tightly to the cellular protein, FKBP12, w^hile FK1012, a synthetic dimer of FK506, causes dimerization of several chimeric proteins containing FKBP12 [111]. Another synthetic compound, FKCsA, created by fusion betw^een FK506 and cyclosporine A, binds vŝ ith high affinity to FKBP12 and cyclophilin and has been used for inducible transcription of exogenous genes [112]. Hov^ever, the most promising results have been obtained using the heterodimerizer rapamycin, w^hich binds simultaneously to the human proteins FKBP and FRAP [113, 114]. In this system, transcriptional activa tion is achieved through rapamycin induced reconstitution of a transcription factor complex formed by coupling of (a) a unique DNA-binding domain, ZFHD, genetically fused to FKBP and (b) the activation domain of the p65 subunit of nuclear factor kappa B (NFKB), fused with the rapamycin-binding domain of FRAP. This novel approach has been successfully utilized for sta ble in vivo delivery of secreted alkaline phosphate, murine erythropoietin 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 7 1 and human growth hormone using eukaryotic expression vectors, adenoviral, retroviral, and adeno-associated viral vectors [115-117]. One of the limita tions of this approach is the growth inhibitory and immunosuppressive activity of rapamycin which is due to the inhibition of endogenous FRAP activity [114]. This limitation can be overcome by nonimmunosuppressive analogs (rapalogs) of rapamycin by incorporating mutations in the FRAP domain that accom modate modified drugs [118, 119]. Considerable progress has also been made in designing novel synthetic dimerizers of the ligand for human FKBP12 and mutated FKBP [119-121]. These studies are suggestive of the potential utility of this novel approach for human gene therapy applications. 3. RU 486 Wang et al. [97] developed a novel regulated transcriptional activator consisting of a truncated ligand-binding domain of the human progesterone receptor, the DNA-binding domain of yeast transcriptional activator GAL4, and a C-terminal fragment of the herpes simplex virus VP16 transcriptional regulator protein. This novel transcriptional activator binds with high affinity to the synthetic progesterone antagonist RU 486 but binds very poorly to progesterone. In conjunction with the target gene containing
four copies of the consensus GAL4 binding site, the gene expression was activated only in the presence of RU 486 [97, 98]. Wang et al. [99] also developed an inducible repressor system by substituting the KRAB transcriptional repressor domain for the VP16 transactivation domain. In addition to RU 486, this system can be activated by other synthetic progesterone antagonists at low concentration. The efficacy of this system has been demonstrated using an ex vivo transplantation approach in which cells containing stably integrated chimeric regulator GLVP and a target gene (tyrosine hydroxylase) were grafted in rats. One of the caveats of this system is the low but distinctive basal activity of the GAL4-responsive promoter in the absence of RU 486. Consequently, this system has been refined by designing a synthetic transcription factor which contains a 35-amino- acid truncation of the progesterone receptor rather than the 42-amino-acid truncation [123]. This system exhibits two- to threefold lower basal activities as compared to the earlier version. IV. Enhanced Control of Tronsgene Expression A. Safety Improvements Prior to initiating our clinical trial with Ad-OC-TK, we performed a distribution study that measured TK activity in a variety of organs har vested 3 days after intravenous (iv) injection of Ad-CMV-TK ( 2 x 1 0 ^ pfu) or 2 7 2 Gardner ef o/. Ad-OC-TK (2 X 10^ pfu) with three mice per group. TK enzymatic activity was detected only in the AdCMV-TK group (hver and spleen only), but not the Ad-OC-TK group. Next we performed a comparative study in which 10 C57/BL mice received one iv injection of 2 x 10^ pfu of Ad-OC-TK or Ad-CMV-TK and intraperitoneal (ip) GCV. Significant mortality with severe hepatic histopathology was observed in the Ad-CMV-TK/GCV group (90% mortality), while the Ad-OC-TK/GCV administration did not affect survival of the treated animals (100% survival). These data and the above tissue distribu tion studies support the hypothesis that, in syngeneic hosts, the OC promoter is tissue-specific for tumors, since Ad-OC-TK inhibits tumor growth as effectively as do RSV-TK and CMV-TK, but without the generalized toxicity observed with these universal promoters. These findings paralleled the formal GLP toxi cology study in mice and our toxicology profile in our cfinical trial. Others have demonstrated the lethal effects of both universal promoter HSV-TK viruses in mice and rats and hepatotoxicity in humans after intraprostatic injections. B. Potency Concerns The initial concern with a tumor-specific promoter is that the magnitude of the transgene expression would decrease because of the specificity of the promoter. To address this issue, we compared the in vivo growth inhibition associated with intralesional administration of Ad-OC-TK with that of Ad CMV-TK using a rat osteosarcoma (ROS 17/2.8) subcutaneous model. Ten athymic nude mice were injected with 1 x 10^ ROS cells per site in four subcutaneous locations. After establishment of tumor growth at greater than 5 mm diameter, Ad-CMV-TK or Ad-OC-TK were injected intralesionally into five animals (or 20 tumors) each. After viral injection, the animals received ip GCV (three mice, 12 tumors) or phosphate-buffered saline (PBS; two mice, 8 tumors) for a 2-week period. The animals received one additional adenoviral injection 7 days after the first. The tumors were measured weekly and the animals were sacrificed after the second week of GCV or PBS administration. Both Ad-OC-TK and Ad-CMV-TK forms of therapy demonstrated a greater growth-inhibitory effect than was observed with PBS administration. The growth inhibition was superior with the Ad-OC-TK adenovirus. Therefore, the OC promoter has high intrinsic activity rivaling that of the strong universal CMV promoter, at least in ROS cells. V. Future Directions A. Enhancement of Weak But Specific Promoters A wide variety of highly tissue-specific promoters have been evaluated for achieving transcriptional targeting, however, their applicability has been 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 7 3 hampered due to weak transcriptional activity. Enhancement of weak tissue specific promoters can be achieved by employing several different strate gies. One of the simplest approach involves (a) deletion of those sequences from the promoter that do not contribute to tissue specificity or transcrip tional activity and (b) incorporation of multiple copies of the enhancer and positive regulatory elements. This approach has been successfully used in the case of PSA promoter [43], tyrosinase promoter [124, 125], and CEA promoter [12]. Another approach involves generation of activating point mutations within the promoter region as has been in the case of AFP promoter [126] and the MDR 1 promoter [127]. Yet another strategy involves selective com bination of multiple positive regulatory and tissue-specific elements to achieve enhancement of weak promoters. This strategy has shown promising results in augmenting melanoma-specific gene expression when the tyrosinase promoter, either alone or in combination with single or dual, tandem melanocyte-specific enhancer, was used to drive the expression of luciferase and the £. colt purine nucleoside phosphorylase gene. Transient expression studies indicated 5- to 500-fold increase in luciferase activity following incorporation of either single or tandem enhancer elements. In another example, when 5-20 muscle-specific transcriptional elements were randomly assembled and linked to the minimal chicken a-actin promoter, sixfold higher activity was observed as compared to the CMV promoter [128]. In case of adenoviral vectors it might be possible to selectively increase specific expression from exogenous promoters by coexpression of modified VAI genes. Using this approach, Eloit et al. [129] were able to achieve 12.5- to 502-fold increased reporter gene expression. The fact that activity of certain E2F- responsive promoters in tumor cells exceeds that achieved in mitotically active normal cells has been exploited for tumor-selective transgene expression using an adenoviral vector in a malignant glioma model [130]. A novel approach involves development of dual-specificity promoters that are both cell-type- specific and cell-cycle-regulated. In this approach the transgene is under the transcriptional control of an artificial heterodimeric transcription factor whose DNA binding domain is expressed from a tissue-specific promoter, whereas the transactivating subunit is transcribed from a cell-cycle-regulated promoter. The feasibility of this approach has been successfully tested in a transient transfection system [131]. Transcriptional targeting of viral replication for selective killing of tumor cells can be achieved by deletion of adenoviral ElB/55-kDa protein which is essential for viral replication but is dispensable in p53-deficient tumor cells. An alternate approach involves generation of a replication-competent adenoviral vector in which El A or El A and ElB genes are under the transcriptional control of tumor-specific promoters like PSA, kallikrein-2, or AFP [47, 132, 133]. 2 7 4 Gardner ef aL B. Improving Specificity with Multiple Promoter Segments Several investigators have placed combinations of promoter sequences in tandem to derive more specific transgene expression. The authors of the following chapter in this book have both laboratory and clinical experience with this approach and this topic is well covered in their chapter. C. Tumor-Specific Oncolysis Several different approaches have been designed to achieved cancer- cell-specific adenoviral replication and subsequent tumor lysis. Based on our previous work in the laboratory and the clinic, we have designed an adenoviral vector that would only replicate in cells, which could activate the osteocalcin promoter. We have recently received approval for OBA #426 using the osteo calcin promoter to transcriptionally regulate adenoviral replication for the treatment of men with metastatic and recurrent prostate cancer. This approach is thoroughly reviewed elsewhere in this volume (see Chapter 10). D. Combined Targeting Approaches The preceding chapter describes elegant methods to achieve trans- ductional targeting. These approaches will allow for the concentration of adenovirus at metastatic tumor deposits after a systemic administration. In collaboration with these investigators we have begun to combine both transductional and transcriptional targeting to allow for both tumor-specific concentration and tumor-specific oncolysis. This approach combines many of the individual strides achieved in adenoviral gene therapy in the past decade and holds great promise for the future of adenoviral cancer gene therapy. VI. Summary In summary, we believe that the success of gene therapy and its general applicability to medicine will be partially linked to the development of effective transcriptional targeting strategies. The main purpose of this chapter was to illustrate to the reader the benefits of transcriptional targeting and how this approach can be used to generate tumor- or tissue-specific gene expression. The main example of the osteocalcin promoter was used because of our laboratory's significant investigation of this promoter. Acknovs^ledgments The authors are supported by the following grant and awards K08 CA 79544-01A2 (TAG), DOD DAMD17-00-1-0027 (TAG), New York Academy of Medicine Edwin Beer Award (TAG), 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 7 5 CaPCURE Foundation (TAG, CK), DOD DAMD17-98-1-8643 (CK, TAG), Walther Oncology Center (TAG, CK), and Department of Urology Research Fund (TAG, CK, SPR). References 1. Beerli, R. R., Segal, D. J., Dreier, B., and Barbas, C. F. (1998). Toward controlling gene expression at will: Specific regulation of the erbB-2/HER-2 promoter by using polydactyl zinc finger proteins constructed from modular building blocks. Proc. Natl. Acad. Set. USA 95, 14,628-14,633. 2. Kang, J. S., and Kim, J. S. (2000). Zinc finger proteins as designer transcription factors. / . Biol. Chem. 275, 8742-8748. 3. Kim, J. S., and Pabo, C. O. (1998). Getting a handhold on DNA: Design of poly-zinc finger proteins with femtomolar dissociation constants. Proc. Natl. Acad. Sci. USA 95,2812-2817. 4. Imanishi, M., Hori, Y., Nagaoka, M., and Sugiura, Y. (2000). DNA-bending finger: Artificial design of 6-zinc finger peptides with polyglycine linker and induction of DNA bending. Biochemistry 39, 4383-4390. 5. Corbi, N., Libri, V., FanciuUi, M., Tinsley, J. M., Davies K. E., and Passananti, C. (2000). The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription. Gene Ther. 7, 1076-1083. 6. Moore, M., Klug, A., and Choo, Y. (2001). From the Cover: Improved DNA binding specificity from polyzinc finger peptides by using strings of two-finger units. Proc. Natl. Acad. Sci. USA 98, 1437-1441. 7. Gold, P., Shuster, J., and Freedman, S. O. (1978). Carcinoembryonic antigen (CEA) in clinical medicine: Historical perspectives, pitfalls and projections. Cancer 42, 1399-1405. 8. Thompson, J. A., Pande, H., Paxton, R. J., Shively, L., Padma, A., Simmer, R. L., Todd, C. W., Riggs, A. D., and Shively, J. E. (1987). Molecular cloning of a gene belonging to the carcinoembryonic antigen gene family and discussion of a domain model. Proc. Natl. Acad. Sci. USA 84, 2965-2969. 9. Schrewe, Fl., Thompson, J., Bona, M., Hefta, L. J., Maruya, A., Hassauer, M., Shively, J. E., von Kleist, S., and Zimmermann, W. (1990). Cloning of the complete gene for carcinoem bryonic antigen: Analysis of its promoter indicates a region conveying cell type-specific expression. Mol. Cell Biol. 10, 2738-2748. 10. Hauck, W., and Stanners, C. P. (1995). Transcriptional regulation of the carcinoembryonic antigen gene. Identification of regulatory elements and multiple nuclear factors. / . Biol. Chem. 270, 3602-3610. 11. Chen, C. J., Li, L. J., Maruya, A., and Shively, J. E. (1995). In vitro and in vivo footprint analysis of the promoter of carcinoembryonic antigen in colon carcinoma cells: Effects of interferon gamma treatment. Cancer Res. 55, 3873-3882. 12. Richards, C. A., Austin, E. A., and Huber, B. E. (1995). Transcriptional regulatory sequences of carcinoembryonic antigen: Identification and use with cytosine deaminase for tumor- specific gene therapy. Hum. Gene Ther. 6, 881-893. 13. Cao, G., Kuriyama, S., Gao, J., Mitoro, A., Cui, L., Nakatani, T., Zhang, X., Kikukawa, M., Pan, X., Fukui, H., and Qi, Z. (1998). Comparison of carcinoembryonic antigen promoter regions isolated from human colorectal carcinoma and normal adjacent mucosa to induce strong tumor-selective gene expression. Int. J. Cancer 78, 242-247. 14. Osaki, T., Tanio, Y., Tachibana, I., Hosoe, S., Kumagai, T., Kawase, I., Oikawa, S., and Kishimoto, T. (1994). Gene therapy for carcinoembryonic antigen-producing human lung cancer cells by cell type-specific expression of herpes simplex virus thymidine kinase gene. Cancer Res. 54, 5258-5261. 2 7 6 Gardner ef o/. 15. Takeuchi, M., Shichinohe, T., Senmaru, N., Miyamoto, M., Fujita, H., Takimoto, M., Kondo, S., Katoh, H., and Kuzumaki, N. (2000). The dominant negative H-ras mutant, N116Y, suppresses growth of metastatic human pancreatic cancer cells in the liver of nude mice. Gene Ther. 7, 518-526. 16. Lan, K. H., Kanai, F., Shiratori, Y., Okabe, S., Yoshida, Y., Wakimoto, H., Hamada, H., Tanaka, T., Ohashi, M., and Omata, M. (1996). Tumor-specific gene expression in carci- noembryonic antigen — Producing gastric cancer cells using adenovirus vectors. Gastroen terology 111, 1241-1251. 17. Lan, K. H., Kanai,
F., Shiratori, Y., Ohashi, M., Tanaka, T., Okudaira, T., Yoshida, Y., Hamada, H., and Omata, M. (1997). In vivo selective gene expression and therapy mediated by adenoviral vectors for human carcinoembryonic antigen-producing gastric carcinoma. Cancer Res. 57, 4279-4284. 18. DiMaio, J. M., Clary, B. M., Via, D. F., Coveney, E., Pappas, T. N., and Lyerly, H. K. (1994). Directed enzyme pro-drug gene therapy for pancreatic cancer in vivo. Surgery 116,205-213. 19. Tanaka, T., Kanai, F., Lan, K. H., Ohashi, M., Shiratori, Y., Yoshida, Y., Hamada, H., and Omata, M. (1997). Adenovirus-mediated gene therapy of gastric carcinoma using cancer- specific gene expression in vivo. Biochem. Biophys. Res. Commun. 231, 775-779. 20. Brand, K., Loser, P., Arnold, W., Bartels, T., and Strauss, M. (1998). Tumor cell-specific transgene expression prevents liver toxicity of the adeno-HSVtk/GCV approach. Gene Ther. 5, 1363-1371. 21. Kijima, T., Osaki, T., Nishino, K., Kumagai, T., Funakoshi, T., Goto, H., Tachibana, I., Tanio, Y., and Kishimoto, T. (1999). Application of the Cre recombinase/loxP system further enhances antitumor effects in cell type-specific gene therapy against carcinoembryonic antigen-producing cancer. Cancer Res. 59, 4906-4911. 22. Belanger, L., Baril, P., Guertin, M., Gingras, M. C., Gourdeau, H., Anderson, A., Hamel, D., and Boucher, J. M. (1983). Oncodevelopmental and hormonal regulation of alpha 1- fetoprotein gene expression. Adv. Enzyme Regul. 21, 73-99. 23. Nahon, J. L., Danan, J. L., Poiret, M., Tratner, L, Jose-Estanyol, M. and Sala-Trepat, J. M. (1987). The rat alpha-fetoprotein and albumin genes. Transcriptional control and compari son of the sequence organization and promoter region. / . Biol. Chem. 262, 12,479-12,487. 24. Sakai, M., Morinaga, T., Urano, Y., Watanabe, K., Wegmann, T. G., and Tamaoki, T. (1985). The human alpha-fetoprotein gene. Sequence organization and the 5' flanking region./. Biol. Chem. 260, 5055-5060. 25. Nakabayashi, H., Hashimoto, T., Miyao, Y., Tjong, K. K., Chan, J., and Tamaoki, T. (1991). A position-dependent silencer plays a major role in repressing alpha- fetoprotein expression in human hepatoma. Mol. Cell Biol. 11, 5885-5893. 26. Kaneko, S., Hallenbeck, P., Kotani, T., Nakabayashi, H., McGarrity, G., Tamaoki, T., Anderson, W. F., and Chiang, Y. L. (1995). Adenovirus-mediated gene therapy of hepatocellular carcinoma using cancer-specific gene expression. Cancer Res. 55, 5283-5287. 27. Kanai, F., Shiratori, Y., Yoshida, Y., Wakimoto, H., Hamada, H., Kanegae, Y., Saito, L, Nakabayashi, H., Tamaoki, T., Tanaka, T., Lan, K. H., Kato, N., Shiina, S., and Omata, M. (1996). Gene therapy for alpha-fetoprotein-producing human hepatoma cells by adenovirus- mediated transfer of the herpes simplex virus thymidine kinase gene. Hepatology 23, 1359-1368. 28. Kanai, F., Lan, K. H., Shiratori, Y., Tanaka, T., Ohashi, M., Okudaira, T., Yoshida, Y., Wakimoto, H., Hamada, H., Nakabayashi, H., Tamaoki, T., and Omata, M. (1997). In vivo gene therapy for alpha-fetoprotein-producing hepatocellular carcinoma by adenovirus- mediated transfer of cytosine deaminase gene. Cancer Res. 57, 461-465. 29. Arbuthnot, P. B., Bralet, M. P., Le Jossic, C , Dedieu, J. F., Perricaudet, M., Brechot, C , and Ferry, N. (1996). In vitro and in vivo hepatoma cell-specific expression of a gene transferred with an adenoviral vector. Hum. Gene Ther. 7, 1503-1514. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 7 7 30. Bui, L. A., Butterfield, L. H., Kim, J. Y., Ribas, A., Seu, P., Lau, R., Glaspy, J. A., McBride, W. H., and Economou, J. S. (1997). In vivo therapy of hepatocellular carcinoma with a tumor-specific adenoviral vector expressing interleukin-2. Hum. Gene Ther. 8, 2173-2182. 31. Sato, Y., Tanaka, K., Lee, G., Kanegae, Y., Sakai, Y., Kaneko, S., Nakabayashi, H., Tamaoki, T., and Saito, I. (1998). Enhanced and specific gene expression via tissue-specific production of Cre recombinase using adenovirus vector. Biochem. Biophys. Res. Commun. 244, 455-462. 32. Riegman, P. H., Vlietstra, R. J., van der Korput,J. A., Romijn, J. C , and Trapman, J. (1989). Characterization of the prostate-specific antigen gene: A novel human kallikrein-like gene. Biochem. Biophys. Res. Commun. 159, 95-102. 33. Riegman, P. H., VHetstra, R. J., Klaassen, P., van der Korput, J. A., Geurts van Kessel, A., Romijn, J. C., and Trapman, J. (1989). The prostate-specific antigen gene and the human glandular kalHkrein-1 gene are tandemly located on chromosome 19. FEBS Lett. 247, 123-126. 34. Lundwall, A, (1989). Characterization of the gene for prostate-specific antigen, a human glandular kallikrein. Biochem. Biophys. Res. Commun. 161, 1151-1159. 35. Wang, M. C , Valenzuela, L. A., Murphy, G. P., and Chu, T. M. (1979). Purification of a human prostate specific antigen. Invest. Urol. 17, 159-163. 36. Wang, M. C , Papsidero, L. D., Kuriyama, M., Valenzuela, L. A., Murphy, G. P., and Chu, T. M. (1981). Prostate antigen: A nev^ potential marker for prostatic cancer. Prostate 2, 89-96. 37. Gallee, M. P., van Vroonhoven, C. C , van der Korput, H. A., van der Kwast, T. H., ten Kate, F. J,, Romijn, J. C , and Trapman, J. (1986). Characterization of monoclonal antibod ies raised against the prostatic cancer cell line PC-82. Prostate 9, 33-45. 38. Riegman, P. H., Vlietstra, R. J., van der Korput, H. A., Romijn, J. C , and Trapman, J. (1991). Identification and androgen-regulated expression of two major human glandular kallikrein-1 (hGK-1) mRNA species. Mol. Cell Endocrinol. 76, 181-190. 39. Cleutjens, C. B., Steketee, K., van Eekelen, C. C , van der Korput, J. A., Brinkmann, A. O., and Trapman, J. (1997). Both androgen receptor and glucocorticoid receptor are able to induce prostate-specific antigen expression, but differ in their growth- stimulating properties of LNCaP cells. Endocrinology 138, 5293-5300. 40. Cleutjens, K. B., van der Korput, H. A., van Eekelen, C. C , van Rooij, H. C , Faber, P. W., and Trapman, J. (1997). An androgen response element in a far upstream enhancer region is essential for high, androgen-regulated activity of the prostate-specific antigen promoter. Mol. Endocrinol. 11, 148-161. 41. Cleutjens, K. B., van Eekelen, C. C , van der Korput, H. A., Brinkmann, A. O., and Trap- man, J. (1996). Two androgen response regions cooperate in steroid hormone regulated activity of the prostate-specific antigen promoter./. Biol. Chem. 271, 6379-6388. 42. Cleutjens, K. B., van der Korput, H. A., Ehren-van Eekelen, C. C , Sikes, R. A., Fasciana, C , Chung, L. W., and Trapman, J. (1997). A 6-kb promoter fragment mimics in transgenic mice the prostate-specific and androgen-regulated expression of the endogenous prostate-specific antigen gene in humans. Mol. Endocrinol. 11, 1256-1265. 43. Pang, S., Dannull, J., Kaboo, R., Xie, Y., Tso, C. L., Michel, K., deKernion, J. B., and Bellde- grun, A. S. (1997). Identification of a positive regulatory element responsible for tissue- specific expression of prostate-specific antigen. Cancer Res. 57, 495-499. 44. Yeung,F., Li, X., Ellett, J., Trapman,]., Kao, C , and Chung, L. W. (2000). Regions of prostate-specific antigen (PSA) promoter confer androgen-independent expression of PSA in prostate cancer cells./. Biol. Chem. 275, 40,846-40,855. 45. Oettgen, P., Finger, E., Sun, Z., Akbarali, Y., Thamrongsak, U., Boltax, J., Grail, F., Dube, A., Weiss, A., Brown, L., Quinn, G., Kas, K., Endress, G., Kunsch, C , and 2 7 8 Gardner ef a/. Libermann, T. A. (2000). PDEF, a novel prostate epithelium-specific ets transcription factor, interacts with the androgen receptor and activates prostate-specific antigen gene expression. / . Biol. Chem. 275, 1216-1225. 46. Latham, J. P., Searle, P. F., Mautner, V., and James, N. D. (2000). Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer: Construction and testing of a tissue-specific adenovirus vector. Cancer Res. 60, 334-341. 47. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Hender son, D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559-2563. 48. Martinello-Wilks, R., Garcia-Aragon, J., Daja, M. M., Russell, P., Both, G. W., Mol- loy, P. L., Lockett, L. J., and Russell, P. J. (1998). In vivo gene therapy for prostate cancer: Preclinical evaluation of two different enzyme-directed prodrug therapy systems delivered by identical adenovirus vectors. Hum. Gene Ther. 9, 1617-1626. 49. Gotoh, A., Ko, S. C., Shirakawa, T., Cheon, J., Kao, C., Miyamoto, T., Gardner, T. A., Ho, L. J., Cleutjens, C. B., Trapman, J., Graham, F. L., and Chung, L. W. (1998). Devel opment of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. / . Urol. 160, 220-229. 50. Lee, S. E., Jin, R. J., Lee, S. G., Yoon, S. J., Park, M. S., Heo, D. S., and Choi, H. (2000). Development of a new plasmid vector with PSA-promoter and enhancer expressing tissue- specificity in prostate carcinoma cell lines. Anticancer Res. 20, 417-422. 51. Xu, L. L., Srikantan, v. , Sesterhenn, L A., Augustus, M., Dean, R., Moul, J. W., Carter, K. C , and Srivastava, S. (2000). Expression profile of an androgen regulated prostate specific homeobox gene NKX3.1 in primary prostate cancer. / . Urol. 163, 972-979. 52. Pan, L. C , and Price, P. A. (1984). The effect of transcriptional inhibitors on the bone gamma-carboxyglutamic acid protein response to 1,25-dihydroxyvitamin D3 in osteosar coma cells./. Biol. Chem. 259, 5844-5847. 53. Price, P. A., and WiUiamson, M. K, (1985). Primary structure of bovine matrix Gla protein, a new vitamin K- dependent bone protein./. Biol. Chem. 260, 14,971-14,975. 54. Kerner, S. A., Scott, R. A., and Pike, J. W. (1989). Sequence elements in the human osteo calcin gene confer basal activation and inducible response to hormonal vitamin D3. Proc. Natl. Acad. Sci. USA 86, 4455-4459. 55. Lian, J., Stewart, C , Puchacz, E., Mackowiak, S., Shalhoub, V., Collart, D., Zambetti, G., and Stein, G. (1989). Structure of the rat osteocalcin gene and regulation of vitamin D- dependent expression. Proc. Natl. Acad. Sci. USA 86, 1143-1147. 56. Desbois, C , Hogue, D. A., and Karsenty, G. (1994). The mouse osteocalcin gene cluster contains three genes with two separate spatial and temporal patterns of expression. / . Biol. Chem. 269, 1183-1190. 57. Desbois, C , Seldin, M. F., and Karsenty, G. (1994). Localization of the osteocalcin gene cluster on mouse chromosome 3. Mamm. Genome 5, 321-322. 58. Montecino, M., Pockwinse, S., Lian, J., Stein, G., and Stein, J. (1994). DNase I hypersensitive sites in promoter elements associated with basal and vitamin D dependent transcription of the bone-specific osteocalcin gene. Biochemistry 33, 348-353. 59. Hoffmann, H. M., Catron, K. M., van Wijnen, A. J., McCabe, L. R., Lian, J. B., Stein, G. S., and Stein, J. L. (1994). Transcriptional control of the tissue-specific, developmentally regu lated osteocalcin gene requires a binding motif for the Msx family of homeodomain proteins. Proc. Natl. Acad. Sci. USA 91, 12,887-12,891. 60. Towler, D. A., Rutledge, S. J., and Rodan, G. A. (1994). Msx-2/Hox 8.1: A transcriptional regulator of the rat osteocalcin promoter. Mol. Endocrinol. 8, 1484-1493. 61. Towler, D. A., Bennett, C. D., and Rodan, G. A. (1994). Activity of the rat osteocalcin basal promoter in osteoblastic cells is dependent upon homeodomain and CPl binding motifs. Mol. Endocrinol. 8, 614-624. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 7 9 62. Tamura, M., and Noda, M. (1994). Identification of a DNA sequence involved in osteoblast- specific gene expression via interaction w îth helix-loop-helix (HLH)-type transcription factors./. Cell Biol. 126, 773-782. 63. Banerjee, C , Hiebert, S. W., Stein, J. L., Lian, J. B., and Stein, G. S. (1996). An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Set. USA 93, 4968-4973. 64. Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidv^ell, J. P., Fey, E., Lian, J., Stein, J., and Stein, G. S. (1995). The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: Interactions with the osteocalcin gene promoter. Biochemistry 34, 13,125-13,132. 65. Geoffroy, v. , Ducy, P., and Karsenty, G. (1995). A PEBP2 alpha/AML-1-related factor increases osteocalcin promoter activity through its binding to an osteoblast-specific cis-acting element./. Biol. Chem. 270, 30,973-30,979. 66. Banerjee, C., Hiebert, S. W., Stein, J. L., Lian, J. B., and Stein, G. S. (1996). An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Set. USA 93, 4968-4973. 67. Markose, E. R., Stein, J. L., Stein, G. S., and Lian, J. B. (1990). Vitamin D-mediated mod ifications in protein-DNA interactions at tw ô promoter elements of the osteocalcin gene. Proc. Natl. Acad. Sei. USA 87, 1701-1705. 68. Demay, M. B., Gerardi, J. M., DeLuca, H. F., and Kronenberg, H. M. (1990). DNA sequences in
the rat osteocalcin gene that bind the 1,25- dihydroxyvitamin D3 receptor and confer responsiveness to 1,25- dihydroxyvitamin D3. Proc. Natl. Acad. Sei. USA 87, 369-373. 69. Breen, E. C., van Wijnen, A. J., Lian, J. B., Stein, G. S., and Stein, J. L. (1994). In vivo occupancy of the vitamin D responsive element in the osteocalcin gene supports vitamin D-dependent transcriptional upregulation in intact cells. Proc. Natl. Acad. Set. USA 91, 12,902-12,906. 70. Montecino, M., Frenkel, B., Lian, J., Stein, J., and Stein, G. (1996). Requirement of distal and proximal promoter sequences for chromatin organization of the osteocalcin gene in bone-derived cells. / . Cell Biochem. 63, 221-228. 71. Bidwell, J. P., Van Wijnen, A. J., Fey, E. G., Dworetzky, S., Penman, S., Stein, J. L., Lian, J. B., and Stein, G. S. (1993). Osteocalcin gene promoter-binding factors are tissue-specific nuclear matrix components. Proc. Natl. Acad. Sei. USA 90, 3162-3166. 72. Yoon, K. G., Rutledge, S. J., Buenaga, R. F., and Rodan, G. A. (1988). Characterization of the rat osteocalcin gene: Stimulation of promoter activity by 1,25-dihydroxyvitamin D3. Biochemistry 27, 8521-8526. 73. Briggs, M. R., Kadonaga, J. T., Bell, S. P., and Tjian, R. (1986). Purification and biochemical characterization of the promoter-specific transcription factor Spl. Science 234, 47-52. 74. Theofan, G., Haberstroh, L. M., and Price, P. A. (1989). Molecular structure of the rat bone Gla protein gene and identification of putative regulatory elements. DNA 8, 213-221. 75. Goto, K., Heymont, J. L., Klein-Nulend, J., Kronenberg, H. M., and Demay, M. B. (1996). Identification of an osteoblastic silencer element in the first intron of the rat osteocalcin gene. Biochemistry 35, 11,005-11,011. 76. Kearns, A. E., Goto, K., Gianakakos, G., Lippmann, W., and Demay, M. B. (1999). Tran scriptional repression of the rat osteocalcin gene: Role of two intronic CCTCCT motifs. Endocrinology 140, 4120-4126. 77. Ko, S. C., Cheon, J., Kao, C., Gotoh, A., Shirakawa, T., Sikes, R. A., Karsenty, G., and Chung, L. W. (1996). Osteocalcin promoter-based toxic gene therapy for the treatment of osteosarcoma in experimental models. Cancer Res. 56, 4614-4619. 78. Cheon, J., Ko, S. C , Gardner, T. A., Shirakawa, T., Gotoh, A., Kao, C , and Chung, L. W. (1997). Chemogene therapy: Osteocalcin promoter-based suicide gene therapy in combina tion with methotrexate in a murine osteosarcoma model. Cancer Gene Ther. 4, 359-365. 2 8 0 Gardner ef al. 79. Shirakawa, T., Ko, S. C , Gardner, T. A., Cheon, J., Miyamoto, T., Gotoh, A., Chung, L. W., and Kao, C. (1998). In vivo suppression of osteosarcoma pulmonary metastasis with intravenous osteocalcin promoter-based toxic gene therapy. Cancer Gene Ther. 5, 274-280. 80. Hou, Z., Nguyen, Q., Frenkel, B., Nilsson, S. K., Milne, M., van Wijnen, A. J., Stein, J. L., Quesenberry, P., Lian, J. B., and Stein, G. S. (1999). Osteoblast-specific gene expression after transplantation of marrov^ cells: Implications for skeletal gene therapy. Proc. Natl. Acad. Set. USA 96, 7294-7299. 81. Opavsky, R., Pastorekova, S., Zelnik, V., Gibadulinova, A., Stanbridge, E. J., Zavada, J., Kettmann, R., and Pastorek, J. (1996). Human MN/CA9 gene, a novel member of the carbonic anhydrase family: Structure and exon to protein domain relationships. Genomics 33,480-487. 82. Der, C. J., and Stanbridge, E. J. (1981). A tumor-specific membrane phosphoprotein marker in human cell hybrids. Cell 26, 429-438. 83. Zavada, J., Zavadova, Z., Pastorekova, S., Giampor, P., Pastorek, J., and Zelnik, V. (1993). Expression of MaTu-MN protein in human tumor cultures and in clinical specimens. Int. J. Cancer 54,26^-274. 84. Liao, S. Y., Brewer, C , Zavada, J., Pastorek, J., Pastorekova, S., Manetta, A., Berman, M. L., DiSaia, P. J., and Stanbridge, E. J. (1994). Identification of the MN antigen as a diagnostic biomarker of cervical intraepithelial squamous and glandular neoplasia and cervical carcinomas. Am. J. Pathol. 145, 598-609. 85. Pastorekova, S., Parkkila, S., Parkkila, A. K., Opavsky, R., Zelnik, V., Saarnio, J., and Pas torek, J. (1997). Garbonic anhydrase IX, MN/CA IX: Analysis of stomach complementary DNA sequence and expression in human and rat alimentary tracts. Gastroenterology 112, 398-408. 86. Pastorek, J., Pastorekova, S., Gallebaut, I., Mornon, J. P., Zelnik, V., Opavsky, R., Zat'ovicova, M., Liao, S., Portetelle, D., Stanbridge, E. J., et al. (1994). Cloning and characterization of MN, a human tumor-associated protein with a domain homologous to carbonic anhydrase and a putative helix-loop-helix DNA binding segment. Oncogene 9, 2877-2888. 87. Ono, M. (1986). Molecular cloning and long terminal repeat sequences of human endogenous retrovirus genes related to types A and B retrovirus genes. / . Virol. 58, 937-944. 88. Locker, J., and Buzard, G. (1990). A dictionary of transcription control sequences. DNA Seq. 1 ,3 -11 . 89. Imagawa, M., Chiu, R., and Karin, M. (1987). Transcription factor AP-2 mediates induction by two different signal- transduction pathways: Protein kinase C and cAMP. Cell 51, 251-260. 90. el-Deiry, W. S., Kern, S. E., Pietenpol, J. A., Kinzler, K. W., and Vogelstein, B. (1992). Defi nition of a consensus binding site for p53. Nat. Genet. 1, 45-49. 91. Searle, P. F., Stuart, G. W., and Palmiter, R. D. (1985). Building a metal-responsive promoter with synthetic regulatory elements. Mol. Cell Biol. 5, 1480-1489. 92. Fuqua, S. A., Blum-Salingaros, M., and McGuire, W. L. (1989). Induction of the estrogen- regulated "24 K" protein by heat shock. Cancer Res. 49, 4126-4129. 93. Hirt, R. P., Easel, N., and Kraehenbuhl, J. P. (1994). Inducible protein expression using a glucocorticoid-sensitive vector. Methods Cell Biol. 43, 247-262. 94. Figge, J., Wright, C , Collins, C. J., Roberts, T. M., and Livingston, D. M. (1988). Stringent regulation of stably integrated chloramphenicol acetyl transferase genes by E. coli lac repressor in monkey cells. Cell 52, 713-722. 95. Baim, S, B., Labow, M. A., Levine, A. J., and Shenk, T. (1991). A chimeric mammalian transactivator based on the lac repressor that is regulated by temperature and isopropyl beta-D-thiogalactopyranoside. Proc. Natl. Acad. Sci. USA 88, 5072-5076. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 8 1 96. Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline- responsive promoters. Proc. Natl. Acad. Set. USA 89, 5547-5551. 97. Wang, Y., O'Malley, B. W., and Tsai, S. Y. (1994). A regulatory system for use in gene transfer. Proc. Natl. Acad. Sci. USA 91, 8180-8184. 98. Wang,Y., DeMayo, F. J., Tsai, S. Y., and O'Malley, B. W. (1997). Ligand-inducible and liver-specific target gene expression in transgenic mice. Nat. Biotechnol. 15, 239-243. 99. Wang, Y., Xu, J., Pierson, T., O'Malley, B. W., and Tsai, S. Y. (1997). Positive and negative regulation of gene expression in eukaryotic cells w îth an inducible transcriptional regulator. Gene Ther. 4,432-441. 100. No, D., Yao, T. P., and Evans, R. M. (1996). Ecdysone-inducible gene expression in mam malian cells and transgenic mice. Proc. Natl. Acad. Sci. USA 93, 3346-3351. 101. Rivera, V. M., Clackson, T., Natesan, S., Pollock, R., Amara, J. F., Keenan, T., Magari, S. R., Phillips, T., Courage, N. L., CerasoU, F., Holt, D. A., and Oilman, M. (1996). A humanized system for pharmacologic control of gene expression. Nat. Med. 2,1028-1032. 102. Dachs, G. U., Patterson, A. V., Firth, J. D., Ratcliffe, P. J., Townsend, K. M., Stratford, I. J., and Harris, A. L. (1997). Targeting gene expression to hypoxic tumor cells. Nat. Med. 3, 515-520. 103. Scott, S. D., Marples, B., Hendry, J. H., Lashford, L. S., Embleton, M. J., Hunter, R. D., Howell, A., and Margison, G. P. (2000). A radiation-controlled molecular sw îtch for use in gene therapy of cancer. Gene Ther. 7, 1121-1125. 104. Putzer, B. M., Stiev^e, T., Crespo, F., and Esche, H. (2000). Improved safety through tamoxifen-regulated induction of cytotoxic genes delivered by Ad vectors for cancer gene therapy. Gene Ther. 7, 1317-1325. 105. Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. (1995). Tran scriptional activation by tetracyclines in mammalian cells. Science 268, 1766-1769. 106. Deuschle, U., Meyer, W. K., and Thiesen, H. J. (1995). Tetracycline-reversible silencing of eukaryotic promoters. Mol. Cell Biol. 15, 1907-1914. 107. Baron, U., Freundlieb, S., Gossen, M., and Bujard, H. (1995). Co-regulation of tv^o gene activities by tetracycline via a bidirectional promoter. Nucleic Acids Res. 23, 3605-3606. 108. Massie, B., Couture, F., Lamoureux, L., Mosser, D. D., Guilbault, C , Jolicoeur, P., Belanger, F., and Langelier, Y. (1998). Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. / . Virol. 72, 2289-2296. 109. Ghersa, P., Gobert, R. P., Sattonnet-Roche, P., Richards, C. A., Merlo Pich, E., and Hooft van Huijsduijnen, R. (1998). Highly controlled gene expression using combinations of a tissue- specific promoter, recombinant adenovirus and a tetracycline-regulatable transcription factor. Gene Ther. 5, 1213-1220. 110. Rubinchik, S., Ding, R., Qiu, A. J., Zhang, F., and Dong, J. (2000). Adenoviral vector which delivers FasL-GFP fusion protein regulated by the tet-inducible expression system. Gene Ther. 7, 875-885. 111. Liang, X., Hartikka, J., Sukhu, L., Manthorpe, M., and Hobart, P. (1996). Novel, high expressing and antibiotic-controlled plasmid vectors designed for use in gene therapy. Gene Ther. 3, 350-356. 112. Belshaw, P. J., Spencer, D. M., Crabtree, G. R., and Schreiber, S. L. (1996). Controlling pro grammed cell death with a cyclophifin-cyclosporin-based chemical inducer of dimerization. Chem.Biol. 3 ,731-738. 113. Standaert, R. F., Galat, A., Verdine, G. L., and Schreiber, S. L. (1990). Molecular cloning and overexpression of the human FK506-binding protein FKBP. Nature 346, 671-674. 114. Brown, E. J., Albers, M. W., Shin, T. B., Ichikawa, K., Keith, C. T., Lane, W. S., and Schreiber, S. L. (1994). A mammalian protein targeted by Gl-arresting rapamycin-receptor complex. Nature 369, 756-758. 2 8 2 Gardner ef o/. 115. Magari, S. R., Rivera, V. M., luliucci, J. D., Gilman, M., and Cerasoli, F. (1997). Pharmaco logic control of a humanized gene therapy system implanted into nude mice. / . Clin. Invest. 100,2865-2872. 116. Ye, X., Rivera, V.M., Zoltick, P., Cerasoli, F., Schnell, M. A., Gao, G., Hughes, J. V., Gilman, M., and Wilson, J. M. (1999). Regulated delivery of therapeutic proteins after in vivo somatic cell gene transfer. Science 283, 88 -91 . 117. Rivera, V. M., Ye, X., Courage, N. L., Sachar, J., Cerasoh, F., Wilson, J. M., and Gilman, M. (1999). Long-term regulated expression of growth hormone in mice after intramuscular gene transfer. Proc. Natl. Acad. Sci. USA 96, 8657-8662. 118. Liberies, S. D., Diver, S. T., Austin, D. J., and Schreiber, S. L. (1997). Inducible gene expres sion and protein translocation using nontoxic ligands identified by a mammalian three-hybrid screen. Proc. Natl. Acad. Sci. USA 94, 7825-7830. 119. Clackson, T., Yang, W., Rozamus, L. W., Hatada, M., Amara, J. F., Rollins, C. T., Steven son, L. F., Magari, S. R., Wood, S. A., Courage, N. L., Lu, X., Cerasoh, F., Gilman, M., and Holt, D. A. (1998). Redesigning an FKBP-ligand interface to generate chemical dimerizers with novel specificity. Proc. Natl. Acad. Sci. USA 95, 10,437-10,442. 120. Amara, J. F., Clackson, T., Rivera, V. M., Guo, T., Keenan, T., Natesan, S., Pollock, R., Yang, W., Courage, N. L., Holt, D. A., and Gilman, M. (1997). A versatile synthetic dimer- izer for the regulation of protein-protein interactions. Proc. Natl. Acad. Sci. USA 94, 10,618-10,623. 121. Rollins, C. T., Rivera, V. M., Woolfson, D. N., Keenan, T., Hatada, M., Adams, S. E., Andrade, L. J., Yaeger, D., van Schravendijk, M. R., Holt, D. A., Gilman, M., and Clackson, T. (2000). A ligand-reversible dimerization system for controlling protein-protein interactions. Proc. Natl. Acad. Sci. USA 97, 7096-7101. 122. Wang, Y., Yu, L., and Geller, A. L (1999). Diverse stabilities of expression in the rat brain from different cellular promoters in a helper virus-free herpes simplex virus type 1 vector system. Hum. Gene Ther. 10, 1763-1771. 123. Delort, J. P., and Capecchi, M. R. (1996). TAXI/UAS: A molecular switch to control expres sion of genes in vivo. Hum. Gene Ther. 7, 809-820. 124. Siders, W. M., Halloran, P. J., and Fenton, R. G. (1996). Transcriptional targeting of recom binant adenoviruses to human and murine melanoma cells. Cancer Res. 56, 5638-5646. 125. Siders, W. M., Halloran, P. J., and Fenton, R. G. (1998). Melanoma-specific cytotoxicity induced by a tyrosinase promoter-enhancer/herpes simplex virus thymidine kinase aden ovirus. Cancer Gene Ther. 5, 281-291. 126. Ishikawa, H., Nakata, K., Mawatari, F., Ueki, T., Tsuruta, S., Ido, A., Nakao, K., Kato, Y., Ishii, N., and Eguchi, K. (1999). Utilization of variant-type of human alpha-fetoprotein
promoter in gene therapy targeting for hepatocellular carcinoma. Gene Ther. 6, 465-470. 127. Stein, U., Walther, W., and Shoemaker, R. H. (1996). Vincristine induction of mutant and wild-type human multidrug- resistance promoters is cell-type-specific and dose-dependent. / . Cancer Res. Clin. Oncol. Ill, TIS-1%1. 128. Li, X., Eastman, E. M., Schwartz, R. J., and Draghia-Akli, R. (1999). Synthetic muscle pro moters: Activities exceeding naturally occurring regulatory sequences. Nat. Biotechnol. 17, 241-245. 129. Eloit, M., Adam, M., Gallais, L, and Fournier, A. (1997). High level of transgene expression in cell cultures and in the mouse by replication-incompetent adenoviruses harboring modified VAI genes./. Virol. 71, 5375-5381. 130. Parr, M. J., Manome, Y., Tanaka, T., Wen, P., Kufe, D. W., Kaelin, W. G., and Fine, H. A. (1997). Tumor-selective transgene expression in vivo mediated by an E2F- responsive adenoviral vector. Nat. Med. 3, 1145-1149. 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 8 3 131. Nettelbeck, D. M., Jerome, V., and MuUer, R. (1999). A dual specificity promoter system combining cell cycle-regulated and tissue-specific transcriptional control. Gene Ther. 6, 1276-1281. 132. Yu, D. C , Chen, Y., Seng, M., Dilley, J., and Henderson, D. R. (1999). The addition of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant prostate tumor xenografts. Cancer Res. 59, 4200-4203. 133. Hallenbeck, P. L., Chang, Y. N., Hay, C , Golightly, D., Stewart, D., Lin, J., Phipps, S., and Chiang, Y. L, (1999). A novel tumor-specific replication-restricted adenoviral vector for gene therapy of hepatocellular carcinoma. Hum Gene Ther. 10, 1721-1733. 134. Bilbao, R., Gerolami, R., Bralet, M. P., Qian, C , Tran, P. L., Tennant, B., Prieto, J., and Brechot, C. (2000). Transduction efficacy, antitumoral effect, and toxicity of adenovirus- mediated herpes simplex virus thymidine kinase/ ganciclovir therapy of hepatocellular carcinoma: the woodchuck animal model. Cancer Gene Ther. 7, 657-662. 135. Balague, C , Zhou, J., Dai, Y., Alemany, R., Josephs, S. F., Andreason, G., Hariharan, M., Sethi, E., Prokopenko, E., Jan, H. Y., Lou, Y. C , Hubert-Leslie, D., Ruiz, L., and Zhang, W. W. (2000). Sustained high-level expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector. Blood 95, 820-828. 136. Brann, T., Kayda, D., Lyons, R. M., Shirley, P., Roy, S., Kaleko, M., and Smith, T. (1999). Adenoviral vector-mediated expression of physiologic levels of human factor VIII in nonhuman primates. Hum. Gene Ther. 10, 2999-3011. 137. Draghia-AkH, R., Li, X., and Schwartz, R. J. (1997). Enhanced growth by ectopic expression of growth hormone releasing hormone using an injectable myogenic vector. Nat. Biotechnol. 15,1285-1289. 138. Anderson, L. M., Krotz, S., Weitzman, S. A., and Thimmapaya, B. (2000). Breast cancer- specific expression of the Candida albicans cytosine deaminase gene using a transcriptional targeting approach. Cancer Gene Ther. 7, 845-852. 139. Anderson, L. M., Swaminathan, S., Zackon, I., Tajuddin, A. K., Thimmapaya, B., and Weitzman, S. A. (1999). Adenovirus-mediated tissue-targeted expression of the HSVtk gene for the treatment of breast cancer. Gene Ther. 6, 854-864. 140. Li, Q., Emery, D. W., Fernandez, M., Han, H., and Stamatoyannopoulos, G. (1999). Development of viral vectors for gene therapy of beta-chain hemoglobinopathies: Optimization of a gamma-globin gene expression cassette. Blood 93, 2208-2216. 141. Vassaux, G., Hurst, H. C , and Lemoine, N. R. (1999). Insulation of a conditionally expressed transgene in an adenoviral vector. Gene Ther. 6, 1192-1197. 142. Ring, C. J., Harris, J. D., Hurst, H. C , and Lemoine, N. R. (1996). Suicide gene expression induced in tumour cells transduced with recombinant adenoviral, retroviral and plasmid vectors containing the ERBB2 promoter. Gene Ther. 3, 1094-1103. 143. Staba, M. J., Mauceri, H. J., Kufe, D. W., Hallahan, D. E., and Weichselbaum, R. R. (1998). Adenoviral TNF-alpha gene therapy and radiation damage tumor vasculature in a human malignant gUoma xenograft. Gene Ther. 5, 293-300. 144. Manome, Y., Kunieda, T., Wen, P. Y., Koga, T., Kufe, D. W., and Ohno, T. (1998). Transgene expression in malignant glioma using a replication-defective adenoviral vector containing the Egr-1 promoter: activation by ionizing radiation or uptake of radioactive iododeoxyuridine. Hum. Gene Ther. 9, 1409-1417. 145. Jaggar, R. T., Chan, H. Y., Harris, A. L., and Bicknell, R. (1997). EndotheUal cell-specific expression of tumor necrosis factor-alpha from the KDR or E-selectin promoters following retroviral delivery. Hum. Gene Ther. 8, 2239-2247. 146. Reynolds, P. N., Nicklin, S. A., Kafiberova, L., Boatman, B. G., Grizzle, W. E., Balyasnikova, I. v . . Baker, A. H., Danilov, S. M., and Curiel, D. T. (2001). Combined transductional and transcriptional targeting improves the specificity of transgene expression in vivo. Nat. Biotechnol. 19, 838-842. 2 8 4 Gardner ef aL 147. Smith-Arica, J. R., Morelli, A. E., Larregina, A. T., Smith, J., Lowenstein, P. R., and Castro, M. G. (2000). Cell-type-specific and regulatable transgenesis in the adult brain: adenovirus- encoded combined transcriptional targeting and inducible transgene expression. MoL Ther. 2, 579-587. 148. Cortez, N., Trejo, F., Vergara, P., and Segovia, J. (2000). Primary astrocytes retrovirally transduced with a tyrosine hydroxylase transgene driven by a glial-specific promoter elicit behavioral recovery in experimental parkinsonism./. Neurosci. Res. 59, 39-46. 149. Gazit, G., Hung, G., Chen, X., Anderson, W. F., and Lee, A. S. (1999). Use of the glucose starvation-inducible glucose-regulated protein 78 promoter in suicide gene therapy of murine fibrosarcoma. Cancer Res. 59, 3100-3106. 150. Chen, X., Zhang, D., Dennert, G., Hung, G., and Lee, A. S. (2000). Eradication of murine mammary adenocarcinoma through HSVtk expression directed by the glucose-starvation inducible grp78 promoter. Breast Cancer Res. Treat. 59, 81-90. 151. Miao, C. H., Ohashi, K., Patijn, G. A., Meuse, L., Ye, X., Thompson, A. R., and Kay, M. A. (2000) Inclusion of the hepatic locus control region, an intron, and untranslated region increases and stabilizes hepatic factor IX gene expression in vivo but not in vitro. Mol. Ther. 1, 522-532. 152. Lee, E. J., Anderson, L. M., Thimmapaya, B., and Jameson, J. L. (1999). Targeted expression of toxic genes directed by pituitary hormone promoters: a potential strategy for adenovirus- mediated gene therapy of pituitary tumors./. Clin. Endocrinol. Metab. 84, 786-794. 153. Lee, E. J., Thimmapaya, B., and Jameson, J. L. (2000). Stereotactic injection of adenoviral vectors that target gene expression to specific pituitary cell types: implications for gene therapy. Neurosurgery 46, 1461-1468; discussion 1468-1469. 154. Rinsch, C , Regulier, E., Deglon, N., Dalle, B., Beuzard, Y., and Aebischer, P. (1997). A gene therapy approach to regulated delivery of erythropoietin as a function of oxygen tension. Hum. Gene Ther. 8, 1881-1889. 155. Xie, X., Zhao, X., Liu, Y., Young, C. Y., Tindall, D. J., Slawin, K. M., and Spencer, D. M. (2001). Robust prostate-specific expression for targeted gene therapy based on the human kallikrein 2 promoter. Hum. Gene Ther. 12, 549-561. 156. Yu, D. C , Chen, Y., Seng, M., Dilley, J., and Henderson, D. R. (1999). The addition of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant prostate tumor xenografts. Cancer Res. 59, 4200-4203. 157. Luna, M. C , Ferrario, A., Wong, S., Fisher, A. M., and Gomer, C. J. (2000). Photodynamic therapy-mediated oxidative stress as a molecular sw îtch for the temporal expression of genes ligated to the human heat shock promoter. Cancer Res. 60, 1637-1644. 158. Hernandez-Alcoceba, R., Pihalja, M., Nunez, G., and Clarke, M. F. (2001). Evaluation of a new dual-specificity promoter for selective induction of apoptosis in breast cancer cells. Cancer Gene Ther. 8, 298-307. 159. Chung, I., Schwartz, P. E., Crystal, R. G., Pizzorno, G., Leavitt, J., and Deisseroth, A. B. (1999). Use of L-plastin promoter to develop an adenoviral system that confers transgene expression in ovarian cancer cells but not in normal mesothelial cells. Cancer Gene Ther. 6, 99-106. 160. Shinoura, N., Koike, H., Furitu, T., Hashimoto, M., Asai, A., Kirino, T., and Hamada, H. (2000). Adenovirus-mediated transfer of caspase-8 augments cell death in gliomas: implication for gene therapy. Hum. Gene Ther. 11, 1123-1137. 161. Chen, H., McCarty, D. M., Bruce, A. T., and Suzuki, K. (1998). Gene transfer and expression in oligodendrocytes under the control of myelin basic protein transcriptional control region mediated by adeno-associated virus. Gene Ther. 5, 50-58. 162. Hauser, M. A., Robinson, A., Hartigan-O'Connor, D., Williams-Gregory, D. A., Buskin, J. N., Apone, S., Kirk, C. J., Hardy, S., Hauschka, S. D., and Chamberlain, J. S. (2000). 9. Targeted Adenoviral Vectors II: Transcriptional Targeting 2 8 5 Analysis of muscle creatine kinase regulatory elements in recombinant adenoviral vectors. Mol. Ther. 2, 16-25. 163. Steiner, M. S., Anthony, C. T., Lu, Y., and Holt, J. T. (1998). Antisense c-myc retroviral vector suppresses established human prostate cancer. Hum. Gene Ther. 9, 747-755. 164. Ou, Y. C , Yeung, F., Yang, L., Kao, C , Chung, L. W. K., and Gardner, T. A. (1998). MN promoter activity in renal cell carcinoma cell lines: A potential for tissue restrictive gene therapy. / . Urol. 161, 554. 165. Gardner, T. A., Shalhav, M., Kim, H.-S., Ou, Y.-C, Kim, S.-J., and Kao, C. (2001). Preclinical evaluation of renal cell carcinoma specific-oncolysis using MN promoter mediated transcriptional targeting. Mol. Therapy 3, S982. 166. Kurihara, T., Brough, D. E., Kovesdi, I., and Kufe, D. W. (2000). Selectivity of a replication- competent adenovirus for human breast carcinoma cells expressing the MUCl antigen. / . Clin. Invest. 106, 763-771. 167. Ring, C. J., Blouin, P., Martin, L. A., Hurst, H. C , and Lemoine, N. R. (1997). Use of transcriptional regulatory elements of the MUCl and ERBB2 genes to drive tumour-selective expression of a prodrug activating enzyme. Gene Ther. 4, 1045-1052. 168. Kurihara, H., Zama, A., Tamura, M., Takeda, J., Sasaki, T., and Takeuchi, T. (2000). Glioma/glioblastoma-specific adenoviral gene expression using the nestin gene regulator. Gene Ther. 7, 686-693. 169. MoreUi, A. E., Larregina, A. T., Smith-Arica, J., Dev^ey, R. A., Southgate, T. D., Ambar, B., Fontana, A., Castro, M. G., and Lov^enstein, P. R. (1999). Neuronal and glial cell type-specific promoters v^ithin adenovirus recombinants restrict the expression of the apoptosis-inducing molecule Fas ligand to predetermined brain cell types, and abolish peripheral liver toxicity./. Gen. Virol. 80, 571-583. 170. Klein, R. L., Meyer, E. M., Peel, A. L., Zolotukhin, S., Meyers, C , Muzyczka, N., and King, M. A. (1998). Neuron-specific transduction in the rat septohippocampal or nigrostriatal pathway by recombinant adeno-associated virus vectors. Exp. Neurol. 150, 183-194. 171. Cheon, J., Ko, S. C , Gardner, T. A., Shirakawa, T., Kao, C , and Chung, L.W.K. (1997). Osteosarcoma: Osteocalcin promoter based suicide gene therapy in combination v^ith methotrexate in a murine osteosarcoma model. Cancer Gene Ther. 4, 359-365. 172. Gardner, T. A., Ko, S. C , Kao, C , Cui, Q., Balian, G., and Chung, L.W.K. (1998). Exploiting prostate cancer-bone stromal interaction v^ith gene therapy: Application of osteoblastic tissue specific promoter and bone homing mechanism to deliver therapeutic toxic genes for the treatment of prostate cancer. / . Urol. 159, Abstract 16. 173. Wada, Y., Gardner, T. A., Ko, S. C , Kao, C , Kim, S. J., Shirakawa, T., and Chung, L.W.K. (1999). Widening the therapeutic window of thymidine kinase/GCV gene therapy with a tumor-restricted promoter: Osteocalcin based TK gene therapy for osteosarcoma. Proc. Am. Assoc. Cancer Res. 40, Abstract 87. 174. Gardner, T. A., Ko, S.-C, Kao, C , Shirakawa, T., Cheon, J., Gotoh, A., Wu, T. T., Sikes, R. A., Zhau, H. E., Balian, G., and Chung, W. K. (1998). Exploiting Stromal-epitehlial interaction for model development and new strategies of gene therapy for prostate cancer and osteosarcoma metastases (review). Gene Ther. Mol. Biol. 2, 41-58 . 175. Gardner, T. A., Chung, L.W.K,, Koenemen, K., Gillenwater, J. Y., Myers, C , Fisch, M., Kallmes, D., Wada, Y., Yang, L., and Kao, C. (2000). Preliminary safety report of an osteocalcin-based adenoviral gene therapy (Ad-OC-TK) for metastatic and recurrent prostate cancer: Tumor-restrictive promoter confers safety of toxic gene expression. Mol. Therapy 1, S236. 176. Koeneman, K. S., Kao, C , Ko, S. C , Yang, L., Wada, Y., Kallmes, D. F., Gillenwater, J. Y., Zhau, H. E., Chung, L. W., and Gardner, T. A. (2000). Osteocalcin-directed gene therapy for prostate-cancer bone metastasis. World J. Urol. 18, 102-110. 177. Matsubara, S., Wada, Y., Gardner, T. A., Egawa, M., Park, M. S., Hsieh, C. L., Zhau, H. E., Kao, C , Kamidono, S., Gillenwater, J. Y., and Chung, L. W. (2001). A conditional 2 8 6 Gardner ef a/. replication-competent adenoviral
vector, Ad-OC-Ela, to cotarget prostate cancer and bone stroma in an experimental model of androgen-independent prostate cancer bone metastasis. Cancer Res. 61, 6012-6019. 178. Lu, D., Tamemoto, H., Shibata, H., Saito, I., and Takeuchi, T. (1998). Regulatable production of insulin from primary-cultured hepatocytes: insulin production is up-regulated by glucagon and cAMP and down-regulated by insulin. Gene Ther. 5, 888-895. 179. Kaplitt, M. G., Kwong, A. D., Kleopoulos, S. P., Mobbs, C. V., Rabkin, S. D., and Pfaff, D. W. (1994). Preproenkephalin promoter yields region-specific and long-term expression in adult brain after direct in vivo gene transfer via a defective herpes simplex viral vector. Proc. Natl. Acad. Sci. USA 91, 8979-8983. 180. Xie, X., Zhao, X., Liu, Y., Zhang, J., Matusik, R. J., Slav^in, K. M., and Spencer, D. M. (2001). Adenovirus-mediated tissue-targeted expression of a caspase-9-based artificial death switch for the treatment of prostate cancer. Cancer Res. 61, 6795-6804. 181. Southgate, T. D., Windeatt, S., Smith-Arica, J., Gerdes, C. A., Perone, M. J., Morris, I., Davis, J. R., Klatzmann, D., Lowenstein, P. R., and Castro, M. G. (2000). Transcriptional targeting to anterior pituitary lactotrophic cells using recombinant adenovirus vectors in vitro and in vivo in normal and estrogen/sulpiride-induced hyperplastic anterior pituitaries. Endocrinology 141, 3493-3505. 182. Robertson, M. W., 3rd, Wang, M., Siegal, G. P., Rosenfeld, M., Ashford, R. S., 2nd, Alvarez, R. D., Garver, R. I., and Curiel, D. T. (1998). Use of a tissue-specific promoter for targeted expression of the herpes simplex virus thymidine kinase gene in cervical carcinoma cells. Cancer Gene Ther. 5, 331-336. 183. Kim, S., Lin, H., Barr, E., Chu, L., Leiden, J. M., and Parmacek, M. S. (1997). Transcriptional targeting of replication-defective adenovirus transgene expression to smooth muscle cells in vivo./. Clin. Invest. 100, 1006-1014. 184. Harrod, K. S., Hermiston, T. W., Trapnell, B. C., Wold, W. S., and Whitsett, J. A. (1998). Lung-specific expression of adenovirus E3-14.7K in transgenic mice attenuates adenoviral vector-mediated lung inflammation and enhances transgene expression. Hum. Gene Ther. 9, 1885-1898. 185. Park, B. J., Brown, C. K., Hu, Y., Alexander, H. R., Horti, J., Raje, S., Figg, W. D., and Bartlett, D. L. (1999). Augmentation of melanoma-specific gene expression using a tandem melanocyte-specific enhancer results in increased cytotoxicity of the purine nucleoside phosphorylase gene in melanoma. Hum. Gene Ther. 10, 889-898. 186. Emiliusen, L., Gough, M., Bateman, A., Ahmed, A., Voellmy, R., Chester, J., Diaz, R. M., Harrington, K., and Vile, R. (2001). A transcriptional feedback loop for tissue-specific expression of highly cytotoxic genes which incorporates an immunostimulatory component. Gene Ther. 8, 987-998. C H A P T E R Development of Attenuated Replication Competent Adenoviruses (ARCAs) for the Treatment of Prostate Cancer Daniel R. Henderson and De-Chao Yu Calydon, Incorporated Sunnyvale, California I. Introduction The specificity, or therapeutic index, of anticancer chemotherapy agents has long been problematic. The majority of cancer chemotherapy agents, such as alkylating agents, antimetabolites, antibiotics, plant alkyloids, and other cytotoxic agents, nonspecifically injure or kill dividing cells [1]. These agents are noted for their poor specificity and low therapeutic ratio of toxicity toward target cancer cells compared to normal cells (e.g., therapeutic ratios of 2:1 to 6:1). In some instances, hormonal anticancer agents offer improved specificity [2]. The few biologic response modifiers [3], particularly humanized monoclonal antibodies, also offer greater anti-cancer specificity. However, cytotoxic agents remain the mainstay of cancer chemotherapy. The unwanted toxicity problems, most notably the myeloid stem cell suppression characteristic of cytotoxic drugs, are so great that drugs designed to recover patients from the side-effects of cytotoxic anticancer agents such as G-CSF, GM-CSF, and erythropoetin [4] represent as significant a commercial market as the cytotoxic chemotherapy agents themselves. Intense efforts to increase specific cancer cell cytotoxicity of anticancer agents have frustrated researchers for decades. One such effort is gene ther apy [5, 6]. In experimental models of gene therapy using replication defective adenoviruses (Ads), the use of prodrug converting enzymes such as herpes simplex virus thymidine kinase [7-11] and cytosine deaminase [10] under the control of transcriptional response elements (TREs), has shown anticancer activity in animal models with significantly increased specificity. However, to ADENOVIRAL VECTORS FOR GENE THERAPY 2 8 7 Copyright 2002, Elsevier Science (USA). All rights reserved. 2 8 8 Henderson and Yu destroy a solid tumor in a human, replication-defective adenoviruses must deliver a therapeutic gene and initiate a significant bystander effect all before the host immune response to the adenovirus coat proteins limits further treatment. Unfortunately, in humans even w^hen gene transfer v^as success ful, gene expression from replication-defective vectors has been inadequate or too short-lived. Thus, clinically the limiting issue has been a lack of efficacy. To address some of these shortcomings we have tried to design therapeu tics v^ith sufficient specificity and efficacy so that the short-term expression of adenovirus v îll be successful in killing enough target cancer cells to be med ically useful. Physically, replicating adenoviruses can infect a broad range of human cells and produce infectious progeny that could attack adjacent tumor cells, leading to destruction of a solid tumor w^ithin a short period of time from a single virus treatment. In human patients, tumor-specific replicating adenoviruses w^ould be expected to induce a strong cytotoxic T-cell response confined to the target tumor cells precipitating a cancer vaccine-like response that could help eliminate tumor cells. Replicating viruses have been proposed to treat cancer for nearly a century 112]. The first sustained attempts to treat tumors in animal models occurred in the late 1940s and early 1950s w^hen infections w êre induced v^ith viruses such as avian pest, Russian Far East encephalitis, St. Louis encephalitis, Coxsackie, foot and mouth, herpes simplex, influenzae. West Nile, dengue, Nev^castle disease, vaccinia, and rabies [13]. A significant early attempt was made to explore the cell-killing properties of replicat ing cytolytic adenoviruses for the treatment of cancer in humans. The first isolates of adenovirus were shown to grow "luxuriantly" on HeLa cells, cells originally derived from cervical cancer. It was proposed that perhaps adenoviruses would preferentially replicate in and destroy cervical cancers. Smith et al. [14] tested 10 different wild-type adenovirus serotypes, includ ing adenovirus type 5 (Ad5), as a treatment for locally advanced cervical carcinoma. Virus was administered via intratumoral injection or intraarte rial injection. The virus stocks used were unpurified lysates of tissue culture cells; the number of infectious viral particles (plaque-forming units) and the total number of virus particles in the injected dose were not determined. Although long-term clinical benefit was not achieved, tumor necrosis and cavity formation was observed in 6S% of treated patients via intratumoral injection, and these effects were limited to the carcinoma tissue. Side effects, detected primarily in patients receiving immunosuppression with cortisone, included febrile illness and malaise; in all cases, the symptoms resolved in 7-9 days. Infectious virus was not recovered from any biopsy specimens or vaginal smears, but the titers of neutralizing antibodies were uniformly ele vated by 5 -7 days postinjection [14]. This study is significant, for it illustrates the promise and limitations of oncolytic adenoviruses while describing the 10. Development of ARCAs for the Treatment of Prostate Cancer 2 8 9 limited toxicity to be expected of replicating adenoviruses that contain the E3 region and do not contain transgenes encoding foreign proteins at these intermediate dose levels. However, adenoviruses were subsequently shown to replicate in many cell types and lacked the hoped-for specificity for cervical cancer cells. A resurgence of interest in replicating adenoviruses has occurred in the past decade due to the ability to genetically manipulate viruses. In 1996, Bishoff et al, introduced the use of Ad5 deleted in the ElB-55kD protein so that the virus (ONYX-015 = dll520) [15] preferentially replicates in p53" cells as compared to p53+ cells by a factor of 100-fold. However, the mechanism of antitumor specificity of the ONYX-015 virus has come under criticism [16-20]. In 1997, Rodriquez et al. introduced transcriptional target ing of adenovirus using the enhancer/promoter of the human prostate-specific antigen gene to drive the Ad5 El A gene [21]. We have focused on the use of transcriptional response elements to control the expression of virus genes required for virus replication [21-23]. To test this idea we initially chose prostate cancer and the regulatory enhancer and promoter elements (PSE) of prostate-specific antigen (PSA). PSA is the most widely used serum marker for the diagnosis and management of any form of cancer. It is produced in prostate cancer cells and normal prostate ductal epitheha (which represents less than 5% of the cells of the prostate); it is also produced in much smaller amounts in the periurethral glands (less than 0.01% compared to prostate epitheha) and very rarely in tumors of the skin and salivary gland, but frequently in tumors of the female breast [24]. Since the prostate is an accessory organ, removal or ablation of the entire gland has no serious health repercussions [2, 25-28] , although the side-effects of incontinence and impotence are legendary. A virus destroying all PSA- producing cells would not be expected to attack cells leading to incontinence and impotence. Thus, the regulatory regions of the prostate-specific antigen gene are a reasonable choice for such an approach. We reasoned that placing adenovirus genes under the control of the PSE would create host range mutants or a virus in which replication would be restricted primarily to PSA-producing (PSA+) ductal epithelial cells within the prostate, and PSA+ prostate cancer (PCA) cells. We refer to our geneti cally engineered viruses using transcriptional response elements as attenuated replication-competent adenoviruses (ARCAs). We describe CV706 (PSE driv ing the Ad5 ElA genes and deleted in the Ad5 E3 region), which is currently in clinical trials for localized prostate cancer. Since taking CV706 to clinic, we have focused on improving the specificity and efficacy of the ARCA platform. Below we describe additional prostate-specific viruses on the developmental pathway from CV706, leading to CV787 (probasin driving the ElA gene, PSE driving the ElB gene, and reintroduction of the Ad5 E3 region) and their toxicity and explore the possibility of achieving a better antitumor efficacy 2 9 0 Henderson and Yu by combining ARCA with conventional therapies including radiotherapy and chemotherapy. CV787 is also currently in the clinic. II. ARCAs for Prostate Cancer: CV706 and CV787 A. Adenovirus: Gene Expression and Regulation Members of the human Adenoviridae family were first cultured from the tonsils and adenoids of children in 1953 [29]. They represent 51 different serotypes which are distinguishable by antibody reactivity to epitopes on the virion surface. Each serotype is assigned to one of five subgroups (A-E). Adenovirus type 5 (Ad5), a member of Subgroup C, is associated with a self-limiting, febrile respiratory illness and ocular disease in humans; infectious virus can be recovered from the throat, sputum, urine, and rectum. Ad5 is also associated with renal impairment, hepatic necrosis, and gastric erosions in immunosuppressed individuals [30, 31]. Ad5 and the other Subgroup C viruses have little or no oncogenic potential in mammals [32]. The adenovirus type 5 genome is a double-stranded DNA molecule of 35,935 base pairs [33] containing short inverted terminal repeats [34]. Expression of the genome is a regulated cascade which is arbitrarily divided into early (E) and late (L) phases, with viral DNA replication required for maximal L gene expression. Related RNA transcripts are grouped according to the region of the genome from which they are transcribed as well as by the timing (E or L) of their expression. Viral gene expression is regulated at the levels of transcription, posttranscriptional modification (splicing), translation, and posttranslational modification. Products of the El region are essential for efficient expression of the other regions of the adenovirus genome. The ElA transcription unit is the first Ad sequence to be expressed during viral infection and its products play a crucial role in a number of important biological functions in adenovirus-infected cells. The E2 region encodes several proteins that are required for viral DNA replication. These include a DNA- binding protein [35], the viral DNA-dependent DNA polymerase, and the DNA terminal protein that are required for DNA replication [36-38]. The E3 region is not essential for replication in tissue culture and this region is deleted from most first-generation therapeutic adenoviruses [39, 40]. Proteins encoded by the E3 region modulate host immune responses to infection by inhibiting transport of the MHC class I protein to the
cell surface, thereby impairing the cytotoxic T lymphocyte (CTL) response [41-43], and by blocking TNFA- induced cytolysis of infected cells [44-46]. Significantly, all natural isolates of adenovirus contain the E3 region. Seven transcripts of the E4 region have been identified. Some of the encoded proteins interact with and/or modulate the activity of El region proteins. 10. Development of ARCAs for the Treatment of Prostate Cancer 2 9 1 The onset of viral DNA replication signals the switch from E to L gene expression. Although the precise mechanisms are not fully understood, this transition requires both cis- and trans-acting factors [47-49]. Late genes primarily encode the structural components of the virion and the nonstructural scaffolding proteins that are essential for the assembly of infectious virus. It is estimated that up to 10,000 adenovirus virions accumulate per cell and most remain cell-associated [50]. The entire adenovirus replication cycle is complete in approximately 32-36 h [51]. Host range mutants of adenovirus have played a significant role in elucidation of virus functions. ARCAs using transcriptional response elements create host range mutants where replication is restricted to a particular cell type. The cytotoxicity associated with virus replication (lysis) and the vaccine nature of expressing highly visible foreign capsid antigens should be limited to a certain type of cell. B. Tissue Specificity of ARCA We hypothesized that tropism of a virus could be redirected if expression of an essential viral gene could be controlled. Viruses generated from this approach would have the same capsid as its parental virus and they should be able to penetrate all cell types that express the CAR receptor. Presumably, in all cells containing the CAR receptor, these viruses would follow the normal cell entry process: they would penetrate the endosome, fuse with the endosome membrane, reach the cytoplasm, find transport to the nucleus, and uncoat the viral DNA. In a normal adenovirus replication cycle the ElA gene is the only gene expressed during the first 2.5 h of infection [52-55]. In turn, the ElA proteins as transcription factors upregulate expression of the impending cascade of viral genes. However, we have genetically engineered prostate tissue- specific promoters and enhancers so as to drive the ElA genes. Viral replication should preferentially take place in cells that express the necessary transcription factors, thus enabling activation of the tissue or tumor-specific transcription regulatory elements. Thus, the ElA proteins should be preferentially expressed and the virus preferentially replicate in prostate cells. There are several criteria important in regard to the transcriptional response element (TRE) necessary for the successful engineering of a thera peutic adenovirus: (1) the tissue-specific regulatory specificity must be tightly regulated, and transcription should be limited to tumor cells, or accessory cells with as few other sites of expression as medically tolerable, (2) the TRE must regulate the initiation of transcription of the adjacent gene, (3) the promoter must be strong enough to drive sufficient expression of essential viral genes, and (4) the TRE must be small enough to fit within the packaging limits of adenovirus. We chose prostate cancer and the TREs of PSA as our initial target. Expression of the PSA gene is modulated by the prostate-specific enhancer (PSE) element that is located several thousand nucleotides upstream of the PSA 292 Henderson and Yu promoter [56]. When fused to a fragment (position -230 to +7, relative to the start of transcription) containing the PSA promoter, the PSE (position —5322 to —3875, relative to the start of transcription) confers tissue-specific expression on the reporter gene chloramphenicol acetyl-transferase (CAT) [56]. Sequence analysis of the PSE reveals the presence of regions v^ith homology to steroid-response elements (SREs) and to binding sites for several cellular transcription factors including c-Fos and AP-1 [23, 56., 57]. A functional androgen-response element (ARE) w îthin the PSE increases expression up to 100-fold in the presence of testosterone or the nonmetabolized testosterone analog Rl881. 1. ARC As Containing One Prostate-Specific Transcriptional Response Element To test the feasibility of the ARCA technology, v ê engineered the PSE fragment into the adenovirus genome and generated a first generation virus, CV706. CV706 contains the PSE fragment (PSA promoter and enhancer) inserted immediately upstream of the El A region and transcription of the El A region is regulated by the PSE (Table I). Virus characterization show^ed that CV706 was able to efficiently replicate in PSA+ prostate carcinoma cell lines but not in the other PSA" human cell lines HBL-100, MCF-7, PANC-1, OVCAR-3. CV706 also does not replicate efficiently in DU-145, a prostate cancer cell line which does not express PSA and does not contain the androgen receptor [21]. Further study indicated that the transcription of the ElA mRNA was regulated by the PSE. ElA mRNA was detectable in PSA+ LNCaP cells, Table I ARCAs for Prostate Cancer Virus E l A E l B E3 E4 Targeting cell driven by driven by region driven by CV702 wt wt Deleted wt N/A CV706 PSE wt Deleted wt Prostate cancer CV711 wt PSA Deleted wt Prostate cancer CV716 PSE PSE Deleted wt Prostate cancer CV730 No ElA wt Deleted wt N/A CV737 PB wt Deleted wt Prostate cancer CV738 wt PB Deleted wt Prostate cancer CV739 PB PSE Deleted wt Prostate cancer CV740 PB PB Deleted wt Prostate cancer CV757 wt wt Deleted PSE Prostate cancer CV763 H K 2 wt Deleted wt Prostate cancer CV764 PSE H K 2 Deleted wt Prostate cancer CV787 PB PSE Full-length wt Prostate cancer CV802 wt wt Full-length wt N/A 10. Development of ARC As for the Treatment of Prostate Cancer 2 9 3 but was not detectable in PSA~ cells. El A protein was also reduced by 99% in PSA~ cells, compared to that in the PSA+LNCaP cells [21]. This indicates that the inserted PSE has successfully controlled expression of the El A gene and the host range of this adenovirus mutant has been confined to a particular cell type. We also showed that the tropism of adenovirus could also be changed when the ElB gene or the E4 gene was placed under the control of the PSE TRE. CV711, whose ElB gene is placed under the control of PSE, and CV757, whose E4 genes are driven by PSE, both replicate similarly to wild- type adenovirus in PSA+ cells but are highly attenuated in PSA~ cells. Cell specificity of CV711 viruses is similar to CV706 and replicates similarly to wild-type virus in PSA+cells. In contrast, CV757, shows significantly greater specificity for PSA"^cells. While CV757 grows similarly to wild-type in PSA+ cells, it suffers a very large reduction in the ability to replicate in PSA~ cells (data not shown). Thus, adenovirus mutants can be generated to target PSA+ cells when any one of the ElA, ElB, of E4 genes are driven by the PSE. These observations have been confirmed with other prostate-specific TREs including the TREs for probasin and hK2. The rat probasin (PB) gene is developmentally regulated in the prostate by androgens. Induction of the rat probasin gene by androgens was shown to involve the partic ipation of two different cis-acting DNA elements that bind the androgen receptor. An expression cassette carrying 426 bp of the PB gene promoter and 28 bp of the 5^-untranslated region was found to be sufficient to tar get expression of a bacterial CAT reporter gene specifically to the prostate epithelium [58]. It was also shown that the same 5^-flanking region of PB gene promoter fragment fused to the SV40 TAg gene could lead to the devel opment of progressive forms of prostate disease that histologically resemble human prostate cancer in transgenic animals [58]. The promoter of the rat probasin gene was engineered into adenovirus to drive the expression of either the ElA gene or the ElB gene to generate CV737 and CV738, respec tively. Both CV737 and CV738 showed significant specificity to PSA+prostate carcinoma cells. We also recently cloned the TRE of the human glandular kallikrein (hK2) gene. The hK2 gene is located 12 kb downstream from the PSA gene in a head- to-tail fashion, whereas the hKl gene is located 30 kb upstream of the PSA gene in head-to-head fashion [59]. The PSA and hK2 gene share DNA (80%) and amino acid (78%) sequence homologies that suggests they evolved by gene dupfication from the same ancestral gene [60, 61]. Interestingly, the hK2 protein was recently shown to be expressed in every prostate cancer, and the expression of hK2 protein incrementally increased from benign epithelium, to high-grade prostatic intraepithelial neoplasia, to adenocarcinoma. We recently described CV763 containing the hK2 promoter and enhancer driving the Ad5 El gene. CV763 behaved identically to CV706 [23]. 2 9 4 Henderson and Yu Thus, the repHcation of adenovirus can be restricted to prostate cancer cells when one of the essential adenovirus genes El A, ElB, or E4 is placed under the control of any one of three different prostate-specific TREs. 2. ARC As Containing Tw ô Prostate-Specific Transcriptional Response Elements Since both the El A and ElB genes are essential for adenovirus replication, we reasoned that it was possible to create a virus with significantly higher specificity if both the El A and ElB genes were under independent control of two TREs. To test this hypothesis, we generated an adenovirus mutant CV716, in which both the El A gene and the ElB gene were under the control of PSE. In vitro study showed that CV716 replicated well in the PSA-producing prostate cancer cells. However, replication of CV716 was highly attenuated in nonprostate human cell lines. Compared to CV706, the efficiency of CV716 replication in nonprostate cancer cells has been further reduced by another 100-fold, giving specificity for PSA^ cells compared to PSA" cells of nearly 10,000:1 (data not shown). The high degree of specificity for PSA"̂ cells of CV716 as compared to PSA~cells was found to be universally true [22, 23]. CV740, containing duplicate copies of the rat probasin promoter, also showed this high level of specificity. Unfortunately, CV716 and CV740 are genetically unstable, resulting in self-inactivation of the virus. The ElA gene and one copy of the tissue-specific TRE inserts are deleted during replication. Southern blot analysis of stocks of CV716 indicated a new band when annealed with an EIB-labeled probe. DNA sequence analysis of the cloned deletion mutant indicated that self-inactivation is due to homologous recombination between two identical inserted TREs. In order to make a stable tissue-specific adenovirus we employed two different TREs to drive expression of early essential viral genes. In CV739 the ElA gene and the ElB genes are under the control of the TRE of the rat probasin gene and PSA gene, respectively. CV739 replicates well in PSA"̂ prostate cancer cells, but poorly in nonprostate human cancer cell lines. The cell specificity of CV739 was similar to that of CV716, again showing the roughly 10,000:1 selectivity for PSA+ cells as compared to PSA" cells. However, CV739 is stable. No replication-defective mutants with deleted genomes were found after extensive passages. The same is true for other CV739-like viruses including CV764. CV764 is a stable ARCA variant containing the PSE driving the ElA genes and the hK2 promoter and enhancer driving the ElB genes. The sequences of the PSE and hK2 promoter and enhancer are 80% identical, yet the virus is genetically stable. Again, CV764 has the high therapeutic index of the other viruses containing two prostate-specific TREs with a cell specificity of 10,000:1 for PSA+ cells compared to PSA-cells [22, 23]. Taken together, these adenovirus variants show that tropism of aden ovirus can be redirected by placing essential viral genes under the control of 10. Development of ARCAs for the Treatment of Prostate Cancer 2 9 5 tissue-specific regulators. The cell selectivity of a stable oncolytic virus can be over 10,000:1 w^hen the expression of more than one viral gene is driven by two different tissue-specific TREs. The phenomenal success of creating adenovirus host range mutants v^ith specificity for target cells compared to nontarget cells of over 10,000:1 is one of the major achievements of the ARCA technology. C. Antitumoral Efficacy of ARCA In vivo studies evaluating intratumoral and intravenous administration of prostate-specific adenoviruses w êre conducted in the nu/nu mouse containing human tumor xenografts. Tumors were produced by subcutaneous injection of PSA+-producing prostate cancer LNCaP cells into each flank of each mouse, and after establishment of palpable tumors (mean
tumor volume 300 mm^), the tumors were directly injected with purified virus or vehicle (PBS and 10% glycerol). Tumor growth was then followed for 6 weeks, at which time the mean tumor volume in each group was determined. A significant antitumoral activity was observed in the in vivo study for CV706. Tumor volume dropped by more than 80% in the animal group that was treated with CV706 by a single intratumoral injection. These residual tumor masses were shown by histology to be scar tissue devoid of PSA+ cells. After 6 weeks, 5 of 10 mice were visually free of tumor [21]. In contrast, DU145 is a prostate cancer cell line that is PSA~ and does not produce the androgen receptor. Tumors of DU145 cells were induced in nude mice and challenged with buffer, wild-type Ad5 but E3 virus CV702 and CV706. The results showed that CV702 inhibited growth of DU145 tumors, whereas CV706 has no effect on tumor growth. Thus, the prostate-specific CV706 virus not only shows efficacy but also selectivity for PSA"^cells in vivo [21]. The E3 region has long been considered unnecessary for replication of adenovirus in vitro. It has been universally deleted from Ad5 gene therapy constructs until recent efforts to prolong transgene expression from replication- defective Ad5 gene therapy constructs [39,40, 62-64]. To test the possibility of increasing virus cytotoxicity, we created CV787 from its parent virus CV739 by engineering the full-length E3 region back into the viral genome. Thus CV787 contains the rat probasin promoter driving the ElA gene the PSE driving the ElB gene. Otherwise, CV787 is identical to the recombinant wild-type adenovirus CV802. CV787 retained the high specificity of characteristics of two TRE-containing viruses driving the ElA and ElB genes. Cell viability assay and virus yield assay demonstrated that addition of E3 aids virus replication and increases virus cytotoxicity. Thus CV787 has a stronger cytotoxicity than CV739 [22]. The increased cytotoxicity due to the Ad5 E3 region was also confirmed in vivo in the LNCaP xenograft animal model. A single intratumoral injection 2 9 6 Henderson and Yu of CV739 and CV787 yielded identical reduction of LNCaP xenografts. However, CV739 required 100-fold more virus to achieve the same effect as CV787 [22]. A single intratumoral CV787 at a dose of 1 x 10^ particles/mm^ was curative for animals 6 weeks after treatment (^ = 8). A single intravenous injection of CV739 at a dose of 5 x 10^^ particles could stop tumor growth, whereas CV787 at this dose level caused a fourfold reduction in tumor volume [22]. Six weeks following a single intravenous injection of 1 x 10^^ particles, the sizes of tumors were reduced to less than 5% of their original size, and 8 of 14 mice were visually free of tumors. The residual tumors measurably present were immunohistologically devoid of PSA [22]. The serum PSA levels in mice injected intravenously with CV787 decreased to 5% of their starting values within 4 weeks. Intravenous administration of CV787 designed to treat LNCaP xenografts showed that 1 x 10^^ particles could eliminate 300 mm^ preexistent LNCaP xenografts, whereas 1 x 10^^ particles of CV706 administered intravenously only stabilizes tumors. A dose-response curve of 1 X 10^ and 1 x 10^^ CV787 particles administered as a single intravenous dose can stabilize and regress tumors, respectively, but not eliminate tumors. These data indicate that CV787 has a significantly improved antitumor activity and a single dose of intratumoral or intravenous administration can eliminate pre-existent tumors in animal models. D. Mechanism for Cell-Killing of ARCA Infection with adenovirus causes profound changes in host-cell macro- molecular synthesis that ultimately lead to cell death. Virion fiber protein inhibits macromolecular synthesis when applied directly to cells bearing the adenovirus receptor [65]; soluble penton protein causes cytopathic effects (CPEs) in susceptible cells that are similar to those caused by infectious virus [66]. Cell-specific DNA synthesis, export of cellular mRNAs from the nucleus to the cytoplasm, and cell-specific translation are all inhibited after infection, but the precise mechanisms are not completely understood. The 243E1A protein induces the full range of classical apoptotic events by increasing the level of the host cellular tumor suppressor protein p53. The 289E1A protein induces apoptosis by a p53-independent mechanism that requires a product of the E4 region [67, 6S]. The ElA-induced activation of the apoptosis path way (s) must be modulated by ElB proteins to ensure efficient virus replication prior to cell death [69]. Activation of the interferon-inducible RNase L pathway by the adenovirus-associated type I (VAI) RNA [70] may also contribute to the stimulation of apoptotic pathways in adenovirus-infected cells [71]. The E3 11.6-kDa adenovirus death protein also has a role in cell- killing and promotes the release of progeny virions from the cell [72, 73]. We have investigated how our oncolytic viruses kill tumors in the nuinu mouse model. Immunohistochemical analyses were performed to assay for the 10. Development of ARCAs for the Treatment of Prostate Cancer 2 9 7 de novo synthesis of CV787-encoded proteins in tumor xenografts and to examine the effects of treatment with CV787 on tumor morphology in vivo. The mice bearing human LNCaP tumors were injected intravenously on day 0 with 1 X 10^^ particles of CV787 per animal. Tumors were excised from two animals on days 1, 3, 7, 14, 21, and 28. The tumors were cut into six pieces and each piece fixed, embedded in paraffin, and sectioned. Sections were stained for the presence of adenovirus protein by a double-antibody protocol with rabbit anti-Ad antibodies and Fast Red stain followed by a hematoxylin counterstain. On day 1, intracellular staining for adenovirus protein was detected in less than 1% of the tumor cells examined in 12 sections from two tumors. Occasional small clusters of stained cells, as well as dispersed single stained cells, were visible. By day 3, large clusters of cells expressing adenovirus proteins were detected in one of the two excised tumors. In some instances, areas of tumor necrosis were adjacent to clusters of adenovirus protein positive cells. On day 7, intracellular staining for adenovirus proteins was detected in greater than 10% of the tumor cells examined in 12 sections from both excised tumors. Virus-infected cells within the tumor sections were prominent on Day 21 and increased to more than 90% of the microscopic field of the section by Day 28. These results demonstrated that CV787 replicated in and expressed virus-encoded gene products in the LNCaP xenografts. The increased distribution of virus protein-positive cells indicated that infectious progeny CV787 spread to adjacent cells within the tumor which was associated with progressive necrosis in vivo [22]. Adenovirus-induced apoptosis causes cell death in vitro., specifically at the late stage of infection [67]., and this process may contribute to the therapeutic effect of oncolytic virus in vivo. LNCaP xenografts in athymic mice were treated on day 0 with vehicle alone or a total dose of 3.2 x 10^ particles of CV706 per mm^ of tumor. Tumor biopsy specimens were taken on day 14, and 5-\|xm sections were prepared and examined for apoptosis. Extensive areas containing apoptotic nuclei were detected in sections of tumors treated with CV706. More than 25% of nuclei were apoptotic in some sections from CV706-treated tumors. In contrast, less than 2% of nuclei were apoptotic in sections from tumors treated with vehicle alone. Additionally, a visual change of tumor color has been documented when the animals receive tumor specific adenovirus variants. For example, the color of the established human LNCaP xenografts is black. However, the tumors will become white within 1 week after receiving a dose of CV706 or CV787 through either intratumoral or intravenous administration. Histological H&E staining analysis found that the virus-treated tumors had significantly fewer numbers of blood vessels when compared to the tumors treated with vehicle. It is unclear at this time as to the precise mechanism by which this reduction in blood vessel number is achieved. This can achieved either though direct 298 Henderson and Yu A. Vehicle g cwOB .:'.> V-\-.. / <. -, l?^..v rr. ::r': • - ^'^"'!® V.!" '^?^ '*°'" '"9 f"'' "^^'y developed blood vessel. Tumors were harvested 14 days after receiving (A) vehicle or (B) 1 x 10^ particles/mm3 tumor of CV706 and stained with anti-CD31 monoclonal antibody by immunohistochemical analysis. damage of endothelial cells or indirectly through the destruction of tumor vasculature by extensive necrosis. CD31 is expressed constituitively on the surface of adult and embryonic endothelial cells and has been used as a marker to detect angiogenesis [74]. Immunohistochemical staining was performed to examme the effect of virus treatment on tumor angiogenesis by using monoclonal antibody against CD31. Tumors treated with CV706 showed a sigmficantly lower level of CD31-positive cells in the vessel when compared to vehicle treated tumors (Fig. 1). This observation suggests that CV706 may be mhibitmg tumor angiogenesis to a significant extent. The change of tumor color from black to white has been a reliable early indication for antitumor ethcacy of a virus. III. Synergy of ARCA and Conventional Therapy Although conventional cancer therapies (surgery, chemotherapy, and radiation) are effective at curing early-stage disease, few human cancers are curable with a single modality. The utilization of a replication-competent cytolytic adenovirus as a therapeutic modality shows much promise. In our laboratory and clinical trials, CV706 and CV787 have been shown to be effective agamst human prostate tumors [21-23]. However, single-dose total eradication of human LNCaP xenografts in our animal model required as much as one-third of the lethal dose of virus alone [22, 75]. To set the bar for efficacy high, namely single-dose efficacy, is deliberate. While multiple doses 10. Development of ARCAs for the Treatment of Prostate Cancer 2 9 9 always allowed total eradication of tumors with lower doses, in the clinic the patient immune response will tend to limit the number of doses that can be effectively delivered despite the SIAPA technology described below. Certainly, strategies to improve the efficacy of these viruses are desirable. However, in preclinical experimental animal models, it can be readily appreciated that genetic engineering allows creation of many different viruses with an associated rationale for why the new mutant may be an improvement with greater efficacy over its predecessor. Experimentally it is impossible to compare different viruses for their efficacy in animal models unless a standardized treatment regimen is used. Thus, we use only single-dose treatment regimens in our animal studies. Small changes in efficacy do not warrant replacing current clinical candidates; large changes in efficacy are most interesting. The largest changes in efficacy we have seen came with the addition of the E3 region and the synergy afforded by radiation and chemotherapy. We studied neoadjuvant therapy consisting of combining ARC A with conventional therapy for additional reasons as well: (1) combinations of agents with different toxicological profiles can result in increased efficacy without increasing overall toxicity to the host; (2) overlapping resistance between ARCA and conventional therapeutics has not been described previously and a combination of agents may thwart the development of drug resistance; and (3) tumor cell populations have different drug sensitivity profiles, which allow the physician to take advantage of possible synergies between drugs, resulting in increased anticancer efficacy in patients. A. Synergy of CV706 and Irradiation Radiation therapy, either administered through external beam or seed implantation (brachytherapy), is one of the most widely used therapeutic modalities for treatment of clinically localized prostate cancer [76, 77]. How ever, nearly 30% of patients treated with potentially curative radiation doses suffer relapse as defined as three serial rises in serum PSA levels (biochemical failure). Specifically, the eradication of locally advanced or high-risk prostate cancer with radiation has proven more difficult than believed previously. The gains with high radiation dose have been modest and fraught with signifi cant side-effects [78]. It is apparent that there is a need for novel methods of radiosensitization. We have examined the effects of a combination treat ment involving CV706 and irradiation for localized prostate cancer. We have demonstrated a very high synergy when irradiation treatment is complemented with CV706. Initial in vitro experiments demonstrated a synergistic cytotoxicity to LNCaP prostate cancer cells when CV706 was combined with radiation. LNCaP cells treated with CV706 and radiation had significantly decreased viability compared to cells treated with either agent alone. LNCaP cells 300 Henderson and Yu treated with radiation exhibited
a significantly greater burst size of CV706 (m.o.i. = 0.1) with more than 100 times more virus produced per cell. In addition, the combination treatment of CV706 with radiation did not alter the specificity of replication-mediated cytotoxicity. A similar synergistic anti-tumor efficacy of combination therapy with CV706 and radiation was also observed in vivo in prostate LNCaP xenografts. Previous in vivo studies demonstrated that prostate tumors were completely eliminated within 6 weeks by a single intratumoral administration of CV706 at a dose 5 x 10^ particles per mm^. Combination treatment of CV706 at a dose of 1 X 10'̂ particles per mm^ with radiation 10 Gy eliminated tumors within 6 weeks. Under similar conditions CV706 or radiation alone could only slow down or inhibit further tumor growth (Fig. 2). Thus, a 50-fold lower dose of virus (1 x 10^ particles) can be used in the combination treatment modality to achieve the same curative effect. Statistical analysis of the in vivo studies indicated that CV706 and the radiation combination group showed a significant anti-tumor synergy with a 1.5- to 6.7-fold higher inhibition of tumor Weeks ""•-Vehicle -"CV708 m) and EBRT (d1) - ^ C V 7 0 6 (1x10'̂ p/mm3) (dO) XBRT(10Gy)(d1) -Q~ E8RT (dO) and CV706 (d1) Figure 2 /n v/vo efficacy of intratumorally administered CV706 and radiation against nude mouse LNCaP xenografts. Tumor volume of LNCaP xenografts treated witfi either vehicle (diamond), CV706 alone (1 x 10'̂ particles per mm^ of tumor, circle), radiation alone (10 Gy, triangle), CV706 (1 X 10'̂ particles per mm^ of tumor) at day 0 plus radiation (10 Gy) at day 1 (close square), and radiation at day 0 plus CV706 at day 1 (open square). 10. Development of ARCAs for the Treatment of Prostate Cancer 3 0 1 growth over the additive effect during the entire treatment period. Subsequent studies have show^n that a synergistic antitumor efficacy could be achieved w^hen 1 X lO"" particle CV706 w âs combined with only 5 Gy radiation (unpublished data, Chen etal.). Further in vivo studies are in progress to determine the effective minimum dose of CV706 in combination with radiation required for complete regression of tumors. A series of experiments was then designed to examine the effects of the sequencing of the agents, the timing of radiation following virus admin istration, and radiation fractionation. Efficacy was highly dependent on the sequencing of the agents; treatment with CV706 24 h prior to radiation was significantly superior to radiation followed by CV706. The antitumor activity was decreased when the tumors were treated with radiation 7 days after CV706 administration. However, there was no significant difference in antitumor effi cacy when the tumors were treated with CV706 followed by a single dose of radiation or four sequential daily fractional doses of radiation as long as the total does of radiation was the same. A preliminary assessment of synergistic activity in the CV706 and radi ation combination treatment reveals several mechanistic possibilities. First, radiation at the synergistic dose significantly increases virus replication. One- step growth curve study shows that although synergistic doses of irradiation did not alter virus replication kinetics, the irradiation significantly increases the burst size of CV706 in LNCaP cells. For example, burst size of CV706 in LNCaP cells treated with CV706 for 24 h followed by irradiation is 500-fold higher than that in cells treated with CV706 alone (0.01 m.o.i.). Irradiation kills mammalian cells in the reproductive (also known as clonogenic) death pathway, and breaks down DNA strands. Most radiation induced DNA double-stranded breaks are rapidly repaired by constituitively expressed DNA repair mechanisms [79]. DNA repair machinery becomes more active in irradi ated cells, thus allowing for greater replication/multiplication of the episomal adenoviral DNA. Because of its small target size, the adenoviral genome (36 kb) is far less likely to sustain radiation-induced damage as it is 10^-fold smaller than that of human cells (3 x 10^ kb). Therefore, the more active cellular DNA synthesis machinery in the irradiated cells may facilitate viral DNA synthesis and virus replication. Second, CV706 may be augmenting the anti-tumor activity of radiation. The adenovirus El A gene is the only viral gene expressed during the first 2.5 h of infection and encodes a multifunctional tran scriptional factor also known to induce apoptosis [32, 80]. It is believed that the adenovirus ElA gene is a potent inducer of radiosensitivity through p53- dependent and -independent mechanisms. Malignant tumors, when expressing adenovirus ElA, are very sensitive to treatment with DNA-damaging agents in vivo., including irradiation [81, 82]. In the tumors treated with CV706 and radiation, the histological features included intravascular thrombosis and massive necrosis positioned more centrally within tumors. This supports a 3 0 2 Henderson and Yu growing concept for the involvement of an effect on the destruction of the vasculature leading to tumor reduction and elimination. This seems to be in agreement w îth a recent finding that inhibition of angiogenesis led to increased tumor radiosensitivity [83]. Indeed, CV706 in combination v^ith radiation exerted a significant reduction of CD31 positive blood vessels, indicating an anti-angiogenesis effect of the combination treatment [84, 85]. As human tumors are composed of a mixture of cells having different genetic makeup, this inherent intratumoral heterogeneity may need treatment w îth multiple therapeutic modalities. As demonstrated here, radiation can be successfully combined with cytolytic adenoviral therapy. The advantages are as follows: the combination of CV706 with irradiation still limits the damaging effects of CV706 to the irradiated cells; the combination of CV706 with irradiation leads to significantly increased necrosis, marked decrease of blood vessel number, and inhibition of angiogenesis; The combination of CV706 with irradiation allows at least a 50-fold reduction in the amount of virus to achieve the same curative effect; animals receiving combination treatment appear healthier, characterized by a significant weight gain compared to the groups treated with either agent alone. Thus, combining cytolytic adenoviral therapy with radiation may augment the efficacy of standard cancer modalities. B. Synergy of CV787 and Chemotherapy Once prostate cancer enters a metastatic stage, the current treatment is androgen ablation therapy, which in 70% of men provides relief from otherwise uncontrollable bone pain and increases life expectancy by 6-18 months [86, 87]. For many years, chemotherapy was felt not to play any role in the treatment of advanced prostate cancer. However, this negative impression is apparently changing, as significant activity is being seen with new drugs and drug combinations [87]. Interim analysis of an ongoing Phase III trial of docetaxel in end-stage hormone refractory prostate cancer patients shows an improvement in life span to 30 months (Dan Petrylak, pers. commun.). A synergistic antiproliferative effect in LNCaP prostate cancer cells was observed when CV787 was combined with various chemotherapeutic agents including cisplatin (Platinol), docetaxel (Taxotere), doxorubicin (Adri- amycin), estramustine (Emcyt capsules), etoposide (VePesid), gemcitabine HCl (Gemzar), mitoxantrone (Novantrone), and paclitaxel (Taxol). In this chapter, we will discuss the synergistic antitumor efficacy of CV787 only when com bined with the taxanes. In vitro experiments demonstrated that LNCaP cells cultured with paclitaxel or docetaxel for 24 h before or after infection with CV787 had significantly lower rates of proliferation than cells treated with either agent alone [88]. Also, LNCaP cells exhibited a greater burst size of CV787, whereas no significant effect on viral growth kinetics was seen. No significant difference 10. Development of ARCAs for the Treatment of Prostate Cancer 3 0 3 in the effectiveness of the combined therapy of taxane and CV787 infection was observed by varying the time of taxane administration in vitro^ v^hereas varying the administration schedule of pacHtaxel w îth Ad-p53 gene therapy can modulate the synergistic activity between these two agents in ovarian can cer [89]. Furthermore, in vitro combination treatment of CV787 with taxane did not alter the specificity of replication-mediated cytotoxicity. CV787 has been shown previously to replicate preferentially in PSA-producing human prostate cancer cells 10,000 times more efficiently than in non-PSA-producing cells [22]. In the presence of paclitaxel or docetaxel in the culture medium, CV787 replicates to the same degree of specificity in the non-PSA-producing human cell lines versus PSA+ cells. Cell viability assays with MTT further indicate that CV787 in combination with taxane remains fully selective. The antitumor effects of combination therapy with CV787 and taxane were also evaluated in vivo. Previous studies have demonstrated that tumors were eliminated within 6 weeks by a single intravenous administration of CV787 at a dose of 1 x 10^^ particles [22]. Clinically, docetaxel is adminis tered intravenously at 12.5 mg/kg once per week for 6 weeks. A single cycle of docetaxel is not toxic, whereas the full course of six cycles is highly toxic. Combination treatment of CV787 and taxane (three courses of 5 mg/kg) elim inated tumors within 4 weeks, whereas CV787 alone at the same dose of 1 X 10^^ particles per animal could only slow down tumor growth (Fig. 3A). The experiments described below are with a single cycle of docetaxel. In combination with the higher clinical dose of 12.5 mg/kg docetaxel, 1 x 10^ particles and of 1 x 10^ particles of CV787 led to a complete elimination of tumors within 4 weeks. Thus, the dose of CV787 required for complete remission has been reduced by 1000 times from 1 x 10^^ particles to 1 x 10^. The LDo and LDioo single bolus dose of CV787 for Balb/c, nuinu is 1.0 x 10^^ particles and 2.5 x 10^^ particles, respectively. Thus, the single-dose combina tion of docetaxel with CV787 has increased the potential curative therapeutic window, from 1 to 1000. Furthermore, healthier animals, characterized by body weight, were observed in the combination treatment group as compared to groups treated with either agent alone (data not shown). The mechanism(s) of synergistic activity in the combination of taxane with CV787 is unknown at this time; however, our experiments suggest a few hypotheses. First, taxane at the synergistic dose may be augmenting viral replication. It has been previously shown that a low concentration of paclitaxel (1-14 nM) increased the number of cells transduced by recombinant adenovirus 3 -35% in a dose-dependent manner [89]. Recently, it was found that taxane increases intracellular receptor trafficking. For example, more Coxsackie and adenovirus receptor (CAR) moved to outer membrane in the paclitaxel-treated cells (Nielsen Loretta, pers. commun.). It is suggested that adenovirus transduction efficiency may increase after the cells are treated with taxane. Indeed, our data show that although the synergistic dose of paclitaxel 304 Henderson a n d Y u A 1400 1200 0) 1000 ....^^ _. 1 E "oo BOO > O E 600 ZJ L-'T'̂ î ,̂ . ^ \ 400 i*f<^' i { < ; 200 ^ - ^ » _ , 1 2 3 4 6 6 7 Weeks After Treatment " Control A CV787 (1 x1 O^Op) 'CV787(1x10^^p) - Docetaxel (5 mg/kg) - CV787/Docetaxe[ B Docetaxel CV787 CV787/Docetaxel Mm Figure 3 In vivo efficacy of intravenously administered CV787 and taxane against nude mouse LNCoP xenografts. (A) LNCaP tumor volume in mice treated with either vehicle, CV787 (1 x 10 ' ^ 1 X 10^^ particles per animal, iv), docetaxel (5 mg/kg at day 2, 5 and 8, iv), or CV787 (1 x 10^^ particles per animal) and docetaxel (5 mg/kg at days 2, 5, and 8, iv), (n = 6). Tumor volumes measured weekly. Error bars represent the standard error of the mean. (B) Histological features (H&E staining) of LNCaP tumors treated with either docetaxel (12.5 mg/kg) (left), CV787(1 x 10^0 particles per animal) (middle), and CV787 (1 x 10^^ particles per animal) plus docetaxel (12.5 mg/kg) (right) at X 400 original magnification. LNCaP xenografts were harvested 14 days after treatment. The open arrow indicates cells with abnormal mitosis, the filled arrow indicates necrotic cells. 10. Development of ARC As for the Treatment of Prostate Cancer 3 0 5 or docetaxel did not alter virus replication kinetics, the chemotherapy drugs slightly increased the burst size of CV787 in LNCaP cells. Second, CV787 may be augmenting the anti-tumor activity of taxane. El A gene expression has been show^n to increase cellular sensitivity to chemotherapeutic agents [90] and this enhanced sensitivity is partially caused by the induction of p53-dependent apoptosis by the ElA-induced sensitization of the cells [91]. Recently, Ueno et al. found that human ovarian cancer cells that w êre originally resistant to
paclitaxel, became paclitaxel sensitive in El A dow^nregulated HER-2/neu cells \GG\. In CV787, the ElA gene is intact and may be overexpressed in PSA- producing LNCaP cells, w^hich may enable significant interaction betv\̂ een ElA and taxane. In addition, ElA is a potent inducer of p53 protein expression in infected cells [92]. p53 levels may increase follov^ing infection, thereby increasing cell sensitivity to chemotherapy-induced apoptosis. This is consistent w îth the observation that more apoptotic cells v\̂ ere seen in the LNCaP tumors that received combination treatment than in tumors that received either agent alone (Fig. 3B). Interestingly, in the combination-treated tumors, most of the cells v^ere empty and virtually devoid of cellular content. Finally, the actions of the tw ô agents may be occurring at tvŝ o distinct points in the same apoptotic pathv^ay, analogous to the activity of cyclosporine A and rapamycin on tw ô distinct points in the T-cell activation signal transcription pathw^ay [93]. Further investigation of the possible mechanism(s) of synergistic activity in the combination of taxane w îth CV787 is under w ây. IV. Toxicity of Intravenously Administered ARCAs in the Absence or Presence of Docetaxel As a prerequisite for a Phase I trial, vŝ e evaluated the biodistribution, persistence, and toxicity of CV787 follow^ing intravenous administration. Cotton rats v^ere chosen over the mouse for Cotton rats are semipermissive for adenoviral replication [32, 94]. The objective of the first study was to determine the toxicity of CV787, after a single tail vein intravenous administration into the male Cotton rat, followed by a 3-day observation period. CV787 was administered at 3 x 10^^ particles, 1 x 10^^ particles, and 3 x 10^^ particles per animal. There were no deaths or treatment-related clinical observations over the study period. In addition, there were no effects of treatment noted on body weight, food consumption, or clinical pathology or at the macroscopic pathological examination at all dose levels. As 3 x 10^^ particles per animal was the highest achievable dose, this dose was considered the no-effect level when administered as a single bolus intravenous injection to the Cotton rat. To investigate the biodistribution and persistence of CV787 following intravenous administration, we conducted a 21-day study with Cotton rats. 3 0 6 Henderson and Yu Twenty-seven male Cotton rats received either vehicle, replication-defective Ad5 CV730, an ElA deleted adenovirus mutant, and CV787 at 3 x 10^^ particles per animal in a single intravenous tail vein injection on day 1. Three animals from each group were sacrificed on days 3, 8, and 22. DNA was extracted from plasma, testes, brain, spleen, liver, heart, lungs, kidneys, and bone marrow. The DNA obtained from tissues was quantified by optical density measurement and 100 ng was subjected to quantitative PCR using a TaqMan procedure specific for the Ad5 packaging site present in both CV730 and CV787. There were no ill effects seen upon intravenous delivery of 3 x 10^^ particles of CV787 per Cotton rat. As similar distribution of adenovirus seen in other rodents [94], CV787 accumulated primarily in the liver and spleen, and to a lesser extent in the heart, kidney, lung, and bone marrow. Viral DNA levels were very low in the testes and undetectable in the brain. The tissue distribution was similar for Ad5 CV730, a replication-defective control virus that was detected primarily in the spleen, liver, and kidney. The potential for nonspecific replication of CV787 was found to be very low, resulting in no more than a two- to fivefold increase in viral copy number during the course of the study. A third study was designed to compare the acute toxicity and inflam matory potential of CV787 and CV706 by subcutaneous and intradermal administration in immunocompetent mice, C57BL/6. Four groups of five mice each were treated with a single dose of 1 x 10^^ particles of CV787 or CV706 by subcutaneous (sc) or intradermal (id) injection on day 1. Four control groups were treated either intradermally or subcutaneously with the vehicle for CV787 or the vehicle for CV706. Two additional groups were treated intravenously (iv) with either virus at the same dose to compare the acute liver toxicity between CV787 and CV706. All animals were scarified on day 4. Blood was collected for serum chemistry analysis. Macroscopic examination for signs of toxicity was performed at necropsy. Portions of the liver, lung, spleen draining lymph nodes, and sc or id injection sites were collected in buffered formalin and examined for histopathological effects. All animals survived until the scheduled day of sacrifice. No signs of toxicity were observed after treatment or during macroscopic examination in any of the id or sc groups. Serum chemistry analysis showed no significant changes following subcutaneous or intradermal administration of either virus preparation. With both viruses, histopathological analysis revealed a mild chronic inflammation in the areas surrounding the subcutaneous injection site in some of the animals, but no effects on any of the body organs were observed. Some inflammation was observed in the dermas following intradermal administration with both viruses, but the inflammation remained localized to the injection sites and the overall effects were no more severe than those observed after subcutaneous treatment. As expected, intravenous 10. Development of ARCAs for the Treatment of Prostate Cancer 3 0 7 delivery of the virus at a dose of 1 x 10^^ particles per animal resulted in significant liver toxicity, as evidenced by 5- to 100-fold increase of ALT and AST enzyme levels. The ALT and AST response w âs more pronounced for CV706 than for CV787. Intravenous treatment w îth CV706 also resulted in statistically significant effects on BUN, serum cholesterol, glucose, and calcium levels, w^hich v^ere not as apparent follov\^ing the intravenous administration of CV787. The subcutaneous and intradermal effects observed in this study suggest that CV787 poses no additional risk of inflammation over CV706. Results from intravenous treatment of C57BL/6 mice indicate that CV787 may shov^ less systemic toxicity than CV706. Also, it does not appear that Cotton rats add any nev^ information on toxicity compared to the use of more common and easier to use laboratory mouse strains such as C57BL/6. A synergistic antitumor efficacy w âs observed w^hen CV787 w âs combined w îth taxane in the prostate tumor xenograft [88]. To examine the toxicity of CV787 in combination w îth the chemotherapeutic agent docetaxel, we conducted a fourth toxicology study in C57BL/6. The 4-day and 28-day effects w êre evaluated in mice given a single daily dose of dexamethasone (Decadron) each day for 3 consecutive days, a single injection of CV787 at lovv̂ (1 x 10^ particles per animal), medium (3 x 10^ particle per animal), or high (1 x 10^^ particles per animal) dose, and a single dose of the chemotherapeutic agent, docetaxel (100 mg/m^). Six different treatment groups v^ere established using identical treatment regimens for animals in subgroups sacrificed at 4 days and at 28 days. Each treatment subgroup consisted of eight randomly assigned mice. The ARCA virus vehicle and all three doses of virus were given intravenously via tail vein injection. All virus injections v^ere given on day 1 at 1-2 h prior to Decadron administration. Dexamethasone and docetaxel vŝ ere both given separately by intraperitoneal injection. At the end of the 4-day and 2 8-day treatment periods, respectively, blood samples w êre taken for complete blood count (CBC), including platelet count, and serum chemistry analysis just prior to sacrifice. Tissues w êre taken for organ v^eights and histopathologic evaluation of liver, lung, spleen, kidney, brain, heart, mesenteric lymph nodes, bone marrov^, any enlarged lymph nodes, and any gross lesions. Acute virus-associated changes at day 4 v\̂ ere characterized by hepato cellular necrosis and elevated serum leakage (liver) enzymes (ALT, AST) seen in the groups w ĥo received a high dose of CV787 alone or high dose of CV787 in combination with docetaxel, as well as an increasing incidence of lymphoid hyperplasia from mid-dose (3 x 10^ particles per animal) to high- dose (1 X 10^^ particles per animal) virus subgroups. These findings indicate dose-related viral effects without evidence of augmentation by docetaxel in combination with dexamethasone. In contrast, the severity of the lymphoid hyperplasia in the high-dose virus subgroup may have been ameliorated some by the docetaxel combination. Evidence of acute (high-dose) virus-associated 3 0 8 Henderson and Yu hepatocellular toxicity was resolved by day 28 and replaced by a viral dose- dependent increase in mild multifocal hepatic mononuclear cell inflammatory infiltrates in subgroups w ĥo received CV787 at a dose of 3 x 10^ particles per animal or 1 x 10^^ particles per animal with or without docetaxel. These inflammatory changes are most likely to be associated with chronic effects of viral replication and antigen stimulation and do not appear to be ameliorated by docetaxel combination. There was acute mild/moderate bone marrow necrosis at day 4 from high-dose virus plus docetaxel combination in two of eight mice, but not from high-dose virus alone or from lesser-dose virus plus docetaxel combination. There were no bone marrow lesions seen in any animals at day 28, so if the effect is real, it appears to be a reversible effect of the high-dose virus plus docetaxel combination. Acute mild to moderate bone marrow hypoplasia was found at day 4 in all eight mice only in the high-dose virus plus docetaxel combination. Hypoplasia was not seen at day 28. The occurrence of bone marrow necrosis (2/8) and hypoplasia (8/8) in the day 4 high-dose virus plus docetaxel combination subgroup constitutes evidence for an additive but reversible effect of the combination. The 25% bone marrow necrosis and 100% hypoplasia were the only additive toxic effects ascribed to the combination of docetaxel with virus. These toxicities appeared to be dose-dependent with respect to the virus and are reversible. V. Effects of Preexisting Adenovirus Antibody on Antitumor Activity and Immunoopheresis for Human Therapy Preexistent antibodies to adenoviruses are highly prevalent in the human population. By 7 months of age 23% of infants have circulating antibody titers to adenovirus [95], a percentage that increases with age to essentially 100%[96,97]. Adenovirus antibodies are readily divided into total antibodies (TAb) and neutralizing antibodies (NAb). Almost all adults have antibodies (TAb) to adenovirus type 5, but only Sl^/o of adults have neutrahzing anti bodies \1S^ 98]. These antibodies are of significant interest in the design of therapeutic strategies based on adenoviruses. Transient immunosuppression during initial adenovirus administration with cyclosporine [7, 99], FK506 [100-103], cyclophosphamide [104, 105], deoxyspergualin [105], IL-12 [106], CTLA4Ig [107, 108], anti-CD4 antibody [109-111], anti-CD40 ligand antibody [112, 113], and dexamethasone [113, 114] has been used to blunt the formation of anti-Ad Abs in animal mod els. This strategy has successfully allowed repeat adenovirus treatments in animals and should extrapolate extremely well to the clinic. Clinically, this strategy could prevent a rise in antibody titer, thereby maintaining preexistent 10. Development of ARCAs for the Treatment of Prostate Cancer 3 0 9 anti-Ad5 Ab titers at pretreatment levels. However, treatment in these ani mal models was initiated in immunologically naive animals, animals without preexistent circulating anti-Ad antibody [115-117]. This does not represent the situation in the clinic where many patients already have preexistent anti-Ad antibodies [118-120]. Transient immunosuppression would not be expected to suppress the levels of these preexistent circulating antibodies. Three approaches have been explored to overcome preexistent adenovirus antibody: inducing immunologic tolerance [120, 121], the use of another of the 51+ different adenovirus serotypes [122-124], or the use of polyethylene glycol (PEG) to block adenovirus virions from antibody binding [125-127]. All three approaches show promise, but all may also be encumbered by practical considerations. The induction of tolerance may be time-consuming, sporadic, and unpredictable. Changing serotypes changes the drug, implying separate costly drug approval pathways. The conjugation of PEG to purified virions to successfully block antibody interactions incurs questions of also blocking the virus from the interaction with the CAR [128,129] as well as virus pen etration, internalization, and uncoating [127, 129]. In addition, large-scale purification of conjugates from nonreacted components during manufacturing will be required [130]. Surprisingly, preexistent adenovirus antibody has not impaired the ther apeutic activity of adenoviruses directly injected into tissues in animal studies or in human clinical trials [118, 131-134]. Presumably, the therapeutic dose of viruses directly injected into tissues overwhelms the level of free aden ovirus NAb available. We have been
interested in systemic administration of adenovirus for the treatment of metastatic prostate cancer. Such treatment requires intravascular injection of adenovirus to achieve virion distribution to the multiple distant tumor sites. In the vascular compartment, adenovirus will be subject to the opsonizing activity of TAb and the neutralizing activity of NAb; both could adversely affect efficacy [115, 131]. There is considerable evidence that repeat administrations of adenovirus-based therapeutics in the face of mounting specific anti-adenovirus immune responses eliminates efficacy [98,112,115,135]. A. Preexisting Adenovirus Antibodies Inhibit Systemic Toxicity and Antitumor Activity In order to better understand the effect of preexisting antibody on ARCA- mediated toxicity and anti-tumor efficacy, we first developed an animal model controlling both the dose of the intravascularly administered adenovirus and the level of preexistent antibody while measuring the virus-induced toxicity and the anti-tumor activity. To this end we prepared hyperimmune sera to purified adenovirus in rabbits, purified the rabbit total IgG containing high titer adenovirus antibody, and passively injected the purified rabbit anti-Ad5 3 1 0 Henderson and Yu antibody into Balb/C nu/nu mice bearing LNCaP prostate cancer xenografts. This established a measurable humoral anti-Ad5 antibody titer. The prostate specific adenovirus, CV706, was injected into the tail vein (iv) of animals, and toxicity and anti-tumor activity was measured. First, preexisting neutralizing antibodies were found to be protective of nude mice from liver toxicity. Adenoviruses injected intravenously into mice have been shown to cause liver toxicity from a rapid induction of chemokines and neutrophils that lead to hepatic necrosis and apoptosis [44, 86,136-138]. In the absence of preexistent antibody, the lethal dose (LDioo) was 2.5 x 10^^ CV706 particles, whereas 1 X 10^^ CV706 particles was not lethal. Yet, in the presence of a 1:80 preexistent titer of Ad5 NAb, iv injection of 5 x 10^^ CV706 particles was no longer lethal. Serum ALT levels started to elevate 48 h after viral injection in the animals that had no or low titers of preexistent antibodies (1:10 or 1:20), and increased progressively, reaching peak levels within 72-96 h. However, the animals injected with the same lethal dose of CV706 but containing a 1:80 level of preexistent anti-Ad5 NAb exhibited normal or only slightly elevated ALT levels during the entire treatment period (Table II). In this study, a maximum tolerated dose of CV706 with a 1:80 pre-existent NAb titer was not found. Secondly, no effect of preexistent antibodies on the uptake of CV706 in different organs was found in the animals after receiving virus [76]. Balb/C nu/nu mice, pretreated with purified IgG (NAb titer 1:80) or buffer (no neutralizing antibodies), were administered 2.5 x 10^^ particles of CV706 by a single tail vein injection. As expected from prior observations [139], the majority of Ad DNA was accumulated in liver and a small percentage of DNA was found in spleen, whereas Ad DNA was undetectable in blood, lung, heart, or kidney. The level of Ad genome in liver was equivalent with or without preexistent anti-Ad5 Ab at 30 min and at 2 h after CV706 injection. However, at 24 h postinjection. Ad DNA was undetectable in the liver of mice with preexistent antibodies, whereas a significant amount of Ad DNA was still present in the liver of animals devoid of preexistent Ad5 Ab. No Ad DNA was detectable in liver for both treatment groups 72 h after virus administration. This observation suggests that the reduced amount of Ad DNA in liver of mice with preexistent antibodies at 24 h is not due to virus redistribution, but may be related to accelerated virus DNA degradation in the liver. Most likely, virus complexed with antibody remains in the endosomes and is subjected to lysosomal degradation processes, an outcome that may not trigger the adenovirus toxicity response. Third, preexistent anti-Ad5 Ab was found to be critical to the outcome of CV706 anti-tumor efficacy. In our previous work, we have shown the curative antitumoral activity of a single intratumoral injection of CV706 [21]. In the same animal model following a single intravenous tail vein injection we showed CV706 could inhibit additional tumor growth. With our second generation virus, CV787, a single intravenous administration could eliminated distant S S ^ ^ t \ <N o ro ^ ro O O < g O o < ^ ^ o E Ji ^ 'c < = s C < ^ c ^ ^ O) ^ B .SP -^ .5P -^ .5? c IZ) > C/5 • > C^ > C/5 S c/5 > (/3 > <U . tU ^ <U ^ > ^ ^ ^ J:̂ ^ ^ ^ 5 c^ O c^ O 03 O - ^ 3 ^ ^ ^ K 0) Z TJ '15 "cS ^o^ < B 'B _> 0) '> "oT c < C/5 i ^ «A *>< bJD 0) _C £ (/) JU 0 . • > < < a -I o o X X l O l o 311 3 1 2 Henderson and Yu preexistent tumors [22]. These reports showed that the nonspecific immunity, most notably the uptake of adenovirus by hver Kupffer cells [44, 139], does not eliminate the anti-tumor activity follow^ing intravascular administration of these viruses. Our in vivo studies demonstrated that 1 x 10^^ particles of CV706 inhibited additional grow^th of LNCaP mouse tumor xenografts in the absence of preexistent anti-Ad5 NAb. This anti-tumor activity w âs also show^n using the same dose but in the presence of 1:20 preexistent anti-Ad5 Ab. However, in the presence of preexistent antibodies (1:80), tumors in animals that were iv injected with 1 x 10^^particles CV706 grew progressively, a growth similar to the growth found in the group that received 1:80 antibody but no CV706. These results indicate that at a low preexistent anti-Ad5 antibody titer of 1:20, 1 x 10^^ CV706 particles can overwhelm the available antibody and retain anti-tumor activity. However, higher preexistent anti-Ad5 Ab (1:80) can eliminate the anti-tumor activity of intravenously administered CV706. The anti-tumor activity of CV706 can be restored in the face of a preexistent 1:80 antibody titer by a threefold higher dose of CV706 (3 x 10^^ particles/mouse). The amount of infectious CV706 in the circulation of mice showed an antibody titer-dependent pattern. In animals that had no preexistent antibodies or had low levels (1:10 or 1:20) of preexistent anti-Ad5 NAb and had received 1 x 10^^ infectious CV706 particles, infectious virus was detectable in the circulation 4 h after administration of CV706. In contrast, no infectious CV706 was found in mice that received a higher level of neutralizing antibodies (1:80) but the same dose of CV706. Interestingly, infectious CV706 was once again found in mice with a preexistent antibody (1:80) following a threefold higher dose of CV706 (3 x 10^^ particles). These results suggest that both the level of circulating neutralizing antibodies and the dose of administered viruses play significant roles in determining therapeutic toxicity and efficacy of intravenously administered CV706. Clearly, preexistent humoral antibody to Ad5 could present a serious barrier to the clinical application of systemically administered adenovirus. However, our data also indicate that therapeutic efficacy could be achieved by administering a higher dose of viruses, or by decreasing the levels of circulating neutralizing antibodies. The December 1999 RAC meeting, convened after the death in Philadel phia of Jesse Gelsinger, explored the then available data with adenovirus administered intravenously. It was apparent from that meeting that while investigators at the University of Pennsylvania, Onyx, Aventis, and Schering- Plough were monitoring for the existence of preexistent antibody to adenovirus, none were using preexistent antibody levels as a patient inclusion/exclusion criteria. The data presented above caused us to adopt a strategy we call SIAPA, for screening and immunoapheresis of preexistent antibody (described below). Unfortunately, the data also showed that not prescreening patients for preex istent antibody levels and proceeding with a dose escalation Phase I clinical 10. Development of ARCAs for the Treatment of Prostate Cancer 3 1 3 trial could lead to an uncontrolled clinical trial. Namely, if a patient with a high anti-Ad5 antibody received a given dose of adenovirus administered intravenously shov^ed no efficacy and no toxicity, the clinical answ^er is to proceed to the next higher dose. Hov^ever, if the next patient had a lov^ or undetectable antibody titer, the next dose of virus could be lethal. B. SIAPA: Screening and Immunoapheresis of Preexistent Antibody for Monitoring and Removing Preexistent Ad5 Antibodies from Blood Based on the observation that toxicity and anti-tumor efficacy of intravas cular CV706 treatment is inversely proportional to the titer of circulating anti-Ad5 antibodies, v̂ e became interested in the clinical use of an affinity column consisting of recombinant capsid proteins to specifically remove anti- adenovirus antibodies from human sera. Such an affinity column could be used in conjunction v^ith apheresis to become immunoapheresis. During the apheresis procedure, the serum could pass through a column of Ad5 antigen, specifically removing anti-adenovirus antibodies. Clinically, patients could be screened for the titer of preexistent anti-Ad5 Ab w îth the rapid 5̂ disposable immunoassay. Those patients v^ith a preexistent antibody titer above a given cutoff value would be candidates for adenovirus antibody immunoapheresis. After several hours of immunoapheresis, the antibody screening test could be repeated, confirming the removal of anti-Ad5 antibodies. Since anti-Ad5 antibodies would be expected to repopulate the vascular compartment at the rate of 5% per hour, a temporal window of several hours for intravascular adenovirus therapy could be created [140, 141]. The relevant preexistent anti-Ad5 antibodies are directed against the three principal capsid protein components: hexon, penton, and fiber [142, 143]. The Ad5 fiber, hexon and penton genes were cloned into the bacterial expression vector pQE-30. The recombinant proteins were expressed in E. coli M15 cells with IPTG induction and visualized as 120 IcDa (hexon), 82 kDa (penton), and 62 kDa (fiber) polypeptide proteins by denaturing SDS-PAGE and Western blotting. These results agreed well with sizes of hexon, fiber, and penton proteins derived from the purified virions. To test the feasibility of removing anti-Ad antibodies from serum with the recombinant Ad5 antigens, we built three types of column by individually coupling the purified hexon, penton, or fiber proteins to the Ni-NTAmatrix. A human clinical serum sample collected during the CV706 clinical trial at Johns Hopkins Oncology Center was used to test the ability of the columns to remove anti-Ad5 antibody. The patient serum collected 15 days after administration of CV706 had an anti- Ad5 NAb titer of 1:3200. The patient serum was passed through each column separately or sequentially. The processed serum was tested for the efficiency and specificity of removing anti-Ad5 antibodies and found that total anti-Ad5 3 1 4 Henderson and Yu Table III Efficiency of Ad Antigen Column to Remove Ad Antibodies from Plasma Patient NAb tier TAb (ixgy' ml) sera Before After Before After Serum-1 1:400 <1:10 15.6 0 Serum-2 1:1600 <1:10 75.6 3.7 Serum-3 1:400 <1:10 158.5 9.6 Serum-4 1:1600 <1:10 498.4 8.7 Serum-5 1:400 <1:10 604.4 19.8 Serum-6 1:400 <1:10 65.1 0.56 IgG was significantly reduced after passing through the columns. Table III showed that after passage through all three columns, neutralizing antibodies in sera were completely eliminated in all six samples and total anti-Ad IgG was reduced to 0.5 to 5% of initial levels (Table III). Further study demonstrated that the depletion of anti-Ad antibodies by an Ad antigen column was specific to Ad capsid proteins. This immunoapheresis column for specific removal of Ad antibody is currently under development at Calydon. VI. Clinical Development of CV706 and CV787 CV706 and CV787 are novel therapeutic agents with a novel mechanism of action. As of this writing, a phase I/II clinical trial of CV706 for recurrent local prostate cancer has been completed and CV787 has entered a multicenter Phase I/II clinical trial for metastatic, hormonal refractory prostate cancer. A brief summary for CV706 trial result and factors impacting clinical efficacy and safety are discussed. A. CV706 Phase I/II Trial for Locally Recurrent Prostate Cancer A Phase I trial of CV706 was initiated in 1998 at the Brady Urological Institute of the Johns Hopkins Oncology Center under the direction of Jonathan Simons, MD, and Ted DeWeese, MD. The patient population consists of men with locally recurrent prostate cancer with rising PSA levels following definitive external beam irradiation. Men in this category are usually left untreated or receive androgen ablation therapy
as serum PSA levels rise significantly above 10 ng/mL. On average, these men have a life expectancy of 3 years. The virus was administered under spinal anesthesia using the brachytherapy template 10. Development of ARCAs for the Treatment of Prostate Cancer 3 1 5 and ultrasound 3D imaging using the MMS Terapac Plus 6.6 B3DTUI (Char lottesville, VA) treatment-planning software for implantation of radioactive seeds. Virus w âs initially administered w îth 0.1 mL aliquots from up to 40 brachytherapy needles. PSA levels were determined and biopsies obtained. Systemic toxicity was minimal and limited to brief Grade 1 fever with or without an associated chill. These episodes were self-limited, responded to routine anti-pyretics, and no patient required antibiotics. This phenomenon is consistent with previously reported series using intratumoral injections of replication-competent adenovirus (Onyx-015) [144, 145] and likely represents cytokine release (e.g., IL-1, IL-6, TNF-a) in response to the adenovirus [146, 147]. A transient non-clinically significant lymphopenia confined to the normal range was noted in a majority of patients (95%) within 24 h of viral instillation. Full recovery of cell counts occurred within 4 to 7 days posttreatment. As with the transient fever, the timing of this decrement combined with the quick recovery are consistent with an acute-phase reaction mediated by transient cytokine release, as occurs with a variety of agents including bisphosphonates, and are not consistent with viral induced bone marrow suppression [148, 149]. Importantly, treatment with CV706 was not associated with significant hepatic or coagulation abnormalities. No patient experienced >Grade 2 elevation of liver transaminase levels and no patient had evidence of alteration in PT or PTT or a decrement in fibrinogen. This safety was evident even at the highest dose level of 1 x 10^^ viral particles and with viral shedding into the blood as documented in this study. Taken together, these data reveal a high degree of safety and tolerability of CV706 when administered by intraprostatic injection. The analysis of secondary study end points provided compelling evidence of CV706 activity. Serum PSA is well known to be a marker of both disease activity as well as disease burden and the use of serum PSA as a marker of therapeutic efficacy has become increasingly well defined. Several investigators have correlated declines in serum PSA of greater than 50% with prolongation of survival in men with hormone refractory prostate cancer [150, 151]. In addition, other investigators have found that a slowly rising PSA following definitive management with radiation or surgery is associated with an increased time to clinically evident metastatic disease when compared to patients with a more rapid PSA doubling time [152, 153]. Moreover, there was a statistically significant reduction in the PSA velocity following treatment with CV706, most pronounced for patients in dose levels 4 and 5, again suggestive of a dose-response relationship. In the final two dose levels, 50% of treated patients achieved a PSA partial remission (PR). It also appears that treatment with CV706 resulted in a prolongation of the time required for the serum PSA to double, suggesting a slowing of cancer growth within the prostate even among individuals not achieving a PR as defined by the protocol. It is well known that biopsy of the prostate results in significant elevations in serum PSA for 2 weeks [154, 155]. It is 3 1 6 Henderson and Yu likely that while the design of this study, with frequent posttreatment biopsies, aided in the documentation of viral replication, these same invasive procedures prevented a full analysis of the PSA response to therapy with CV706. Thus, it is possible that significant reductions in serum PSA could have been obscured by these frequent prostatic manipulations. Despite this possibility, the evidence gathered on PSA levels following treatment with CV706 are encouraging and suggest that at the higher dose levels, a clinically meaningful treatment effect may be achievable. This treatment effect at higher doses is associated with histologic evidence of viral replication. The viral inclusions seen on electron microscopy are consistent with viral replication in prostate epithelial cells. The positive staining for hexon protein seen on immuohistochemistry from day 4 biopsy materials is also confined to prostatic epithelial cells, is greatest in the highest dose levels, and, like the electron microscopy, is highly suggestive of intraprostatic replication of CV706 in these patients. Therefore, there is appropriate rationale for optimism given these findings in men treated with CV706, particularly at the high dose level. We believe these data to be significant and warrant CV706 evaluation in a Phase II study. Importantly, we were able to rigorously document viral circulation in the blood following intraprostatic delivery of CV706 without significant associated clinical sequale. The quantitative PCR assay is very specific for CV706 and is capable of detecting 1300 copies per milliliter of plasma. These results confirm that a small but significant amount of the intraprostatically administered virus reached the circulation. The amount of virus released in the first "peak" varied between patients and did not appear to be related to the dose level or neutralizing antibody titer. The highest total amount of virus detected was in two patients (patients 12 and 14) with an estimate of less than 2% of the dose being detected. Circulating virus then became undetectable analogous to a virus "eclipse." A significant secondary "peak" of circulating CV706 was observed in most patients within 3 days of treatment, suggestive of viral replication in these patients. The appearance and size of the secondary "peak" seemed to correlate best inversely with the anti-Ad5 antibody titer at the time of treatment. These data are consistent with those derived from electron microscopy and immunohistochemistry, and are highly suggestive of CV706 replication in the human prostate. Response of PSA to CV706 delivered directly into the prostate was not correlated with the presence of preexisting Ad5 neutralizing antibod ies. As expected, following CV706 administration, most patients developed Ad5-neutralizing antibodies. However, development of neutralizing antibod ies failed to correlate with response to treatment. Moreover, our data also reveal that the presence of preexisting anti-Ad5 antibodies was not correlated with treatment-related toxicity. These data extend the previously reported 10. Development of ARCAs for the Treatment of Prostate Cancer 3 1 7 work on intratumoral delivery of adenovirus by revealing a lack of asso ciation betvv êen preexisting neutralizing antibodies and treatment efficacy and toxicity [118, 133]. While circulating anti-Ad5 antibody may significantly impact on the efficacy and toxicity of systemically administered adenovirus [75, 86], it is not clear that these antibodies have the same access to the tumor-bearing prostate and thus may have a limited impact on direct intratumoral injections [156]. In summary, these data reveal that CV706 is safe and not associated v^ith irreversible serious short- or long-term side effects w^hen delivered by intratumoral injection using a planned, stereotactic approach. These data also suggest that CV706 replicates selectively in prostatic epithelial cells, i.e., those prostate cells that make PSA, and does so in a time frame consistent w îth an adenovirus replication cycle. These data suggest that CV706 has significant biologic activity as evidenced by significant durable dose-related decreases in patient serum PSA. Indeed, three of five men treated w îth 1 x 10^^ particles of CV706 experienced a PSA partial response. Thus, CV706 delivered by brachytherapy is an excellent candidate for the treatment of organ-confined prostate cancer. B. Factors Impacting Clinical Efficacy and Safety The pathogenesis of adenoviral infections is influenced by a large number of factors, some pertaining to the virus and others pertaining to the host defenses of the virus. Important issues for the virus include the route of infec tion, the size of the virus inoculum, the tropism of the virus for different-cell types, and w^hether the virus spreads directly from cell to cell or through extra cellular fluid. Clearly, the vascularization of tumors, the leakiness of capillaries to virus, and the physical size of virus particle w îll affect intratumoral virus distribution. In the replication efficiency of the virus in prostate tumor cells, both the time of the replication cycle and the burst size are also important. Host defenses include mechanical defenses (epithelia, mucosal, liver Kupffer cells, or the blood-brain barrier), nonspecific immune defenses (interferons, recog nition of infected cells by natural killer cells, release of cytokines, macrophage recruitment and activation, and triggering of complement and kinin cascades), and specific immune defenses (humoral immunity, mostly IgM and IgG but also IgA, IgD, and IgE, and finally cell-mediated immunity) [152]. In adenovirus-mediated prostate cancer therapy, the virus can be either injected directly into the tumor or administered by intravenous injection. In either case, the dose of virus is massive (10^^-10^^ particles) compared to natural, vaccine-induced adenovirus infections (10^-10^ particles) [153, 157, 158], or the clinical trials w îth w^ild-type adenovirus (10^-10^ particles) [14]. Very little is knov^n about the human host response to large doses of ade noviruses [14, 159] and nothing is knov^n about the human host response 3 1 8 Henderson and Yu to using the intravenous route of administration of large doses of replicating adenoviruses. Liver toxicity of virion proteins may be limiting at these high doses. Therapeutic antibody studies have indicated that antibodies do not effec tively penetrate the core of a solid tumor; extravasation is limited to the tumor periphery. This suggests that the accessibility of replicating virus to antibody binding should be minimal foUow îng direct intratumoral injection [98, 131]. Cell-mediated immunity directed tow^ard infected tumor cells may actually enhance the efficacy of replicating viruses in cancer patients if enough replica tion and spread occur initially. How^ever, a systemically delivered replicating adenovirus is going to face several potential hurdles: (1) the nonspecific removal of adenovirus by liver Kupffer cells, (2) the inactivation of virus by preexisting circulating antibodies to adenovirus, (3) a limitation of viral replication medi ated by a vigorous CTL response to virally infected cells, and (4) a limitation of the efficacy of repeat dosage by primary or secondary induction of humoral immunity. Incorporation of the Ad5 genome into germ cells has been expressed as a concern but has not been found for any of the Ad5 gene therapy constructs. Indeed, adenovirus gene expression is characterized as transient in nature due to a lack of viral DNA integration. Virus shedding has been expressed as a concern but it has not been detected in any Ad5 clinical trial to date. In our clinical trial, virus replication w âs detected after 2 - 8 days but w âs undetectable after 2 weeks. It is difficult to estimate the increased cytolytic activity in humans of CV787 compared to CV706. However, replicating adenoviruses containing hepatitis B surface antigen (HbsAg), with and without the E3 region, have been tested in chimpanzees, a system permissive for infection by human adenoviruses [160]. In this study, the addition of the E3 region resulted in 10- to 100-fold increase in virus shedding and a 10- to 100-fold increase in titer to HBsAg. However, one should not lose sight of the fact that adenoviruses are ubiquitous. Twenty-three percent of normal healthy infants are seropositive for adenoviruses by 7 months of age [95] and CV787 is attenuated 10,000:1 compared to the wild-type virus. We believe the therapeutic use of CV787 will be safe; the major question is whether or not there is sufficient efficacy to be medically useful. VII. Summary Safety of administrating wild-type Ad5 either intratumorally and intra venously was demonstrated at intermediate doses (10̂ ^ to 10^ particles) over 40 years ago [14]. None of the treated patients had significant side-effects. Safety and efficacy will be the major issues as adenovirus doses escalate from 10^^ to lO^^particles. CV787 is a replication-competent adenovirus atten uated 10,000:1 compared to the wild-type virus in PSA~ cells. This is an 10. Development of ARCAs for the Treatment of Prostate Cancer 3 1 9 unprecedented therapeutic index for a cytotoxic agent as measured in vitro. CV787 is capable of eliminating distant mouse xenograft tumors with a single intravenous injection. Synergy of prostate cancer-specific adenovirus variants has been demonstrated w^hen combined with conventional therapies including radiotherapy and chemotherapy. Synergy of CV787 and docetaxel has opened a single-dose curative therapeutic window in excess of 1,000:1 in vivo. This progress, coupled with screening and immunoapheresis to control and remove preexistent antibody to adenovirus [75^ 161], may overcome the hurdles and achieve clinical benefits with intravenous administration of adenovirus-based therapeutics.
Ongoing clinical trials of agents such as CV787 will resolve the issues of safety and efficacy and hopefully point to a new mode of cancer chemotherapy, one that includes the use of targeted cytolytic adenoviruses. References 1. Donehoweer, R. C , Abeloff, M. D., and Perry, M. C. (1995). Chemotherapy. In "Chni- cal Oncology" (M. D. Abeloff, J. O. Armitage, A. S. Lichter, and J. E. Niederhuber, Eds.), pp. 201-218. Churchill Livingston, New York. 2. Scher, H. I., Isaacs, J. T., Fuks, Z., and Walsh, P. C. (1995). Prostate. In "Clinical Oncology" (M. D. Abeloff, J. O. Armitage, A. S. Lichter, and J. E. Niederhuber, Eds.), pp. 1439-1472. Churchill Livingston, New^ York. 3. Golomb, H. M., Fefer, A., Golde, D. W., Ozer, H., Portlock, C , Silber, R., Rappeport, J., Ratain, M. J., Thompson, J., Bonnem, E., et al. (1988). Report of a multi-institutional study of 193 patients with hairy cell leukemia treated with interferon-alfa2b. Semin. Oncol. 15, 7 -9 . 4. Demetri, G. D., and Anderson, K. C. (1995). Bone Marrow Failure. In "Clinical Oncology" (M. D. Abeloff, J. O. Armitage, A. S. Lichter, and J. E. Niederhuber, Eds.), pp. 433-456. Churchill Livingston, New York. 5. Anderson, W. F. (1994). Gene therapy for cancer. Hum. Gene Ther. 5, 1-2. 6. Wilson, J. M. (1996) Adenoviruses as gene-delivery vehicles. N. Engl. J. Med. 334, 1185-1187. 7. Elshami, A, A., Kucharczuk, J. C , Sterman, D. H., Smythe, W. R., Hwang, H. C , Amin, K. M.,Litzky, L. A., Albelda, S. M., and Kaiser, L. R. (1995). The role of immunosuppression in the efficacy of cancer gene therapy using adenovirus transfer of the herpes simplex thymidine kinase gene. Ann. Surg. 222, 298-307; 307-310. 8. Kaneko, S., Hallenbeck, P., Kotani, T., Nakabayashi, H., McGarrity, G., Tamaoki, T., Ander son, W. F., and Chiang, Y. L. (1995). Adenovirus-mediated gene therapy of hepatocellular carcinoma using cancer-specific gene expression. Cancer Res. 55, 5283-5287. 9. Kanai, F., Shiratori, Y., Yoshida, Y., Wakimoto, H., Hamada, H., Kanegae, Y., Saito, L, Nakabayashi, H., Tamaoki, T., Tanaka, T., Lan, K. H., Kato, N., Shiina, S., and Omata, M. (1996). Gene therapy for alpha-fetoprotein-producing human hepatoma cells by adenovirus-mediated transfer of the herpes simplex virus thymidine kinase gene. Hepatology 23,1359-1368. 10. Kanai, F., Lan, K. H., Shiratori, Y., Tanaka, T., Ohashi, M., Okudaira, T., Yoshida, Y., Wakimoto, H., Hamada, H., Nakabayashi, H., Tamaoki, T., and Omata, M. (1997). In vivo gene therapy for alpha-fetoprotein-producing hepatocellular carcinoma by adenovirus- mediated transfer of cytosine deaminase gene. Cancer Res. 57y 461-5 . 3 2 0 Henderson and Yu 11. Su, H., Lu, R., Chang, J. C , and Kan, Y. W. (1997). Tissue-specific expression of herpes simplex virus thymidine kinase gene dehvered by adeno-associated virus inhibits the grov^th of human hepatocellular carcinoma in athymic mice. Proc. Natl. Acad. Set. USA 94, 13,891-13,896. 12. Dock, G. (1904). Influence of complicating diseases upon leukemia. Am. J. Med. Sci. 127, 536-592. 13. Moore, A. E. (1954). Effects of viruses on tumors. Annu. Rev. Microbiol. 8, 393-410. 14. Smith, R. R., Huebner, R. J., Rowe, W. P., Schatten, W. F., and Thomas, L. B. (1956). Studies on the use of viruses in the treatment of carcinoma of the cervix. Cancer 9, 1211-1218. 15. Bischoff, J. R., Kirn, D. H., Williams, A., Heise, C , Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick, F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-376. 16. Hall, A. R., Dix, B. R., O'Carroll, S. J., and Braithwaite, A. W. (1998). p53-dependent cell death/apoptosis is required for a productive adenovirus infection. Nat. Med. 4, 1068-1072. 17. Goodrum, F. D., and Ornelles, D. A. (1998). p53 status does not determine outcome of ElB 55-kilodalton mutant adenovirus lytic infection. / . Virol. 71, 9479-9490. 18. Horridge, J. J., and Leppard, K. N. (1998). RNA-binding activity of the ElB 55-kilodalton protein from human adenovirus type 5 . / . Virol. 72, 9374-9379. 19. Gabler, S., Schutt, H., Groitl, P., Wolf, H., Shenk, T., and Dobner, T. (1998). ElB 55- kilodalton-associated protein: A cellular protein with RNA-binding activity implicated in nucleocytoplasmic transport of adenovirus and cellular mRNAs./. Virol. 71, 7960-7971. 20. Zhang, J. F., Hu, C., Geng, Y., Selm, J., Klein, S. B., Orazi, A., and Taylor, M. W. (1996). Treatment of a human breast cancer xenograft with an adenovirus vector containing an interferon gene results in rapid regression due to viral oncolysis and gene therapy. Proc. Natl. Acad. Sci. VSA 93, 4513-4518. 21. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Henderson, D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57, 2559-2563. 22. Yu, D. C., Chen, Y., Seng, M., Dilley, J., and Henderson, D. R. (1999). The addition of adenovirus type 5 region E3 enables calydon virus 787 to eliminate distant prostate tumor xenografts. Cancer Res. 59, 4200-4203. 23. Yu, D. C , Sakamoto, G. T., and Henderson, D. R. (1999). Identification of the transcrip tional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res. 59, 1498-504. 24. Aumuller, G., Seitz, J., Lilja, H., Abrahamsson, P. A., von der Kammer, H., and Scheit, K. H. (1990). Species- and organ-specificity of secretory proteins derived from human prostate and seminal vesicles. Prostate 17, 31-40. 25. Scher, H. I., and Fossa, S. (1995). Prostate cancer in the era of prostate-specific antigen. Curr. Opin. Oncol. 7, 281-291. 26. Wilding, G. (1995). Endocrine control of prostate cancer. Cancer Surv. 23, 43-62. 27. Smith, P. H. (1995). Hormone therapy: an overview. Cancer Surv. 23, 171-181. 28. Walsh, P. C. (1994). Radical prostatectomy: A procedure in evolution. Sentin. Oncol. 21, 662-671. 29. Rowe, W. P., Huebner, R. J., Gilmore, L. K., Parrott, R. H., and Ward, T. G. (1953). Isola tion of a cytopathogenic agent from human adenoids undergoing spontaneous degeneration in tissue culture. Proc. Soc. Exp. Med. 84, 570-573. 30. Zahradnik, J. M., Spencer, M. J., and Porter, D. D. (1980). Adenovirus infection in the immunocompromised patient. Am. J. Med. 68, 725-732. 10. Development of ARCAs for the Treatment of Prostate Cancer 3 2 1 31. Shields, A. F., Hackman, R. C , Fife, K. H., Corey, L., and Meyers, J. D. (1985). Adenovirus infections in patients undergoing bone-marrow transplantation. N. Engl. } . Med. 312, 529-533. 32. Horwitz, M. S. (1990). "Adenovirus and Their Replication." Raven Press, Ltd., Nev^ York, pp. 1679-1721. 33. Chroboczek, J., Bieber, F., and Jacrot, B. (1992). The sequence of the genome of adenovirus type 5 and its comparison with the genome of adenovirus type 2. Virology 186, 280-285. 34. Garon, C. F., Berry, K. W., and Rose, J. A. (1972). A unique form of terminal redundancy in adenovirus DNA molecules. Proc. Natl. Acad. Set. USA 69, 2391-2395. 35. Linne, T., Jornvall, H., and Philipson, L. (1977). Purification and characterization of the phosphorylated DNA-binding protein from adenovirus-type-2-infected cells. Eur.}. Biochem. 76,481-490. 36. Lichy, J. H., Field, J., Horwitz, M. S., and Flurwitz, J. (1982). Separation of the adenovirus terminal protein precursor from its associated DNA polymerase: Role of both proteins in the initiation of adenovirus DNA replication. Proc. Natl. Acad. Set. USA 79, 5225-5229. 37. Lichy, J. H., Nagata, K., Friefeld, B. R., Enomoto, T., Field, J., Guggenheimer, R. A., Ikeda, J. E., Horwitz, M. S., and Hurwitz, J. (1983). Isolation of proteins involved in the replication of adenoviral DNA in vitro. Cold Spring Harbor Symp. Quant. Biol. 47, 731-740. 38. Friefeld, B. R., Lichy, J. H., Hurwitz, J., and Horwitz, M. S. (1983). Evidence for an altered adenovirus DNA polymerase in cells infected with the mutant H5tsl49. Proc. Natl. Acad. Sci. USA 80, 1589-1593. 39. Ghosh-Choudhury, G., Haj-Ahmad, Y., Brinkley, P., Rudy, J., and Graham, F. L. (1986). Human adenovirus cloning vectors based on infectious bacterial plasmids. Gene 50, 161-171. 40. Graham, F. L. (1990). Adenoviruses as expression vectors and recombinant vaccines. Trends Biotechnol. 8, 85-87. 41. Feuerbach, D., and Burgert, H. G. (1993). Novel proteins associated with MHC class I antigens in cells expressing the adenovirus protein E3/19K. EMBO J. 12, 3153-3161. 42. Beier, D. C., Cox, J. H., Vining, D. R., Cresswell, P., and Engelhard, V. H. (1994). Associ ation of human class I MHC alleles with the adenovirus E3/19K protein./. Immunol. 152, 3862-3872. 43. Lee, M. G., Abina, M. A., Haddada, H., and Perricaudet, M. (1995). The constitutive expression of the immunomodulatory gpl9k protein in E1-, E3- adenoviral vectors strongly reduces the host cytotoxic T cell response against the vector. Gene Ther. 2, 256-262. 44. Lieber, A., He, C. Y., Meuse, L., Schowalter, D., Kirillova, L, Winther, B., and Kay, M. A. (1997). The role of Kupffer cell activation and viral gene expression in early liver toxicity after infusion of recombinant adenovirus vectors. / . Virol. 71, 8798-8807. 45. Gooding, L. R., Aquino, L., Duerksen-Hughes, P. J., Day, D., Horton, T. M., Yei, S. P., and Wold, W. S. (1991). The ElB 19,000-molecular-weight protein of group C adenoviruses prevents tumor necrosis factor cytolysis of human cells but not of mouse cells. / . Virol. 65, 3083-3094. 46. Gooding, L. R., Ranheim, T. S., Tollefson, A. E., Aquino, L., Duerksen-Hughes, P., Hor ton, T. M., and Wold, W. S. (1991). The 10,400- and 14,500-dalton proteins encoded by region E3 of adenovirus function together to protect many but not all mouse cell lines against lysis by tumor necrosis factor. / . Virol. 65, 4114-4123. 47. Thomas, G. P., and Mathews, M. B. (1980). DNA replication and the early to late transition in adenovirus infection. Cell 22, 523-533. 48. Shaw, A. R., and Ziff, E. B. (1980). Transcripts from the adenovirus-2 major late promoter yield a single early family of 3' coterminal mRNAs and five late families. Cell 22, 905-916. 49. Shaw, A. R., and Ziff, E. B. (1982). Selective inhibition of adenovirus type 2 early region II and III transcription by an anisomycin block of protein synthesis. Mol. Cell Biol. 2, 789. 3 2 2 Henderson and Yu 50. Green, M., and Daesch, G. E. (1961). Biochemical studies on adenovirus multiplication. I. Kinetics: If nucleic acid and protein synthesis in suspension cultures. Virology 13,169-176. 51. Wold, S. M., Green, M., and Buttner, W. (1978). "The Molecular Biology of Animal Viruses." Dekker, New York. 52. Berk, A.J. (1986). Adenovirus promoters and ElA transactivation. Annu. Rev. Genet. 20, 45-79. 53. Nevins,J. R. (1991). Transcriptional activation by viral regulatory proteins. Trends Biochem. Set. 16, 435-439. 54. Berk, A. J., and Sharp, P. A. (1978). Structure of the adenovirus 2 early mRNAs. Cell 14, 695-711. 55. Nevins, J. R., Ginsberg, H. S., Blanchard, J. M., Wilson, M. C., and Darnell, J. E. (1979). Regulation of the primary expression of the early adenovirus transcription units. / . Virol. 32, 727-733. 56. Schuur, E. R., Henderson, G. A., Kmetec, L. A., Miller, J. D., Lamparski, H. G., and Hender son, D. R. (1996). Prostate-specific antigen expression is regulated by an upstream enhancer. / . Biol. Chem. 271, 7043-7051. 57. Brookes, D. E., Zandvliet, D., Watt, F., Russell, P. J., and MoUoy, P. L. (1998). Relative activity and specificity of promoters from prostate-expressed genes. Prostate 35, 18-26. 58. Greenberg, N. M., DeMayo, F. J., Sheppard, P. C., Barrios, R., Lebovitz, R., Finegold, M., Angelopoulou, R., Dodd, J. G., Duckworth, M. L., Rosen, J. M., et al. (1994). The rat probasin gene promoter directs hormonally and developmentally regulated expression of a heterologous gene specifically to the prostate in transgenic mice. Mol. Endocrinol. 8, 230-239. 59. Riegman, P. H., Vlietstra, R. J., Suurmeijer, L., Cleutjens, C. B., and Trapman, J. (1992). Characterization of the human kallikrein locus. Genomics 14, 6 -11 . 60. Schedlich, L. J., Bennetts, B. H., and Morris, B.J. (1987). Primary structure of a human glandular kallikrein gene. DNA 6, 429-437. 61. Morris, B.J. (1989). hGK-1: A kallikrein gene expressed in human prostate. Clin. Exp. Pharmacol. Physiol. 16, 345-351. 62. Haj-Ahmad, Y., and Graham, F. L. (1986). Development of a helper-independent human adenovirus vector and its use in the transfer of the herpes simplex virus thymidine kinase gene. / . Virol. 57, 267-274. 63. Robbins, P. D., Tahara, H., and Ghivizzani, S. C. (1998). Viral
vectors for gene therapy. Trends Biotechnol. 16, 35-40. 64. Wivel, N. A., and Wilson, J. M. (1998). Methods of gene delivery. Hematol. Oncol. Clin. North. Am. 12 ,483-501. 65. Levine, A.J., and Ginsberg, H. S. (1967). Mechanism by which fiber antigen inhibits multi plication of type 5 adenovirus./. Virol. 1, 747-757. 66. Ueno, N. T., Bartholomeusz, C., Herrmann, J. L., Estrov, Z., Shao, R., Andreeff, M., Price, J., Paul, R. W., Anklesaria, P., Yu, D., and Hung, M. C. (2000). ElA-mediated paclitaxel sensitization in HER-2/neu-overexpressing ovarian cancer SKOV3.ipl through apoptosis involving the caspase-3 pathway. Clin. Cancer Res. 6, 250-259. 67. Teodoro, J. G., Shore, G. C., and Branton, P. E. (1995). Adenovirus ElA proteins induce apoptosis by both p53-dependent and p53-independent mechanisms. Oncogene 11,467-474. 68. Marcellus, R. C., Teodoro, J. G., Wu, T., Brough, D. E., Ketner, G., Shore, G. C., and Branton, P. E. (1996). Adenovirus type 5 early region 4 is responsible for ElA-induced p53-independent apoptosis./. Virol. 70, 6207-6215. 69. Han, J., Sabbatini, P., Perez, D., Rao, L., Modha, D., and White, E. (1996). The ElB 19K protein blocks apoptosis by interacting with and inhibiting the p53-inducible and death-promoting Bax protein. Genes Dev. 10, 461-477. 10. Development of ARCAs for the Treatment of Prostate Cancer 3 2 3 70. Desai, S. Y., Patel, R. C , Sen, G. C , Malhotra, P., Ghadge, G. D., and Thimmapaya, B. (1995). Activation of interferon-inducible 2^-5' oligoadenylate synthetase by adenoviral VAI RNA./. BioL Chem. 270, 3454-3461. 71. Diaz-Guerra, M., Rivas, C., and Esteban, M. (1997). Activation of the IFN-inducible enzyme RNase L causes apoptosis of animal cells. Virology 236, 354-363. 72. Tollefson, A. E., Scaria, A., Hermiston, T. W., Ryerse, J. S., Wold, L. J,, and Wold, W. S. (1996). The adenovirus death protein (E3-11.6K) is required at very late stages of infection for efficient cell lysis and release of adenovirus from infected cells. / . Virol, 70, 2296-2306. 73. Tollefson, A. E., Ryerse, J. S., Scaria, A., Hermiston, T. W., and Wold, W. S. (1996). The E3- 11.6-kDa adenovirus death protein (ADP) is required for efficient cell death: Characterization of cells infected vŝ ith adp mutants. Virology 220, 152-162. 74. Chu, J. S., Huang, C. S., and Chang, K.J. (1998). The prognostic significance of tumor angiogenesis in Taiv^anese patients v^ith invasive ductal breast carcinomas. Cancer Lett. 134, 7-14. 75. Chen, Y., Yu, D. C , Charlton, D., and Henderson, D. R. (2000). Pre-existent adenovirus antibody inhibits systemic toxicity and antitumor activity of CN706 in the nude mouse LNCaP xenograft model: Implications and proposals for human therapy. Hum. Gene Ther. 11,1553-1567. 76. Pollack, A., and Zagars, G. K. (1997). External beam radiotherapy dose response of prostate cancer. Int. J. Radiat. Oncol. Biol. Phys. 39, 1011-1018. 77. Hanks, G. E., Hanlon, A. L., Schultheiss, T. E., Pinover, W. H., Movsas, B., Epstein, B. E., and Hunt, M. A. (1998). Dose escalation with 3D conformal treatment: Five year outcomes, treatment optimization, and future directions. Int. J. Radiat. Oncol. Biol. Phys. 41,501-510. 78. Zelefsky, M. J., Leibel, S. A., Gaudin, P. B., Kutcher, G. J., Fleshner, N. E., Venkatra- men, E. S., Renter, V. E., Fair, W. R., Ling, C. C , and Fuks, Z. (1998). Dose escalation v^ith three-dimensional conformal radiation therapy affects the outcome in prostate cancer. Int. J. Radiat. Oncol. BioL Phys. 41, 491-500. 79. Garzotto, M., Haimovitz-Friedman, A., Liao, W. C , White-Jones, M., Huryk, R., Hes- ton, W. D., Cardon-Cardo, C , Kolesnick, R., and Fuks, Z. (1999). Reversal of radiation resistance in LNCaP cells by targeting apoptosis through ceramide synthase. Cancer Res. 59, 5194-5201. 80. Jones, N., and Shenk, T. (1979). An adenovirus type 5 early gene function regulates expression of other early viral genes. Proc. Natl. Acad. Sci. USA 76, 3665-3669. 81. Martin-Duque, P., Sanchez-Prieto, R., Romero, J., Martinez-Lamparero, A., Cebrian- Sagarriga, S., Guinea-Viniegra, J., Dominguez, C , Lleonart, M., Cano, A., Quintanilla, M., and Ramon, Y. C. S. (1999). In vivo radiosensitizing effect of the adenovirus El A gene in murine and human malignant tumors. Int. J. Oncol. 15, 1163-1168. 82. Rogulski, K. R., Freytag, S. O., Zhang, K., Gilbert, J. D., PaieUi, D. L., Kim, J. H., Heise, C. C , and Kirn, D. H. (2000). In vivo antitumor activity of ONYX-015 is influenced by p53 status and is augmented by radiotherapy. Cancer Res. 60, 1193-1196. 83. Gorski, D. H., Beckett, M. A., Jaskowiak, N. T., Calvin, D. P., Mauceri, H. J., Salloum, R. M., Seetharam, S., Koons, A., Hari, D. M., Kufe, D. W., and Weichselbaum, R. R. (1999). Blockage of the vascular endothelial growth factor stress response increases the antitumor effects of ionizing radiation. Cancer Res. 59, 3374-3378. 84. Giatromanolaki, A., Sivridis, E., Koukourakis, M. I., Georgoulias, V., Gatter, K. C , and Harris, A. L. (1999). Intratumoral angiogenesis: A new prognostic indicator for stage I endometrial adenocarcinomas? Oncol. Res. 11, 205-212. 85. Giatromanolaki, A., Koukourakis, M. I., Theodossiou, D., Barbatis, K., O'Byrne, K., Harris, A. L., and Gatter, K. C. (1997). Comparative evaluation of angiogenesis assessment with anti-factor-VIII and anti-CD31 immunostaining in non-small cell lung cancer. Clin. Cancer. Res. 3, 2485-2492. 3 2 4 Henderson and Yu 86. Nemunaitis, J., Swisher, S. G., Timmons, T., Connors, D., Mack, M., Doerksen, L., Weill, D., Wait, J., Lawrence, D. D., Kemp, B. L., Fossella, F., Glisson, B. S., Hong, W. K., Khuri, F. R., Kurie, J. M., Lee, J. J., Lee, J. S., Nguyen, D. M., Nesbitt, J. C , Perez-Soler, R., Pisters, K. M., Putnam, J. B., Richli, W. R., Shin, D. M., Walsh, G. L., et al. (2000). Adenovirus-mediated p53 gene transfer in sequence with cisplatin to tumors of patients with non-small-cell lung cancer./. Clin. Oncol. 18, 609-622. 87. Oh, W. K., and Kantoff, P. W. (1999). Treatment of locally advanced prostate cancer: Is chemotherapy the next step? / . Clin. Oncol. 17, 3664-3675. 88. Yu, D. C., Chen, Y., Dilley, J., Embry, M., Zhang, H., Nguyen, N., Amin, P., Oh, J., and Henderson, D. R. (2001). Antitumor synergy of CV787, a prostate cancer-specific adenovirus, and pachtaxel and docetaxel. Cancer Res. 61, 517-525. 89. Nielsen, L. L., Lipari, P., Dell, J., Gurnani, M., and Hajian, G. (1998). Adenovirus-mediated p53 gene therapy and paclitaxel have synergistic efficacy in models of human head and neck, ovarian, prostate, and breast cancer. Clin. Cancer. Res. 4, 835-46. 90. Sanchez-Prieto, R., Quintanilla, M., Cano, A., Leonart, M. L., Martin, P., Anaya, A., and Ramon y Cajal, S. (1996). Carcinoma cell lines become sensitive to DNA-damaging agents by the expression of the adenovirus El A gene. Oncogene 13, 1083-1092. 91. Lowe, S. W., Ruley, H. E., Jacks, T., and Housman, D. E. (1993). p53-dependent apoptosis modulates the cytotoxicity of anticancer agents. Cell 74, 957-967. 92. Debbas, M., and White, E. (1993). Wild-type p53 mediates apoptosis by ElA, which is inhibited by ElB. Genes Dev. 7, 546-554. 93. Molnar-Kimber, K. L. (1996). Mechanism of action of rapamycin (Sirolimus, Rapamune). Transplant Proc. 28, 964-969. 94. Paielli, D. L., Wing, M. S., Rogulski, K. R., Gilbert, J. D., Kolozsvary, A., Kim, J. H., Hughes, J., Schnell, M., Thompson, T., and Freytag, S. O. (2000). Evaluation of the biodistribution, persistence, toxicity, and potential of germ-line transmission of a replication-competent human adenovirus following intraprostatic administration in the mouse. Mol. Ther. 1, 263-274. 95. Nelson, J. K., Shields, M. D., Stewart, M. C , and Coyle, P. V. (1999). Investigation of seroprevalence of respiratory virus infections in an infant population with a multiantigen fluorescence immunoassay using heel-prick blood samples collected on filter paper. Pediatr. Res. 45,799-802. 96. D'Ambrosio, E., Del Grosso, N., Chicca, A., and MiduUa, M. (1982). Neutralizing antibodies against 33 human adenoviruses in normal children in Rome./. Hyg. (London) 89, 155-161. 97. Piedra, P. A., Poveda, G. A., Ramsey, B., McCoy, K., and Hiatt, P. W. (1998). Incidence and prevalence of neutralizing antibodies to the common adenoviruses in children with cystic fibrosis: Implication for gene therapy with adenovirus vectors. Pediatrics 101, 1013-1019. 98. Schulick, A. H., Vassalli, G., Dunn, P. F., Dong, G., Rade, J. J., Zamarron, C , and Dichek, D. A. (1997). Established immunity precludes adenovirus-mediated gene transfer in rat carotid arteries. Potential for immunosuppression and vector engineering to overcome barriers of immunity. / . Clin. Invest. 99, 209-219. 99. Fang, B., Eisensmith, R. C , Wang, H., Kay, M. A., Cross, R. E., Landen, C. N., Gordon, G., Bellinger, D. A., Read, M. S., Hu, P. C , et al. (1995). Gene therapy for hemophilia B: host immunosuppression prolongs the therapeutic effect of adenovirus-mediated factor IX expression. Hum. Gene Ther. 6, 1039-1044. 100. Ilan, Y., Jona, V. K., Sengupta, K., Davidson, A., Horwitz, M. S., Roy-Chowdhury, N., and Roy-Chowdhury, J. (1997). Transient immunosuppression with FK506 permits long-term expression of therapeutic genes introduced into the liver using recombinant adenoviruses in the rat. Hepatology 26, 949-956. 101. Lochmuller, H., Petrof, B. J., Allen, C , Prescott, S., Massie, B., and Karpati, G. (1995). Immunosuppression by FK506 markedly prolongs expression of adenovirus-delivered trans- 10. Development of ARCAs for the Treatment of Prostate Cancer 3 2 5 gene in skeletal muscles of adult dystrophic [mdx] mice. Biochem. Biophys. Res. Commun. 213, 569-574. 102. Lochmuller, H., Petrof, B. J., Pari, G., Larochelle, N., Dodelet, V., Wang, Q., Allen, C , Prescott, S., Massie, B., Nalbantoglu, J., and Karpati, G. (1996). Transient immunosup pression by FK506 permits a sustained high-level dystrophin expression after adenovirus- mediated dystrophin minigene transfer to skeletal muscles of adult dystrophic (mdx) mice. Gene. Ther. 3, 706-716. 103. Vilquin, J. T., Guerette, B., Kinoshita, I., Roy, B., Goulet, M., Gravel, C., Roy, R., and Tremblay, J. P. (1995). FK506 immunosuppression to control the immune reactions triggered by first-generation adenovirus-mediated gene transfer. Hum. Gene Ther. 6, 1391-1401. 104. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression follov^ing delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, 1S5S-\SG6. 105. Smith, T. A., White, B. D., Gardner, J. M., Kaleko, M., and McClelland, A. (1996). Tran sient immunosuppression permits successful repetitive intravenous administration of an adenovirus vector. Gene Ther. 3, 496-502. 106. Yang, Y., Greenough, K., and Wilson, J. M. (1996). Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allov^s repeated gene transfer to mouse liver. Gene Ther. 3, 412-420. 107. Jooss, K., Turka, L. A., and Wilson, J. M. (1998). Blunting of immune responses to adenoviral vectors in mouse liver and lung v^ith CTLA4Ig. Gene Ther. 5, 309-319. 108. Kay, M. A., Holterman, A. X., Meuse, L., Gov^n, A., Ochs, H. D., Linsley, P. S., and Wilson, C. B. (1995). Long-term hepatic adenovirus-mediated gene expression in mice following CTLA4Ig administration. Nat. Genet. 11, 191-197. 109. Kolls, J. K., Lei, D., Odom, G., Nelson, S., Summer, W. R., Gerber, M. A., and Shellito, J. E. (1996). Use of transient CD4 lymphocyte depletion to prolong transgene expression of El-deleted adenoviral vectors. Hum. Gene Ther. 7, 489-497. 110. Lei, D., Lehmann, M., Shellito, J. E., Nelson, S., Siegling, A., Volk, H. D., and Kolls, J. K. (1996). Nondepleting anti-CD4 antibody treatment prolongs lung-directed El-deleted adenovirus-mediated gene expression in rats. Hum. Gene Ther. 7,1T73-1T79. 111. Scaria, A., St George, J.A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C , Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40 ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airv^ay. Gene Ther. ^,611-617. 112. McClane, S. J., Chirmule, N., Burke, C. V., and Raper, S. E. (1997). Characterization of the immune response after local delivery of recombinant adenovirus in murine pancreas and successful strategies for readministration. Hum. Gene Ther. 8, 2207-2216. 113. Kay, M. A., Meuse, L., Gov^n, A. M., Linsley, P., Hollenbaugh, D., Aruffo, A., Ochs, H. D., and Wilson, C. B. (1997). Transient immunomodulation with anti-CD40 ligand antibody and CTLA4Ig enhances persistence and secondary adenovirus-mediated gene transfer into mouse liver. Froc. Natl. Acad. Sci. USA 94, 4686-4691. 114. Cichon, G., and Strauss, M. (1998). Transient immunosuppression with 15-deoxyspergualin prolongs reporter gene expression and reduces humoral immune response after adenoviral gene transfer. Gene Ther. 5, 85-90. 115. Juillard, v. , Villefroy, P., Godfrin, D., Pavirani, A., Venet, A., and Guillet, J. G. (1995). Long-term humoral and cellular immunity induced by a single immunization with replication- defective adenovirus recombinant vector. Eur.
J. Immunol. 25, 3467-3473. 116. Otake, K., Ennist, D. L., Harrod, K., and Trapnell, B. C. (1998). Nonspecific inflammation inhibits adenovirus-mediated pulmonary gene transfer and expression independent of specific acquired immune responses. Hum. Gene Ther. 9, 2207-2222. 117. Li, H., Griscelli, P., Lindenmeyer, F., Opolon, P., Sun, L. Q., Connault, E., Soria, J., Soria, C , Perricaudet, M., Yeh, P., and Lu, H. (1999). Systemic delivery of antiangiogenic adenovirus 3 2 6 Henderson and Yu AdmATF induces liver resistance to metastasis and prolongs survival of mice. Hum. Gene Ther. 10, 3045-3053. 118. Molnar-Kimber, K. L., Sterman, D. H., Chang, M., Kang, E. H., ElBash, M., Lanuti, M., Elshami, A., Gelfand, K., Wilson, J. M., Kaiser, L. R., and Albelda, S. M. (1998). Impact of preexisting and induced humoral and cellular immune responses in an adenovirus-based gene therapy phase I clinical trial for locaHzed mesotheUoma. Hum. Gene Ther. 9, 2121-2133. 119. Harvey, B. G., Hackett, N. R., El-Saw^y, T,, Rosengart, T. K., Hirschov^itz, E. A., Lieberman, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs. / . Virol 73, 6729-6742. 120. Harvey, B. G., Worgall, S., Ely, S., Leopold, P. L., and Crystal, R. G. (1999). Cellular immune responses of healthy individuals to intradermal administration of an El-E3-adenovirus gene transfer vector. Hum. Gene Ther. 10, 2823-2837. 121. Kagami, H., Atkinson, J. C , Michalek, S. M., Handelman, B., Yu, S., Baum, B. J., and O'Connell, B. (1998). Repetitive adenovirus administration to the parotid gland: Role of immunological barriers and induction of oral tolerance. Hum. Gene Ther. 9, 305-313. 122. Gall, J. G., Crystal, R. G., and Falck-Pedersen, E. (1998). Construction and characteri zation of hexon-chimeric adenoviruses: Specification of adenovirus serotype. / . Virol. 71, 10,260-10,264. 123. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, L, Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangeli, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 124. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, L, Crystal, R. G., and Falck- Pedersen, E. (1996). "Sero-switch "adenovirus-mediated in vivo gene transfer: Circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 125. Beer, S. J., Matthev^s, C. B., Stein, C. S., Ross, B. D., Hilfinger, J. M., and Davidson, B. L. (1998). Poly (lactic-glycolic) acid copolymer encapsulation of recombinant adenovirus reduces immunogenicity in vivo. Gene Ther. 5, 740-746. 126. Chillon, M., Lee, J. H., Fasbender, A., and Welsh, M. J. (1998). Adenovirus complexed with polyethylene glycol and cationic lipid is shielded from neutralizing antibodies in vitro. Gene Ther. 5,995-1002. 127. O'Riordan, C. R., Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S. C , Smith, A. E., and Francis, G. E. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum. Gene Ther. 10,1349-1358. 128. Bewley, M. C , Springer, K., Zhang, Y. B., Freimuth, P., and Flanagan, J. M. (1999). Structural analysis of the mechanism of adenovirus binding to its human cellular receptor, CAR. Science 286, 1579-83. 129. Nemerow, G. R., and Stewart, P. L. (1999). Role of alpha(v) integrins in adenovirus cell entry and gene delivery. Microbiol. Mol. Biol. Rev. 63, 725-734. 130. Henderson, D. R., Friedman, S. B., Harris, J. D., Manning, W. B., and Zoccoh, M. A. (1986). CEDIA, a new homogeneous immunoassay system. Clin. Chem. 32, 1637-1641. 131. Bramson, J. L., Hitt, M., Gauldie, J., and Graham, F. L. (1997). Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther. 4, 1069-1076. 132. Li, Z., Rakkar, A., Katayose, Y., Kim, M., Shanmugam, N., Srivastava, S., Moul, J. W., McLeod, D. G., Cowan, K. H., and Seth, P. (1998). Efficacy of multiple administrations of 10. Development of ARCAs for the Treatment of Prostate Cancer 3 2 7 a recombinant adenovirus expressing wild-type p53 in an immune-competent mouse tumor modd.Gene Ther. 5, 605-613. 133. Smith, J. G., Raper, S. E., Wheeldon, E. B., Hackney, D., Judy, K., Wilson, J. M., and Eck, S. L. (1997). Intracranial administration of adenovirus expressing HSV-TK in combination v^ith ganciclovir produces a dose-dependent, self-limiting inflammatory response. Hum. Gene Ther. 8 ,943-954. 134. Sterman, D. H., Treat, J., Litzky, L. A., Amin, K. M., Coonrod, L., Molnar-Kimber, K., Recio, A., Knox, L., Wilson, J. M., Albelda, S. M., and Kaiser, L. R. (1998). Adenovirus- mediated herpes simplex virus thymidine kinase/ganciclovir gene therapy in patients with localized malignancy: Results of a phase I clinical trial in malignant mesothelioma. Hum. Gene Ther. 9, 10H3-1092. 135. Yang, Y., Li, Q., Ertl, H. C , and Wilson, J. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses./. Virol. 69,2004-2015. 136. Muruve, D. A., Barnes, M. J., Stillman, I. E., and Libermann, T. A. (1999). Adenoviral gene therapy leads to rapid induction of multiple chemokines and acute neutrophil-dependent hepatic injury in vivo. Hum. Gene Ther. 10, 965-976. 137. Muruve, D. A., Nicolson, A. G., Manfro, R. C., Strom, T. B., Sukhatme, V. P., and Liber mann, T. A. (1997). Adenovirus-mediated expression of Fas ligand induces hepatic apoptosis after Systemic administration and apoptosis of ex vivo-infected pancreatic islet allografts and isografts. Hum. Gene Ther. 8, 955-963. 138. Postlethwaite, R. (1979). Liver damage induced in mice by human adenovirus type 5. Scot. Med. J. 18,131. 139. Worgall, S., Wolff, G., Falck-Pedersen, E., and Crystal, R. G. (1997). Innate immune mechanisms dominate elimination of adenoviral vectors following in vivo administration. Hum. Gene Ther. 8, 37-44. 140. Dau, P. C. (1995). Immunologic rebound./. Clin. Apheresise 10, 210-217. 141. Dau, P. C , Callahan, J., Parker, R., and Golbus, J. (1991). Immunologic effects of plasma pheresis synchronized with pulse cyclophosphamide in systemic lupus erythematosus. / . Rheumatol. 18, 270-276. 142. Gahery-Segard, H., Farace, F., Godfrin, D., Gaston, J., Lengagne, R., Tursz, T., Boulanger, P., and Guillet, J. G. (1998). Immune response to recombinant capsid proteins of adenovirus in humans: Antifiber and anti-penton base antibodies have a synergistic effect on neutralizing activity./. Virol. 72,2388-2397. 143. Wohlfart, C. (1988). Neutralization of adenoviruses: Kinetics, stoichiometry, and mecha nisms. / . Virol. 62, 2321-2328. 144. Ganly, I. (1997). Phase I trial of intratumoral injection with an ElB-attenuated adenovirus, ONYX-015, in patients with recurrent p53(-) head and neck cancer. Proc. Am. Soc. Clin. Oncol. 16, 382a. 145. Kirn, D. H., and McCormick, F. (1996). Replicating viruses as selective cancer therapeutics. Mol. Med. Today 2, 519-527. 146. Khuri, F. R., Nemunaitis, J., Ganly, I., Arseneau, J., Tannock, I. F., Romel, L., Gore, M., Ironside, J., MacDougall, R. H., Heise, C , Randlev, B., Gillenwater, A. M., Bruso, P., Kaye, S. B., Hong, W. K., and Kirn, D. H. (2000). a controlled trial of intratumoral ONYX-015, a selectively-replicating adenovirus, in combination with cisplatin and 5-fluorouracil in patients with recurrent head and neck cancer. Nat. Med. 6, 879-885. 147. Ganly, I., Eckhardt, S. G., Rodriguez, G. I., Soutar, D. S., Otto, R., Robertson, A. G., Park, O., Gulley, M. L., Heise, C , Von Hoff, D.D., and Kaye, S.B. (2000). A phase I study of Onyx-015, an ElB attenuated adenovirus, administered intratumorally to patients with recurrent head and neck cancer. Clin. Cancer Res. 6, 798-806. 3 2 8 Henderson and Yu 148. van Elsacker-Niele, A. M., and Kroes, A. C. (1999). Human parvovirus B19: relevance in internal medicine. Neth. J. Med. 54, 221-230. 149. Segovia, J. C , Gallego, J. M., Bueren, J. A., and Almendral, J. M. (1999). Severe leukopenia and dysregulated erythropoiesis in SCID mice persistently infected v^ith the parvovirus minute virus of mice./. Virol. 73, 1774-1784. 150. Kelly, W. K., Scher, H. I., Mazumdar, M., Vlamis, V., Schwartz, M., and Fossa, S. D. (1993). Prostate-specific antigen as a measure of disease outcome in metastatic hormone-refractory prostate cancer./. Clin. Oncol. 11, 607-615. 151. Smith, D. C , Dunn, R. L., Strav^derman, M. S., and Pienta, K.J. (1998). Change in serum prostate-specific antigen as a marker of response to cytotoxic therapy for hormone-refractory prostate cancer./. Clin. Oncol. 16, 1835-1843. 152. Pollack, A., Lankford, S., Zagars, G. K., and Babaian, R. J. (1996). Prostate specific antigen density as a prognostic factor for patients v^ith prostate carcinoma treated v^ith radiotherapy. Cancer 77, 1515-1523. 153. Pound, C. R., Partin, A. W., Eisenberger, M. A., Chan, D. W., Pearson, J. D., and Walsh, P. C. (1999). Natural history of progression after PSA elevation follov^ing radical prostatec tomy./A MA 281, 1591-1597. 154. Herschman, J. D., Smith, D. S., and Catalona, W. J. (1997). Effect of ejaculation on serum total and free prostate-specific antigen concentrations. Urology 50, 239-243. 155. Ornstein, D. K., Rao, G. S., Smith, D. S., Ratliff, T. L., Basler, J. W., and Catalona, W.J. (1997). Effect of digital rectal examination and needle biopsy on serum total and percentage of free prostate specific antigen levels./. Urol. 157, 195-198. 156. Jain, R. K. (1990). Physiological barriers to delivery of monoclonal antibodies and other macromolecules in tumors. Cancer Res. 50, 814s-819s. 157. Cunningham, T. (1997). Pathogenesis of viral infection. In "Antiviral Agents and Human Viral Diseases" (J. Glasso, R. J. Whitley, and T. C. Merigan, Eds.), pp. 45-78 . Lippincott- Raven, Philadelphia. 158. Gutekunst, R. R., White, R. J., Edmondson, W. P., and Chanock, R. M. (1967). Immuniza tion with live type 4 adenovirus: Determination of infectious virus dose and protective effect of enteric infection. Am. J. Epidemiol. 86, 341-349. 159. Russi, T. J., Hirschowitz, E. A., and Crystal, R. G. (1997). Delayed-type hypersensitivity response to high doses of adenoviral vectors. Hum. Gene Ther. 8, 323-330. 160. Chengalvala, M. V., Bhat, B. M., Bhat, R. A., Dheer, S. K., Lubeck, M. D., Purcell, R. H., and Murthy, K. K. (1997). Replication and immunogenicity of Ad7-, Ad4-, and Ad5-hepatitis B virus surface antigen recombinants, with or without a portion of E3 region, in chimpanzees. Vaccine 15, 335-339. 161. Kass-Eisler, A., Leinwand, L., Gall, J., Bloom, B., and Falck-Pedersen, E. (1996). Cir cumventing the immune response to adenovirus-mediated gene therapy. Gene Ther. 3, 154-162. C H A P T E R Replicatiofi'Selective Oncolytic Adenovirus El-Region Mutants: Virotherapy for Cancer David Kirn Imperial Cancer Research Fund Program for Viral and Genetic Therapy of Cancer Hammersmith Hospital Imperial College School of Medicine London, United Kingdom I. Introduction Chemotherapy for metastatic sohd tumors generally fails due to an insuf- fiicient therapeutic index and/or insufficient antitumoral potency. Standard agents target a variety of different structures within cancer cells, but almost all of them are thought to kill cancer cells through the induction of apoptosis. As a result, apoptosis-resistant clones develop follov^ing standard therapies, even if numerous high-dose chemotherapeutic agents are used in combination. New treatment approaches should therefore have not only greater potency and greater selectivity than currently available treatments, they should also have novel mechanisms of action that will not be subject to cross-resistance with standard treatments (i.e., efficacy should not be dependent on apoptosis induction in cancer cells exclusively). Replication-selective oncolytic adenoviruses appear to have these char acteristics. These viruses have evolved to infect cells, replicate, induce cell death, release viral particles, and finally spread in human tissues. Replication in tumor tissue leads to amplification of the input dose, while a block in replication in normal tissues can lead to efficient clearance and reduced toxic ity (Fig. 1). Selective replication within tumor tissue can theoretically increase the therapeutic index of these agents dramatically. In addition, viruses kill cells by a number of unique mechanisms. In addition to direct lysis at the conclusion of the repUcative cycle, viruses can kill cells through expression of ADENOVIRAL VECTORS FOR GENE THERAPY 3 2 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 330 David Kirn toxic proteins, induction of both inflammatory cytokines and T-cell-mediated immunity, and enhancement of cellular-sensitivity to their effects. Therefore, cross-resistance with standard chemotherapeutics or radiotherapy should be much less likely. Remarkable advances in molecular biology and genetics have led to a new understanding of both (1) the replication and pathogenicity of viruses and (2) carcinogenesis. The resulting techniques and knowledge have
allowed novel agents to be engineered to enhance their safety and/or their antitumoral potency. Genetically engineered viruses in development over the past decade have included adenoviruses, herpesviruses, and vaccinia. Viruses with inher ent tumor-selectivity have been evaluated and include reovirus, autonomous parvoviruses, Newcastle disease virus, measles virus strains, and vesicular stomatitis virus [1]. Each of these agents has shown tumor selectivity in vitro and/or in vivo^ and efficacy has been demonstrated in murine tumor mod els with many of these agents following intratumoral, intraperitoneal, and/or intravenous routes of administration. Preclinical data reported with these agents has been encouraging, but a number of important questions have awaited results from clinical trials. Viral agents like adenovirus have complex biologies, potentially including NORMAL cell viral replication blocked CANCER cell cancer-specific viral replication genetic alteration Figure 1 Schematic representation of tumor-selective viral replication and cell killing (A) and tumor-selective tissue necrosis (B). Reprinted with permission from Journal of Clinical Investigation. 1 1 . Replication-Selective Oncolytic Adenovirus E1 -Region Mutants 331 Normal Figure 1 (continued) species-specific interactions with host cell machinery and/or immune response effectors [2, 3]. Antitumoral efficacy and safety studies with these viruses have generally been performed in rodent or primate models. All published animal tumor model data with replication-selective adenoviruses has come from immunodeficient mouse-human tumor xenograft models [4-6]. Data from cancer patients has therefore been eagerly awaited. Now, after more than 5 years of clinical research with dll520 (Onyx-015 or CI-1042, Pfizer Corp., Groton, CT), approximately 15 clinical trials have been completed and recently analyzed involving approximately 250 patients. This chapter reviews the discovery and development of replication- selective oncolytic adenoviruses, with an emphasis on recently acquired data from phase I and II clinical trials with J/1520. The goal will be to summarize (1) the genetic targets and mechanisms of selectivity for these agents; (2) clinical trial data and what it has taught us to date about the promise but also the potential hurdles to be overcome with this approach; (3) future approaches to overcome these hurdles. 3 3 2 David Kirn II. Attributes of Replication-Selective Adenoviruses for Cancer Treatment A number of efficacy, safety, and manufacturing issues need to be assessed when considering a virus species for development as an oncolytic therapy [1]. First, by definition the virus must replicate in and destroy human tumor cells. An understanding of the genes modulating infection, replication or pathogenesis is necessary for rational engineering of the virus. Since most solid human turnors have relatively low growth fractions, the virus should infect both cycling and noncycling cells. In addition, receptors for viral entry must be expressed on the target tumor(s) in patients [7]. From a safety standpoint, the parental wild- type virus should ideally cause only mild, well-characterized human disease(s). Nonintegrating viruses have potential safety advantages as well. A genetically stable virus is desirable from both safety and manufacturing standpoints. Finally, the virus must be amenable to high-titer production and purification under Good Manufacturing Practices (GMP) guidelines for clinical studies. Human adenoviruses have these characteristics and are therefore excellent oncolytic virus candidates [8]. IIL Biology of Human Adenovirus Adenovirus biology is reviewed in detail elsewhere [9]. Roughly 50 dif ferent serotypes of human adenovirus have been discovered; the two most commonly studied are types 2 and 5 (group C). Adenoviruses have lin ear, double-stranded DNA genomes of approximately 38 kb. The capsid is nonenveloped and is composed of the structural proteins hexon, fiber (binds Coxsackie and adenovirus receptor (CAR)), and penton (binds ay^s^s integrins for virus internalization). The adenovirus life-cycle includes the following steps: (1) virus entry into the cell following CAR and integrin bind ing, (2) release from the endosome and subsequent entry into the nucleus, (3) expression of early region gene products, (4) cell entry into S-phase, (5) prevention of p53-dependent and -independent apoptosis, (6) shut-off of host cell protein synthesis, (7) viral DNA replication, (8) viral structural protein synthesis, (9) virion assembly in the nucleus, (10) cell death, and (11) virus release. The E3 region encodes a number of gene products respon sible for immune response evasion [10, 11]. The gp 19-kDa protein inhibits MHC-class I expression on the cell surface (i.e. avoidance of cytotoxic T- lymphocyte-mediated killing) [12], and the E3 10.4/14.5-kDa (RID complex) and 14.7-kDa proteins inhibit apoptosis mediated by FasL or tumor necrosis factor (TNF) [11, 13]. 1 1 . Replication-Selective Oncolytic Adenovirus El-Region Mutants 3 3 3 IV. Mechanisms of Adenovirus-Mediated Cell Killing Adenovirus replication within a target tumor cell can lead to cell destruc tion by several mechanisms (Table I). Viral proteins expressed late in the course of infection are directly cytotoxic, including the E3 11.6-kDa adenovirus death protein [14] and E40RF4 [Branton, 1999 #1920]. Deletion of these gene products results in a significant delay in cell death. In addition, El A expression early during the adenovirus life cycle induces cell sensitivity to TNF-mediated killing [15]. This effect is inhibited by the E3 proteins 10.4/14.5 and 14.7; deletion of these E3 proteins leads to an increase in TNF expression in vivo and enhanced cell sensitivity to TNF [3]. Finally, viral replication in and lysis of tumor cells has been show^n to promote the induction of cell-mediated immunity to uninfected tumor cells in model systems w îth other viruses [16, 17]; v^hether this v îll occur in patients and v^ith adenovirus remains to be determined. V. Approaches to Optimizing Tumor-Selective Adenovirus Replication Two broad approaches are currently being used to engineer tumor- selective adenovirus replication. One is to limit the expression of the ElA Table I Pofential Mechanisms of Antitumoral Efficacy v^ith Replication-Selective Adenoviruses Mechanism Examples of adenoviral genes modulating effect I. Direct cytotoxicity due to viral proteins • E3 11.6 kDa • E40RF4 II. Augmentation of antitumoral immunity CTL infiltration, killing • E3 gp 19 kDa^ Tumor cell death, antigen release • E3 11.6 kDa Immunostimulatory cytokine induction • E3 10.4/14.5, 14.7 kDa^ Antitumoral cytokine induction (e.g., TNF) • E3 10.4/14.5, 14.7 kDa^ Enhanced sensitivity to cytokines (e.g., TNF) • ElA Unknov^n (.̂ ElA, others) III. Sensitization to chemotherapy IV. Expression of exogenous therapeutic genes Note. CTL, cytotoxic T-lymphocyte; TNF, tumor necrosis factor; NA, not applicable. ^Viral protein inhibits antitumoral mechanism. 3 3 4 David Kirn gene product to tumor tissues through the use of tumor- and/or tissue-specific promoters. ElA functions to stimulate S-phase entry and to transactivate both viral and cellular genes that are critical for a productive viral infection [18]. A second broad approach to optimizing tumor selectivity is to delete gene functions that are critical for efficient viral replication in normal cells but are expendable in tumor cells (described below^). Tissue- or tumor-specific promoters can replace endogenous viral sequen ces in order to restrict viral replication to a particular target tissue. For example, the prostate-specific antigen (PSA) promoter/enhancer element has been inserted upstream of the ElA gene; the result is that viral replication correlates with the level of PSA expression in a given cell [4]. This virus, CN706 (Calydon Pharmaceuticals, CA), is currently in a Phase I clinical trial of intratumoral injection for patients w îth locally recurrent prostate carcinoma. A second prostate-specific enhancer sequence has subsequently been inserted upstream of the ElB region [19]; the use of these two prostate-specific enhancer elements to drive separate early gene regions has led to improved selectivity over the first-generation virus [19]. A similar approach has been pursued by other groups using tissue-specific promoters to drive ElA expression selectively in specific carcinomas (e.g., alpha-fetoprotein, carcinoembryonic antigen, MUC- 1)[20,21]. A second general approach is to complement loss-of-function mutations in cancers with loss-of-function mutations within the adenovirus genome. Many of the same critical regulatory proteins that are inactivated by viral gene products during adenovirus replication are also inactivated during car cinogenesis [22-25]. Because of this convergence, the deletion of viral genes that inactivate these cellular regulatory proteins can be complemented by genetic inactivation of these proteins within cancer cells [26, 78]. The deletion approach was first described by Martuza et al. with herpesviruses; the thymi dine kinase gene (dlsptk) [27] and subsequently the ribonucleotide reductase gene (G207) were deleted [28]. Two adenovirus deletion mutation approaches have subsequently been described (see below). VI. El A-CR2 Region Deletion Mutants Mutants in the ElA conserved region 2 (CR2) are defective in pRB bind ing [29, 30] (Fig. 2). These viruses are being evaluated for use against tumors with pRB pathway abnormalities (e.g., loss of the Gl-S checkpoint) [26, 31, 32]. The delta-24 E1A-CR2 mutant virus was able to efficiently replicate in tumor cell lines lacking functional pRB, while replication was significantly inhibited by reintroduction of wild-type RB protein into a tumor cell line lack ing functional pRB; both in vitro and in vivo efficacy were demonstrated [32]. With J/922/947, a very similar E1A-CR2 mutant, S-phase induction and viral 1 1 . Replication-Selective Oncolytic Adenovirus El-Region Mutants 3 3 5 Adenovirus El A 289R •Exonl 11 Unique •Exon2- 243R 139 186 289 \| C R 1 CE2 oo 40 eo 120 188 pRb family-binding regions pRB 30 60 121 127 pl30 30 60 121 139 pl07 30 60 124127 ^922-947 92:?/947 i 122 129 Figure 2 Diagram of the structure of the adenovirus El A RNA (12S, 13S) and pRB protein family-binding regions showing deletion in c//922-947 mutant adenovirus. replication are significantly inhibited in quiescent normal cells, whereas repli cation and cytopathic effects proceed efficiently in tumor cells; interestingly, dl922/947 demonstrates significantly greater potency than dllSlO both in vitro and in vivo [26, 31], and in a nude mouse-human tumor xenograft model, intravenously administered d/922/947 had significantly superior efficacy to even wild-type adenovirus [31]. The El A mutant adenoviruses described by these two groups may in fact behave very similarly, although to date they have been tested in different fashions. Unlike the complete deletion of ElB 55 kDa in dll520, these mutations in El A are targeted to a single conserved region and may therefore leave intact other important functions of the gene product; therefore, viral potency is not attenuated. VII. E1B 55-kDa Gene Deletion Mutant: d/1520 J/1520 (Onyx-015) was the first adenovirus described to mirror the gene deletion approach pioneered by Martuza with herpesvirus. McCormick et al. 336 David Kirn hypothesized that an adenovirus with deletion of a gene encoding a p53- binding protein, ElB 55-kDa, would be selective for tumors that already had inhibited or lost p53 function. p53 function is lost in the majority of human cancers through mechanisms including gene mutation, overexpression of p53- binding inhibitors (e.g., mdm2, human papillomavirus E6), and loss of the p53-inhibitory pathway modulated by pl4^^^ [33-35]. However, the precise role of p53 in the inhibition of adenoviral replication has not been defined to date. In addition, other adenoviral proteins also have direct or indirect effects on p53 function (e.g., E4orf6, ElB 19-kDa, ElA) [36]. Finally, ElB 55-kDa itself has important viral functions that are unrelated to p53 inhibition (e.g., viral mRNA transport, host cell protein synthesis shut-off) [37] (Fig. 3). Not surprisingly, therefore, the role of p53 in the replication-selectivity of dll520 has been difficult to confirm despite extensive in vitro experimentation by many groups. ElB 55-kDa gene deletion was associated with decreased replication and cytopathogenicity in p53(-h) tumor cells versus matched p53(-) tumor cells, relative to wild-type adenovirus, in RKO and H1299 cells [38-40]. However, conflicting data on the role of p53 in modulating J/1520 replication and/or cytopathic effect (CPE) has come from different cell systems; no p53 effect was demonstrated in matched U20S cells, for example [40]. Although p53 can clearly inhibit J/1520 in many cell systems, it has become clear that many other cellular factors independent of p53 play critical roles in determining E1B49K E^ltS K >S>1 ^ ^ \m^- Figure 3 Diagram of both p53 pathway interactions with adenoviral gene products and functions of El B 55 kDa: complexity of cancer cell and adenoviral biology. (A) Note that adenoviral proteins (light gray) target multiple components of this pathway at sites upstream of p53, downstream of p53 and at the level of p53 itself. Examples of p53-regulated cell functions are shown (black boxes). In addition, the known functions of ElB 55 kDa are shown (dark gray). (B) Graphic representation of the consequences of ElB 55-kDa gene deletion. In addition to the loss of p53 binding when ElB 55 kDa was deleted in c//1520 (Onyx-015), other important viral functions
are also lost. 1 1 . Replication-Selective Oncolytic Adenovirus E1 -Region Mutants 337 Figure 3 (continued) the sensitivity of cells to dll520 [39, 41-44] . Clinical trials were ultimately necessary to determine the selectivity and clinical utility of J/1520 (see below). Clinical trial data confirmed the tumor-selectivity of dll520. VIII. Clinical Trial Results with Replication-Competent Adenoviruses in Cancer Patients A. Clinical Trial Results with Wild-Type Adenovirus Over the past century a diverse array of viruses were injected into cancer patients by various routes, including adenovirus, Bunyamwara, Coxsackie, dengue, feline panleukemia, Ilheus, mumps, Newcastle disease virus, vaccinia, and West Nile [1, 45-47]. These studies illustrated both the promise and the hurdles to overcome with oncolytic viral therapy. Unfortunately, these previous clinical studies were not performed to current clinical research standards, and therefore none give interpretable and definitive results. At best, these studies are useful in generating hypotheses that can be tested in future trials. Although suffering from many of the trial design flaws listed below, a trial with wild-type adenovirus is one of the most useful for hypothesis generation but also for illustrating how clinical trial design flaws severely curtail the utility of the study results. The knowledge that adenoviruses could eradicate a variety of tumor cells in vitro led to a clinical trial in the 1950s with wild-type adenovirus. Ten different serotypes were used to 3 3 8 David Kirn treat 30 cervical cancer patients [47]. Forty total treatments were administered by either direct intratumoral injection {n = 23), injection into the artery perfusing the tumor {n = 10), treatment by both routes (n = 6), or intravenous administration (n = 1). Characterization of the material injected into patients was minimal. The volume of viral supernatant injected is reported, but actual viral titers/doses are not; injection volumes (and by extension doses) varied greatly. When possible, the patients were treated with a serotype to which they had no neutralizing antibodies present. Corticosteroids were administered as nonspecific immunosuppressive agents in roughly half of the cases. Therefore, no two patients were treated in identical fashion. Nevertheless, the results are intriguing. No significant local or systemic toxicity was reported. This relative safety is notable given the lack of preexisting immunity to the serotype used and concomitant corticosteroid use in many patients. Some patients reported a relatively mild viral syndrome lasting 2 - 7 days (severity not defined); this viral syndrome resolved spontaneously. Infectious adenovirus was recovered from the tumor in two-thirds of the patients for up to 17 days postinoculation. Two-thirds of the patients had a "marked to moderate local tumor response" with necrosis and ulceration of the tumor (definition of "response" not reported). None of the seven control patients treated with either virus-free tissue culture fluid or heat-inactivated virus had a local tumor response (sta tistical significance not reported). Therefore, clinically evident tumor necrosis was only reported with viable virus. Neutralizing antibodies increased within 7 days after administration. Although the clinical benefit to these patients is unclear, and all patients eventually had tumor progression and died, this study did demonstrate that wild-type adenoviruses can be safely administered to patients and that these viruses can replicate and cause necrosis in sofid tumors despite a humoral immune response. The maximally tolerated dose, dose-limiting toxicity, objective response rate, and time to tumor progres sion, however, remain unknown for any of these serotypes by any route of administration. B. A Novel Staged Approach to Clinical Research with Replication-Selective Viruses: The Example of c//1520(Onyx-015) For the first time since viruses were first conceived as agents to treat cancer over a century ago, we now have definitive data from numerous phase I and II clinical trials with a well-characterized and well-quantitated virus. J/1520 (Onyx-015, a.k.a., CI-1042, Pfizer, Inc.) is a novel agent with a novel mechanism of action. This virus was to become the first virus to be used in humans that had been genetically engineered for replication selectivity. We predicted that both toxicity and efficacy would be dependent on multiple 1 1 . Replication-Selective Oncolytic Adenov i rus E1 -Region Mutan ts 339 Staged Development approach: Replication-selective agents for cancer Intra tumoral Intra peritoneal /w^ra-arterial/hepatic artery Intra venous Figure 4 Staged clinical research and development approach used in research and development with c//1520 (Onyx-015). Once safety and biological activity was demonstrated by the intratumoral route, clinical trials were initiated sequentially to study intracavitary instillation (initially intraperi toneal), intraarterial infusion (hepatic artery) and eventually intravenous administration. Only patients with advanced and incurable cancers were enrolled on trials initially. Once safety was demonstrated in these patients, trials were initiated in patients with premalignant lesions. Finally, clinical trials of combinations with chemotherapy were initiated only after the safety of c//1520 as a single agent had been documented by the relevant route of administration. Reprinted with permission from Gene Therapy. factors including (1) the inherent abihty of a given tumor to rephcate and shed the virus, (2) the location of the tumor to be treated (e.g., intracranial vs peripheral), and (3) the route of administration of the virus. In addition, we felt it w^ould be critical to obtain biological data on viral replication, antiviral immune responses and their relationship to antitumoral efficacy in the earliest phases of clinical research. We therefore designed and implemented a novel staged clinical research and development approach with this virus (Fig. 4). The goal of this approach was to sequentially increase systemic exposure to the virus only after safety with more localized delivery had been demonstrated. Following demonstration of safety and biological activity by the intratumoral route, trials were sequen tially initiated to study intracavitary instillation (initially intraperitoneal), intraarterial infusion (initially hepatic artery), and eventually intravenous administration. In addition, only patients with advanced and incurable cancers were initially enrolled on trials. Only after safety had been demonstrated in terminal cancer patients were trials initiated for patients with premalignant conditions. Finally, clinical trials of combinations with chemotherapy were initiated only after the safety of dllSlO as a single agent had been documented by the relevant route of administration. 3 4 0 David Kim IX. Results from Clinical Trials with d/1520 (Onyx-015orCI -1042) A. Toxicity No maximally tolerated dose or dose-limiting toxicities were identified at doses up to 2x10^^ particles administered by intratumoral injection. Flu like symptoms and injection-site pain were the most common associated toxicities [48]. This safety is remarkable given the daily or even twice-daily dosing that was repeated every 1-3 weeks in the head and neck region or pancreas [49]. Intraperitoneal, intraarterial, and intravenous administration were also remarkably well tolerated in general. Intraperitoneal administration was feasi ble at doses up to 10^^ particles divided over 5 days [50]. The most common toxicites included fever, abdominal pain, nausea/vomiting, and bowel motil ity changes (diarrhea, constipation). The severity of the symptoms appeared to correlate with tumor burden. Patients with heavy tumor burdens reached a maximally tolerated dose at 10^^ particles (dose-limiting toxicities were abdominal pain and diarrhea), whereas patients with a low tumor burden tolerated 10^^ without significant toxicity. No dose-limiting toxicities were reported following repeated intravascu lar injection at doses up to 2 x 10^^ particles (hepatic artery) [51] or 2 x 10^^ particles (intravenous) [52]. Fever, chills, and asthenia following intravascular injection were more common and more severe than after intratumoral injec tions (grade 2 - 3 fever and chills vs grade 1). Dose-related transaminitis was reported infrequently. The transaminitis was typically transient (<10 days) and low-grade (grade 1-2) and was not clinically relevant. Further dose escalation was limited by supply of the virus. B. Viral Replication Viral replication was documented at early time points after intratumoral injection in head and neck cancer patients [49, 53]. Roughly 70% of patients had evidence of replication on days 1-3 after their last treatment (Table II). In contrast, day 14-17 samples were uniformly negative. Patients with injected pancreatic tumors, in contrast, showed no evidence of viral replication by plasma PCR (indirect evidence) or fine-needle aspiration. Similarly, intraperi toneal dllSlO could not be shown to reproducibly infect ovarian carcinoma cells within the peritoneum. Therefore, different tumor types can vary dramat ically in their permissiveness for viral infection and replication (Table II). Proof-of-concept for tumor infection following intraarterial [51] or intra venous [52] administration with human adenovirus has also been achieved. Approximately half of the roughly 25 patients receiving hepatic artery infusions c vH O C! o o bJD o o o ^ ^ O o o O _fi - - - vx) ^-^ ON oh^- or o^ ON rsl (N ^ \o 'o ON rH oo -̂' o ^ o —~ -̂̂ bJD ^ ON O o ^ O O " ^ Z o o 1 —̂1 O ^ P O -T3 O CD c Q 13 O x' ^2 nJ (>U (L) 3 > o ^:i> u oo ^ O ^ OJ OH ^ oo c " d _> o '35 oo c:i r o Q Q ^r n oCî •A ?^ Q 0) Q. O ^ o o t \ uo — O ^^ -^ o s I c^ "Ĵ -^ r-. ^ ^ lO (N O o ro O K £ I I o 3 n3 ^ o O H £ 0) UO <!-> !/5 = o*J o O IJ O <u O 00 ro O iW r̂ " ^ ^ (L) C -T3 3 0 3 T 3 - c/5 J ^ 'bi) ^ 'bJD ^ o cs o ( ^ -̂ "bJD ^ " •S >̂ ^ Lo O o ^ X X rsl 'o O I I 1 00 X O "o O ^ 2 c Q ^ o X 0) o 1 u (U CT3 t-l .sC/3 ^ o 0 B c r ^ n c _c ^ "o H OS 2 'o (/3 (/3 B C3 OS ,0 o 0> O o 1C3U >̂,̂̂ u "5- C O CT3 0 .'u2 • M V-l ^ -I > OS 341 3 4 2 David Kim of 2 X 10^^ particles were positive by PCR 3-5 following treatment. Since input virus genomes are cleared to undetectable levels within 6-12 h, these late recurrent peaks of viral genomes are highly suggestive of viral replication and shedding into the blood. Three of four patients with metastatic carcinoma to the lung treated intravenously with >2 x 10^^ particles were positive for genomes in the blood on day 3 (±1). Therefore, it appears to be feasible to infect distant tumor nodules following intravenous or intra-arterial administration. C. Immune Response Neutralizing antibody titers to the coat (Ad5) of J/1520 were positive but relatively low in roughly 50-60% of all clinical trial patients at baseline [49]. Antibody titers increased uniformly following administration of J/1520 by any of the routes tested, in some cases to levels > 1:80,000. Antibody increases occurred regardless of evidence for replication or shedding into the blood stream [49]. Acute inflammatory cytokine levels were determined prior to treatment (by hepatic artery infusion), 3 h posttreatment and 18 h posttreat- ment: IL-1, IL-6, IL-10, interferon-gamma, tumor necrosis factor. Significant increases were demonstrated within 3 h for IL-1, IL-6, tumor necrosis fac tor, and to a lesser extent interferon-gamma; all cytokines were back down to pretreatment levels by 18 h [54]. In contrast, IL-10 did not increase until 18 h. However, cytokine levels varied greatly from patient to patient and from treatment cycle to treatment cycle. D. Efficacy with cf/1520 (Onyx-Ol 5) as a Single Agent Two Phase II trials enrolled a total of 40 patients with recurrent head and neck cancer [49, 53]. Tumors were treated very aggressively with 6-8 daily needle passes for 5 consecutive days (30-40 needle passes per 5-day cycle; n = 30) and 10-15 per day on a second trial (50-75 needle passes per cycle; n = 10). The median tumor volume on these studies was approximately 25 cm^; an average^ cm^of tumor therefore received an estimated 4 - 5 nee dle passes per cycle. With this dose-intensive local treatment regimen, the unconfirmed response rate at the injected site was 14% and the confirmed local response rate was 7%. Interestingly, there was no correlation between evidence of antitumoral activity and neutralizing antibody levels at baseline or posttreatment [49]. No objective responses were demonstrated in patients with tumor types that could not be so aggressively injected (due to their deep locations), although some
evidence of shrinkage or necrosis was obtained. In summary, single agent responses across all studies were uncommon, and therefore combinations with chemotherapy were explored. E. Efficacy in Combination with Chemotherapy: Potential Synergy Discovered Evidence for a potentially synergistic interaction between adenoviral therapy and chemotherapy has been obtained on multiple trials. Encouraging 1 1 . Replication-Selective Oncolytic Adenovirus E1 -Region Mutants 3 4 3 clinical data has been obtained in patients with recurrent head and neck cancer treated with intratumoral J/1520 in combination with intravenous cispaltin and 5-fluorouracil [55]. Thirty-seven patients were treated and 19 responded (54%, intent-to-treat; 63%, evaluable); this compares favorably with response rates to chemotherapy alone in previous trials (30-40%, generally). The time-to-tumor progression was also superior to previously reported studies. However, comparisons to historical controls are unreliable. We therefore used patients as their own controls whenever possible (n = 11 patients). Patients with more than one tumor mass had a single tumor injected with dll520 while the other mass(es) was left uninjected. Since both masses were exposed to chemotherapy, the effect of the addition of viral therapy to chemotherapy could be assessed. The J/1520-injected tumors were significantly more likely to respond (? = 0.017) and less likely to progress (P = 0.06) than were nonin- jected tumors. Noninjected control tumors that progressed on chemotherapy alone were subsequently treated with Onyx-015 in some cases; two of the four injected tumors underwent complete regressions. This data illustrates the potential of viral and chemotherapy combinations. The clinical utility of J/1520 in this indication will be definitively determined in a phase III randomized trial. A phase I/II trial of J/1520 administered by hepatic artery infusion in combination with intravenous 5-fluorouracil and leukovorin was carried out {n = 33 total) [54]. Following phase I dose escalation, 15 patients with colorec tal carcinoma who had previously failed the same chemotherapy were treated with combination therapy after failing approximately to respond to J/1520 alone; 1 patient underwent a partial response (following initial progression on virus alone) and 10 had stable disease (2-7+ months). Combination virus plus chemotherapy-induced responses in colorectal liver metastases was therefore possible via hepatic artery infusions, although the magnitude and frequency of this effect remains to be determined. In addition, the optimal combination regimen has not yet been defined. In contrast, data from a phase I/II trial studying the combination of J/1520 and gemcitabine chemotherapy were dis appointing (n = 21); the combination resulted in only two responses, and these patients had not received prior gemcitabine [56]. Therefore, potential synergy was demonstrated with J/1520 and chemotherapy in two tumor types that supported presumed viral replication (head and neck, colorectal), but not in a tumor type that was apparently resistant to viral replication (pancreatic). X. Clinical Trial Results with c/f1520 (Onyx-015): Summary J/1520 was well-tolerated at the highest practical doses that could be administered (2 x 10^^-2 x 10^^ particles) by intratumoral, intraperitoneal, intraarterial, and intravenous routes. The lack of clinically significant toxicity in the liver or other organs was notable. Flu-like symptoms (fever, rigors. 3 4 4 David Kirn asthenia) were the most common toxicities and were increased in patients receiving intravascular treatment. Acute inflammatory cytokines (especially IL-1 and IL-6) increased within 3 h following intraarterial infusion, although these changes were extremely variable. Neutralizing antibodies increased in all patients, regardless of dose, route, or tumor type. Viral replication was documented directly (by biopsy) or indirectly (by delayed viral genome peaks in blood) in head and neck and colorectal tumors following intratumoral or intraarterial administration. Neutralizing antibodies did not block antitumoral activity in head and neck cancer trials of intratumoral injection. Single agent antitumoral activity was minimal (=15%) in head and neck cancers that could be repeatedly injected. No objective responses were documented with single agent therapy in phase I or I/II trials in patients with pancreatic, colorectal, or ovarian carcinomas. A favorable and potentially synergistic interaction with chemotherapy was discovered in some tumor types and by different routes of administration. XI . Future Directions: Why Has c//1520 (Onyx-015) Failed to Date as a Single Agent? Future improvements with this approach will be possible if the reasons for J/1520 failure as a single agent, and success in combination with chemotherapy, are elucidated. Factors that are specific to this particular adenoviral mutant, as well as factors that are generalizable to other adenoviruses, should be considered. Regarding this particular ElB 55-kDa gene mutant, it is important to remember that this virus is significantly attenuated relative to wild-type adenovirus in most tumor cell lines in vitro and in vivo, including even p53 mutant tumors [31, 39, 40, 43, 57]. This is an expected finding since this virus does not have critical ElB 55-kDa functions that are unrelated to p53, including viral mRNA transport and shut-off of host protein synthesis. This attenuated potency is not apparent with the adenovirus mutant J/922/947 [31]. The deletion in the E3 gene region of genes for the 10.4/14.5 complex is likely to make this virus more sensitive to the antiviral effects of tumor necrosis factor; an immunocompetent animal model will need to be identified in order to resolve this issue. Factors likely to be important for any adenovirus include barriers to intratumoral spread (e.g., fibrosis), antiviral immune responses and inadequate viral receptor expression (e.g., CAR, integrins). Viral coat modifications may be beneficial if inadequate CAR expression plays a role in the resistance of particular tumor types [58, 59]. 1 1 . Replication-Selective Oncolytic Adenovirus El-Region Mutants 3 4 5 XII . Improving the Efficacy of Replication-Selective Oncolytic Adenoviral Agents Alterations within the adenoviral genome can be used to enhance selectiv ity and/or potency. The promising adenoviral ElA CR-2 mutant (dl922/947) has been described that demonstrates not only tumor selectivity (based on the Gl-S checkpoint status of the cell) but also significantly greater antitumoral efficacy in vivo compared to dllSlO (all models tested) and even w^ild-type adenovirus (in a breast cancer metastasis model) [26]. A very similar ElA CR-2 mutant adenovirus has demonstrated replication and cytopathic effects based on the pRB status of the target cell, in addition to encouraging in vivo antitumoral efficacy [32]. Deletion of the ElB 19-kDa gene (antiapoptotic bcl-2 homolog) is knov^n to result in a "large plaque" phenotype due to enhanced speed of cell killing [60]. This observation has now^ been extended to multiple tumor cell lines and primary tumor cell cultures [61, 62]. A sim ilar phenotype resulted from overexpression of the E3 11.6-kDa adenovirus death protein [63]. It remains to be seen vs^hether these in vitro observa tions are foUow êd by evidence for improved efficacy in vivo over w^ild-type adenovirus. "Arming" viruses w îth therapeutic genes can also result in improved potency (e.g., prodrug-activating enzymes and cytokines) [64-67]. Prodrug- activating enzyme conversion of nontoxic prodrugs to active cytotoxic agents w^ithin the tumor is an attractive strategy that has been pursued; how^ever, this approach may result in virus inactivation and decreased viral oncolysis, in addition to beneficial "bystander effects." Viral coat modifications may be ben eficial if inadequate CAR expression plays a role in the resistance of particular tumor types [58, 59]. Improved systemic delivery may require novel formu lations or coat modifications, as v^ell as suppression of the humoral immune response. Determination of the viral genes (e.g., E3 region) and immune response parameters mediating efficacy and toxicity w îll lead to immunomod ulatory strategies. Finally, identification of the mechanisms leading to the potential synergy betw^een replicating adenoviral therapy and chemotherapy may allov\̂ augmentation of this interaction [68]. XIIL Summary Replication-selective oncolytic adenoviruses represent a novel cancer treatment platform. Clinical studies w îth J/1520 and now^ other viruses have demonstrated the safety and feasibility of this approach, including the delivery of adenovirus to tumors through the bloodstream [5, 51, 69]. The discovery of 3 4 6 David Kirn the inherent capacity of repHcation-competent adenoviruses to sensitize tumor cells to chemotherapy led to chemosensitization strategies. Clinical research is anticipated with novel adenoviral agents, including constructs expressing exogenous therapeutic genes to enhance both local and systemic antitumoral activity [8, 64, 70]. In addition to adenovirus, other viral species are being developed, including herpesvirus, vaccinia, reovirus and measles virus [1, 17, 27, 71-75]. Since intratumoral spread also appears to be a substantial hurdle for viral agents, inherently motile agents such as bacteria may hold great promise for this field [76^ 77]. Although data from in vitro cell-based assays and murine tumor model systems will be important for testing and generating hypotheses, it is vital that encouraging adenoviral agents are tested in well- designed clinical trials as soon as possible. Data from clinical trials must be used to guide future laboratory approaches, as well as the converse. This "iterative loop" between laboratory and clinic may result in major cancer treatment advances. Acknov^ledgments The following individuals have been instrumental in making this chapter possible: John Nemunaitis, Stan Kaye, Tony Reid, Fadlo Khuri, James Abruzzesse, Eva Galanis, Joseph Rubin, Antonio Grillo-Lopez, Carla Heise, Larry Romel, Chris Maack, Sherry Toney, Nick LeMoine, Britta Randlev, Patrick Trown, Fran Kahane, Frank McCormick, and Margaret Uprichard. References 1. Kirn, D. (2000a)./. Clin. Invest. 105, 836-838. 2. Wold, W. S., Hermiston, T. W., and Tollefson, A. E. (1994). Trends Microbiol. 2, 437-443. 3. Sparer, T. E., Tripp, R. A., Dillehay, D. L., Hermiston, T. W., Wold, W. S., and Gooding, L. R. (1996)./. Virol. 70, 2431-2439. 4. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Henderson, D. R. (1997). Cancer Res. 57, 2559-2563. 5. Heise, C., Williams, A., Xue, S., Propst, M., and Kirn, D. (1999b). Cancer Res. 59,2623-2628. 6. Heise, C., Williams, A., Olesch, J., and Kirn, D. (1999a). Cancer Gene Ther. 6. 7. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996)./. Virol. 70, 6831-6838. 8. Heise, C , and Kirn, D. (2000)./. Clin. Invest. 105, 847-851. 9. Shenk, T. (1996). In "Fields Virology" (K. Howley, Ed.), pp. 2135-2137. Lippincott-Raven: Philadelphia. 10. Wold, W. S., Tollefson, A. E., and Hermiston, T. W. (1995). Curr. Top. Microbiol. Immunol. 199, 237-274. 11. Dimitrov, T., Krajcsi, P., Hermiston, T. W., Tollefson, A. E., Hannink, M., and Wold, W. S. (1997)./. Virol. 71,2830-2837. 12. Hermiston, T. W., Tripp, R. A., Sparer, T., Gooding, L. R., and Wold, W. S. (1993). / . Virol. 67, 5289-5298. 1 1 . Replication-Selective Oncolytic Adenovirus E1 -Region Mutants 3 4 7 13. Shisler, J., Duerksen, H. P., Hermiston, T. M., Wold, W. S., and Gooding, L. R. (1996). / . Virol. 70, 68-77. 14. Tollefson, A. E., Ryerse, J. S., Scaria, A., Hermiston, T. W., and Wold, W. S. (1996). Virology 220, 152-62. 15. Gooding, L. R. (1994). Infect. Agents Dis. 3, 106-115. 16. Toda, M., Rabkin, S., Kojima, H., and Martuza, R. (1999). Hum. Gene Ther. 10, 385-393. 17. Martuza, R. (2000)./. Clin. Invest. 105, 841-846. 18. Whyte, P., Ruley, H., and Harlow, E. (1988). / . Virol. 62, 257-265. 19. Yu, D., Sakamoto, G., and Henderson, D. R. (1999). Cancer Res. 59, 1498-1504. 20. Hallenbeck, P. Chang, Y., Hay, C., Phipps, S., and Chiang, Y. (1999). Hum. Gene Ther. 10(10), 1721-1733. 21. Kurihara, T., Brough, D. E., Kovesdi, I., and Kufe, D. W. (2000). / . Clin. Invest. 106, 763-771. 22. Barker, D. D., and Berk, A. J. (1987). Virology 156, 107-121. 23. Nielsch, U., Fognani, C , and Babiss, L. E. (1991). Oncogene 6, 1031-1036. 24. Sherr, C. J. (1996). Science 274, 1672-1677. 25. Olson, D. C , and Levine, A. J. (1994). Cell Growth Differ, 5, 61 -71 . 26. Kirn, D., Heise, C , Williams, M., Propst, M., and Hermiston, T. (1998a). "Cancer Gene Therapy" Sobol (Ed.). San Diego. 27. Martuza, R. L., Malick, A., Markert, J. M., Ruffner, K. L., and Coen, D. M. (1991). Science ISl, 854-856. 28. Mineta, T., Rabkin, S. D., Yazaki, T., Hunter, W. D., and Martuza, R. L. (1995). Nat. Med. 1, 938-943. 29. Whyte, P., Williamson, N., and Harlow, E. (1989). Cell 56, 67-75 . 30. Hu, Q. J., Dyson, N. and Harlow, E. (1990). EMBO J. 9, 1147-1155. 31. Heise, C , Hermiston, T., Johnson, L., Brooks, G., Sampson-Johannes, A., Williams, A., Hawkins, L., and Kirn, D. (2000a). Nat. Med. 6, 1134-1139. 32. Fueyo, J., Gomez-Manzano, C , Alemany, R., Lee, P., McDonnell, T., Mitlianga, P., Shi,
Y., Levin, V., Yung, W., and Kyritsis, A. (2000). Oncogene 19, 2 -12 . 33. Scheffner, M., Munger, K., Byrne, J. C , and Howley, P. M. (1991). Proc. Natl. Acad. Set. USA 88, 5523-5527. 34. Zhang, Y., Xiong, Y., and Yarbrough, W. G. (1998). Cell 92, 725-734. 35. Hollstein, M., Sidransky, D., Vogelstein, B., and Harris, C. C. (1991). Science 253, 49 -53 . 36. Dobner, T., Horikoshi, N., Rubenwolf, S., and Shenk, T. (1996). Science 111, \A1^-\A11). 37. Yew, P. R., Liu, X., and Berk, A. J. (1994). Genes Dev., 8, 190-202. 38. Bischoff, J. R., Kirn, D. H., Williams, A., Heise, C , Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick, F. (1996). Science 274, 373-376. 39. Rogulski, K., Freytag, S., Zhang, K., Gilbert, J., PaieUi, D., Kim, J., Heise, C , and Kirn, D. H. (2000). Cancer Res. 60, 1193-1196. 40. Rothmann, T., Hengstermann, A., Whitaker, N. J., Scheffner, M., and zur Hansen, H. (1998). / . Virol. 72, 9470-9478. 41. Ries, S.J., Brandts, C. H., Chung, A. S., Biederer, C. H., Hann, B.C., Lipner, E. M., McCormick, F., and Michael Korn, W. (2000). Nat. Med. 6, 1128-1133. 42. Heise, C , Sampson, J. A., Williams, A., McCormick, F., Von, H. D., and Kirn, D. H. (1997a). Nat. Med. 3, 639-645. 43. Goodrum, F. D., and Ornelles, D. A. {1997). J. Virol. 71, 548-561. 44. Goodrum, F. D., and Ornelles, D. A. (1998). / . Virol. 72, 9479-9490. 45. Southam, C. M., and Moore, A. E. (1952). Cancer 5, 1025-1034. 46. Asada, T. (1974). Cancer 34, 1907-1928. 47. Smith, R., Huebner, R. J., Rowe, W. P., Schatten, W. E., and Thomas, L. B. (1956). Cancer 9, 1211-1218. 3 4 8 David Kirn 48. Ganly, I., Kirn, D., Eckhardt, S., Rodriguez, G., Souter, D., Von Hoff, D., and Kaye, S. (2000). Clin. Cancer Res. 6, 798-806. 49. Nemunaitis, J., Ganly, I., Khuri, F., Arsenau, J., Kuhn, J., McCarty, T., Landers, S., Maples, P., Romel, L., Randlev, B., Reid, T., Kaye, S., and Kirn, D. (2000b). Cancer Res. 60, 6359-6366. 50. Vasey, P., Shulman, L., Gore, M., Kirn, D., and Kaye, S. (2000). Proc. Am. Soc. Clin. Oncol. 51. Reid, A., Galanis, E., Abbruzzese, J., Romel, L., Rubin, J., and Kirn, D. (1999). "EORTC- NCI-AACR Meeting on Molecular Therapeutics of Cancer." 52. Nemunaitis, J., Cunningham, C , Randlev, B., and Kirn, D. (2000a). Proc. Am. Soc. Clin. Oncol. 19, 724 (abstract). 53. Nemunaitis, J., Khuri, F., Posner, M., Yokes, E., Romel, L., and Kirn, D. (2000c). Cancer Res. 60, (22), 6359-6366. 54. Reid, T., Galanis, E., Abbruzzese, J., Randlev, B., Romel, L., Rubin, J., and Kirn, D. (2000). Proc. Am. Soc. Clin. Oncol. 19, 953 (abstract). 55. Khuri, F., Nemunaitis, J., Ganly, I., Gore, M., MacDougal, M., Tannock, I., Kaye, S., Hong, W., and Kirn, D. (2000). Nat. Med. 56. Hecht, R., Abbruzzese, J., Bedford, R., Randlev, B., Romel, L., Lahodi, S. and Kirn, D. (2000). Proc. Am. Soc. Clin. Oncol. 19, 1039 (abstract). 57. Kirn, D., Hermiston, T., and McCormick, F. (1998b). Nat Med. 4, 1341-1342. 58. Roelvink, P., Mi, G., Einfeld, D., Kovesdi, L, and Wickham, T. (1999). Science 286, 1568-1571. 59. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel, D. T. (1996). Nat. Biotechnol. 14, 1574-1578. 60. Chinnadurai, G. (1983). Cell 33, 759-766. 61. Sauthoff, H., Heitner, S., Rom, W., and Hay, J. (2000). Hum. Gene Ther. 11, 379-388. 62. Medina, D. J., Sheay, W., Goodell, L., Kidd, P., White, E., Rabson, A. B., and Strair, R. K. (1999). Blood 94, 3499-3508. 63. Doronin, K., Toth, K., Kuppuswamy, M., Ward, P., Tollefson, A., and Wold, W. (2000). / . Virol. 74, 6147-6155. 64. Hermiston, T. (2000)./. Clin. Invest. 105, 1169-1172. 65. Hawkins, L., Nye, J., Castro, D., Johnson, L., Kirn, D., and Hermiston, T. (1999). Proc. Am. Assoc. Cancer Res. 40, 476. 66. Freytag, S. O., Rogulski, K. R., Paielh, D. L., Gilbert, J. D., and Kim, J. H. (1998). Hum. Gene Ther. 9, 1323-1333. 67. Wildner, O., Blaese, R. M., and Morris, J. M. (1999). Cancer Res. 59, 410-413. 68. Heise, C , Lemmon, M., and Kirn, D. (2000b). Clin. Cancer Res. 69. Nemunaitis, J., Cunningham, C , Buchaman, A., Randier, B., Olson, S., and Kirn, D. (2001). Gene Ther. 8 (10), 746-759. 70. Agha-Mohammadi, S., and Lotze, M. (2000)./. Clin. Invest. 105, 1173-1176. 71. Norman, K., and Lee, P. (2000)./. Clin. Invest. 105, 1035-1038. 72. Mastrangelo, M., Eisenlohr, L., Gomella, L., and Lattime, E. (2000). / . Clin. Invest. 105, 1031-1034. 73. Coffey, M., Strong, J., Forsyth, P., and Lee, P. (1998). Science 282, 1332-1334. 74. Kirn, D. (2000b). Gene Ther. 7, 815-816. 75. Lattime, E. C , Lee, S. S., Eisenlohr, L. C , and Mastrangelo, M. J. (1996). Semin. Oncol. 23, 88-100. 76. Low, K., Ittensohn, M., Le, T., Piatt, J., Sodi, S., Amoss, M., Ash, O., Carmichael, E., Chakraborty, A., Fischer, J., Lin, S., Luo, X., Miller, S., Zheng, L., King, I., Pawelek, J., and Bermudes, D. (1999). Nat. Biotechnol. 17, 37 -41 . 77. Sznol, M., Lin, S., Bermudes, D., Zheng, L., and King, I. (2000). / . Clin. Invest. 105, 1027-1030. 78. Heise, C , Sampson-Johannes, A., WiUiams, A., McCormick, F., Von Hoff, D. D. and Kirn, D. H. (1997b). Nat. Med. 3, 639-645. C H A P T E R Innate Immune Responses to in Vivo Adenovirus Infection Bruce C. Trapnell and Thomas P. Shanley Divisions of Pulmonary Biology and Critical Care Medicine Children's Hospital Medical Center Cincinnati, Ohio I. Overviev^: Components of Innate immunity Innate immunity is the first line of defense against infections. The phylo- genetically ancient, phagocyte-based effector mechanisms of innate immunity exist in their mature state prior to microbial exposure and infection does not alter the intrinsic specificity of the system components. This is in sharp contrast to the more recently evolved mechanisms of adaptive immunity in v^hich the microbial encounter leads to gene rearrangements that alter the intrinsic prop erties of the system components, e.g., following infection, microbe-stimulated antibody gene rearrangements lead to production of antibodies of greater affin ity for the microbe. Mechanisms of innate immunity are either constitutively active or are activated very rapidly after infection (prior to development of adaptive immune responses) and serve three very important functions. First, as the initial host response, innate defenses limit or prevent infection by rapidly eliminating microbes (clearance). Second, the effector components of innate immunity interact and v^ork together with components of adaptive immunity to synergistically augment microbial clearance. Third, innate immunity stimu lates and can reprogram adaptive immune mechanisms to optimize clearance of specific types of microbes. Although viral clearance has been traditionally thought to be due to lymphocyte-mediated clearance of infected cells, recent data have demonstrated the important role for phagocyte-mediated clearance of recombinant, replication-deficient adenoviral vectors administered to the lung and systemic circulation. In this chapter we will review data regarding the interaction between adenovirus and host innate immune mechanisms and discuss the implications for use of recombinant adenoviral vectors for in vivo ADENOVIRAL VECTORS FOR GENE THERAPY 3 4 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 3 5 0 Trapnell and Shanley gene transfer. The discussion will be focused on pulmonary innate immune responses because much of our information comes from preclinical and clin ical studies done in an effort to an develop adenoviral vector-based in vivo gene therapy for the clinical manifestations of cystic fibrosis lung disease. A brief review of innate immunity is useful prior to discussing data related to adenovirus. Components of the innate immune system are found, presumably, in all Mesozoic organisms in contrast to adaptive immunity which is present only in cartilaginous and bony fish, amphibians, reptiles, birds, and mammals. Coevolution during the 400 million years since appearance of lymphocyte- based adaptive immunity accounts for the close interconnection between innate and adaptive immune mechanisms. Innate immunity is composed of a set of constitutive and inducible components including physical and biochemical barriers, circulating or mobile effector cells and proteins, and proinflammatory and chemotactic cytokines (Table I). The principal effector components of innate immunity involved in clearance of microbes during in vivo infection include phagocytic and natural killer (NK) cells, cytokines, and complement. Phagocytic cells are the primary effectors of microbial clearance in vivo and consist of tissue macrophages and circulating monocytes and neutrophils. Tissue macrophages are derived from circulating monocytes that enter the various organs and differentiate into morphologically, histochemically and functionally distinct phagocyte populations [1, 2]. Macrophages, which are normally resident in tissues and phagocytically competent prior to infection, provide a constitutive mechanism for primary clearance of microbes in tissues and organs. Neutrophils, normally abundant in blood and also phagocytically competent prior to infection, are not normally present in tissues but are recruited in response to localized release or generation of chemotactic factors at the site of infection. Thus, neutrophils provide a potent, inducible mechanism for secondary clearance of microbes in tissues and organs. Both macrophages and neutrophils are capable of internalizing and destroying a variety of microbial pathogens and secrete a number of potent inflammatory mediators in response to infection. NK cells normally constitute 5 to 20% of the blood mononuclear cells and are primarily involved in clearance of viruses and some other intracellular pathogens. NK cells are activated and lyse virally infected host cells by three incompletely understood mechanisms: (1) binding to microbe-specific antibody molecules attached to infected host cells, (2) binding to adhesion molecules whose expression is upregulated on infected host cells, and (3) binding by an unknown mechanism to host cells lacking class I major histocompatibility complex (MHC) molecules (reviewed in 13]). Cytokines constitute a group of soluble protein components of innate immunity that serve critical proinflammatory and chemoattractive functions (reviewed in [4]). These functions include augmentation of inflammation (e.g., by TNFot, interleukin (IL)-l), induction of resistance to viral infection within 12. Innate Immune Responses to in Vivo Adenovirus Infection 351 Table I Components of Innate Immunity In the Lung Class Type Effector Principal function Presence Barriers Physical Epithelium Block microbe entry Constitutive Ciliary escalator Eject trapped Constitutive microbe Glycocalyx Trap microbe Constitutive Biochemical Mucin Trap microbe Constitutive and inducible Soluble Defensins Multiple Killing of microbe Constitutive and proteins inducible Proteases Lysozyme, Killing of microbe Constitutive and lactoferrin, inducible elastase metalloproteases Collectins Surfactant protein A Opsonization of Constitutive (SP-A), SP-D, microbe and mannose binding activation of protem complement Complement Multiple Killing of microbe Constitutive and opsonization of microbe and leukocyte activation Pentraxins C-reactive protein Opsonization of Constitutive and microbe and inducible activation of complement Coagulation Multiple Sequester microbe Constitutive factors Cytokines TNFa, IL-1 Inflammation Inducible IFNa/p Resistance to viral Inducible infection IFNy Macrophage Inducible activation T H I / T H 2 cell development IL-12/IL18 IFN production by Inducible NK cells IL-15 NK cell proliferation Inducible IL-10/TGF^ Modulation of Inducible inflammation IL8, MIP-2 Neutrophil Inducible recruitment MCP-1 Monocyte Inducible recruitment (continued) 352 Trapnell and Shanley Table 1 {continued) Class Type Effector Principal function Presence Cells Phagocytes Tissue macrophages Primary microbe Constitutive and clearance and inducible inflammatory signaling Neutrophils Secondary microbe Inducible clearance and inflammatory signaling NK cells Lysis of infected Constitutive cells and activation of macrophages Cell surface Pattern Mannose receptor, Phagocytosis of Constitutive receptors recognition LBP/CD14, Toll microbe receptors homologs inflammatory signaling Scavenger receptors Phagocytosis of Constitutive microbe Other cells (e.g., by IFNa, IFNP), macrophage activation (e.g., by IFNy), neutrophil recruitment and activation (e.g., by IL-8, macrophage inflamma tory protein (MIP)-2), monocyte recruitment (e.g., by MCP-1), stimulation of NK cell-mediated clearance (IL-12, IL-18), stimulation of adaptive immunity (TNFa, IL-2, IL-12, IL-18, others), and suppression of acute inflammation (e.g., by IL-10, TGFp) (Table I). These and other cytokines elicited during in vivo microbial infection, together, form part of the complex and functionally overlapping molecular netw^ork of intercellular communications that orches trate the ensuing inflammatory cascade and immune events. In so doing, these cytokines augment innate immune microbial clearance by activating resident phagocytes and by recruiting and activating other phagocytes and augment adaptive immune clearance by influencing the nature and strength of specific immune responses. Complement (C) is a component of innate immunity composed of several soluble proteins capable of recognizing microbes, stimulating inflammation and augmenting microbial clearance. The complement system can be activated in three ways: (1) direct recognition of
certain microbial surface structures (e.g., via the alternative pathway, a phylogenetically older system); (2) recognition of microbe-bound antibody by a complement component called Clq (e.g., via the classic pathway); and (3) direct cleavage of C3 by a protease associated with complexes of collectins bound to microbes (see below). Subsequent to 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 5 3 recognition, complement activation can neutralize viruses and other microbes by several mechanisms, including direct killing by microbial membrane per foration, agglutination of the microbes v^ith a net loss in infectivity, and opsonization resulting in clearance by C3-receptor-bearing phagocytes. Acti vation of each of these three pathw^ays (classical, alternative, and collectin) has been demonstrated in response to viral infection. The soluble protein effector component of innate immunity also includes a heterogeneous collection of other members that serve opsonic and lytic roles in microbial clearance. Collectins are one such group present in blood and in tissues v^hose family members include conglutinin, mannose-binding protein (MBP), and the surfactant proteins A (SP-A) and D (SP-D) [5]. Members of this family share a common basic structure consisting of collagen-like and lectin domains separated by a short neck region. The lectin moiety binds to microbial surface carbohydrates in a calcium-dependent manner and thus, collectins share both structural and functional homology v^ith Clq. Although surfactant proteins found in the lung (SP-A, SP-B, SP-C, SP-D) v^ere initially regarded as functioning to maintain alveolar structural integrity and patency, emerging data has defined an important role for SP-A and SPD in innate immune mechanisms of lung host defense against bacterial and viral pathogens. Other soluble protein effectors include defensins (a family of proteins with bacteriocidal properties secreted from neutrophils and epithelial cells) lysozyme, elastase, cathepsin G, phospholipase A2, lactoferrin, and transferrin. At present, the potential role of these molecules in viral infection is not particularly clear. Finally, natural antibodies, w^hich are constitutively expressed in the absence of microbial infection, recognize and bind components of the microbial surface and serve as opsonins and can activate complement. Natural antibodies are of fixed specificity because they are expressed from germline genes v^hich do not undergo genetic rearrangements subsequent to microbial infection. Examples include antibodies directed against blood group antigens and those that recognize species-specific cell surface carbohydrate structures. Natural antibodies directed at species-specific murine cell surface carbohydrates present on retroviral vectors derived from murine producer cells are largely responsible for the rapid, complement-mediated lysis of these vectors by human serum. Alveolar macrophages (AMs) play a central role in lung host defense by providing a critical primary barrier to microbial infection mediated by both intrinsic and extrinsic pathv^ays of resistance [6, 7]. Intrinsic resistance mech anisms, which lie completely within the realm of innate immunity, include the ability of macrophages to internalize, degrade, and thus restrict the replica tion of microbial pathogens. Extrinsic resistance mechanisms include release of cytokine mediators that recruit and activate other inflammatory cells (e.g., neutrophils, NK cells) or stimulate antiviral resistance in neighboring cells (e.g., IFNa/IFNp). Both of these mechanisms are also clearly components of innate 3 5 4 Trapnell and Shanley immunity. Extrinsic resistance pathways also include mechanisms by which innate immunity reprograms adaptive immune responses to alter the nature or strength of microbe-specific responses (e.g., cytokines that modulate THI/TH2 development and the balance of cellular and humoral immune responses. How ever, while macrophages help to provide a barrier against infection by some viruses (e.g., vesicular stomatitis, encephalomyocarditis virus and influenza virus), with other viruses (e.g., human immunodeficiency virus) they do not provide a barrier but instead serve as a reservoir of latent infection and facili tate recrudescent disease. Recent data from preclinical and clinical studies with replication-deficient recombinant adenoviral vectors in humans and various animal models strongly support the notion that alveolar macrophages provide a critical innate immune barrier to infection by adenovirus. These data will constitute the focus of the remainder of this chapter. II. Distribution and Clearance of Adenovirus from the Respiratory Tract A. Clinical Aspects of Natural Adenoviral Infection in Humans Adenovirus is an important respiratory pathogen affecting individuals of all ages with an annual incidence of between 5 to 10 million in the United States. Infections can occur sporadically, epidemically and nosocomially but most individuals are infected at a young age; adenovirus accounts for 7 to 10% of all respiratory illnesses in infants and children [8, 9]. Although adenovirus frequently causes a mild, acute upper respiratory illness, e.g., the "common cold," respiratory infections occur as a broad spectrum of distinct clinical syndromes ranging from self-limited acute pharyngitis to fatal pneumonia [10-12]. Adenovirus has also been identified an etiological factor of exacerbations in individuals with chronic obstructive lung diseases and infections can be especially problematic in immunocompromised individuals. Examples of the latter include persistent bladder infections in individuals with chemotherapy-induced neutropenia, fatal pneumonia in neonates, and exacerbation of graft rejection and bronchiolitis obliterans in lung transplant recipients [13, 14]. Natural adenovirus infections are typically initiated by deposition of aerosol droplets containing adenovirus on the mucosal surface of the respira tory epithelium [15]. Some virions then diffuse to the cell surface and enter by receptor-mediated endocytosis. Once inside the cell nucleus, wild-type (replica tion competent) adenovirus DNA overtakes, reprograms, and eventually kills the infected cell ultimately releasing up to 10,000 virions per infected cell. Newly replicated and released virions then infect neighboring cells, repeating the process and thus spreading the infection through the epithelial sheet. The 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 5 5 ensuing clinical course is determined by the race between virus replication and spread and the successful mounting of host innate and adaptive immune responses. B. Distribution of Recombinant, Replication-Deficient Adenoviral Vectors In considering infection of the respiratory tract by recombinant ade noviruses, it is important to recognize tw ô important and fundamental differences from natural infections by v^ild-type adenovirus. First, recom binant human adenoviral vectors used to date for in vivo gene transfer have generally been deleted of El region sequences and are thus relatively replication- deficient in human cells (review^ed in [16, 17]). Further, in mice and primates, tw ô species most commonly used in preclinical gene therapy studies, human adenoviral vectors have a species-related host range restriction that prevents viral replication [15]. These restrictions on viral replication, however, do not affect the infection of a given cell by the vector, i.e., virion internalization and transgene expression proceed normally. Second, and very importantly, there is an enormous difference in the size of the infecting inoculum of adenovirus in the two scenarios. A typical natural infection is thought be caused by less than 1000 adenovirus virions. In contrast, human trials have been conducted in which the virus dose administered was up to one billion times higher (~10^^ virions/individual). Studies in rodent models utilizing transtracheal, liquid bolus administra tion of adenovirus demonstrated that: (1) gene transfer to and expression in airway epithelium was dependent on the dose of virus administered; (2) all cell types could be infected; and (3) gene transfer occurred throughout the bronchial tree but was patchy [18, 19]. Studies in nonhuman primates uti lizing bronchoscopic or aerosol delivery also demonstrated gene transfer but confirmed the overall inefficiency of gene transfer [20-23]. Finally, both direct liquid-based or aerosol-based vector administration in humans also demon strated only low level infection and transduction of the respiratory epithelium. In vitro studies demonstrated, unexpectedly, that while intact airway epithe lium was poorly transduced, damaged epithelium, immature epithelial cells, or differentiating airway epithelium were all easily transduced. These findings were reconciled by studies utilizing a bronchial epithelial cell xenograft model which demonstrated that integrin aj;P5, a coreceptor required for adenoviral virion internalization, was not expressed on the apical membrane of mature airway epithelium and was expressed only on the basolateral surface of the cell [24]. In the context that physical access to the basolateral membrane of epithelial cells of intact epithelium is restricted by tight junctions which connect adjacent airway epithelial cells just below the apical (luminal) surface [25], this data provided early insight into one mechanism by which airway epithilium 3 5 6 Trapnell and Shanley present an innate immune barrier to adenovirus infection. The apical mem brane surface glycocalyx represents another barrier [26]. Evaluation of various organs of cotton rats or monkeys following intrapulmonary adenovirus vector administration using a sensitive polymerase chain reaction technique demon strated that vector does not escape from the lung [21, 27]. Recently, studies in rodents have shown that a large portion of adenovirus administered to the res piratory tract is distributed to alveolar macrophages rapidly after pulmonary administration (see below). C. Kinetics and Mechanisms of Clearance of Adenovirus The initial report of adenovirus-mediated, in vivo transfer of CFTR to the lungs of cotton rats demonstrated the presence of adenoviral vector DNA in the lung as late as 6 weeks after vector administration [28]. Subsequent studies car ried out in various rodent models, nonhuman primates, and humans, however, have demonstrated that most of the adenoviral vector DNA initially adminis tered to the respiratory tract is eliminated from the lung within several weeks in the context of an intact immune system (reviewed in [29]). Data showing that adenovirus-mediated pulmonary transgene expression in athymic mice lasted for more than 3 months implicated the cell-mediated adaptive immunity in pulmonary clearance of adenovirus [30]. This conclusion was supported by the demonstration of prolonged transgene expression in mice depleted of CD4+ cells. The mechanism of this T lymphocyte-mediated clearance was shown to be direct lysis of adenovirus vector-transduced cells by cytotoxic lymphocytes (CTLs) directed at both adenoviral- and transgene-derived proteins. Adaptive immune CTL-mediated clearance is a delayed mechanism because CTL are detected only after several days and are most abundant for 7 to 14 days after infection. The importance of innate immunity in clearance of adenovirus from the lung was first demonstrated by the finding that ^ 7 0 % of the adenoviral DNA present immediately after pulmonary administration in mice was eliminated by degradation within 24 h [31] (Fig. 1). Since this "early phase" clearance was well before a significant adaptive immune response could have been mounted, an innate immune mechanism was sought. Similarity in the pattern of clearance in athymic and normal mice demonstrated independence from lymphocyte-based adaptive mechanisms and alveolar macrophages were pos tulated to be the mechanism of this early clearance. Several findings support this hypothesis. First, in vitro studies demonstrated that infection of human, rat, and murine alveolar macrophages led to loss of approximately two-thirds of the viral DNA within 24 h, whereas similar infection of epithelial cells resulted in no significant loss of viral DNA. Second, pretreatment of the lungs with clodronate-laden liposomes to deplete phagocytic cells significantly impaired the rapid clearance of adenovirus. However, because rapid and significant neu trophil influx occurs during the first 24 h of infection [32], thus overlapping 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 5 7 Acute Intermediate 8 12 16 20 24 28 Time after infection (days) Figure 1 Clearance of viral DNA after adenovirus infection of the respiratory tract. Adenoviral vector DNA is cleared from the lung in a biphasic pattern. Most adenoviral DNA is cleared from the lung very early over the first 24 h after lung infection. The remainder is cleared more slowly over the following several weeks. Clearance during the acute phase is due to internalization and degradation within phagocytes, mostly resident alveolar macrophages (primary clearance). Clearance during the intermediate phase is probably mostly due to recruitment and activation of innate immune NK cells. Clearance during the late phase is principally mediated by the cytotoxic T-cell response. Thus, viral clearance is due to both innate (acute, intermediate) and adaptive (late) immune mechanisms. the early phase of adenovirus eUmination [31], neutrophil-mediated clearance cannot be excluded as an important mediator of viral clearance in these exper iments. This concern is supported by the direct demonstration of the uptake of fluorescently labeled adenovirus by neutrophils recruited to the lung using con- focal microscopy (Zsengeller and Trapnell, unpublished observations). Third, infectious, fluorescently labeled adenovirus is rapidly internalized by alveolar macrophages in vivo as early as 1 min foUov^ing pulmonary administration in mice [33]. The mechanism by v^hich alveolar macrophages internalize adenovirus in vivo is not knov^n but may involve endocytosis and/or phagocytosis and may involve other factors within the local milieu.
In order to better understand this mechanism, it is useful to first consider the mechanism of adenovirus infection in epithelial cells which has been well studied (reviewed in [34]). The virion is internalized by receptor-mediated endocytosis and can be summarized as fol lows: (i) high-affinity binding of the virion to the cell mediated by attachment of the adenovirus fiber knob to its 46-kDa cell surface receptor, CAR [35]; (ii) receptor clustering and rapid virion internalization via a clathrin-coated vesicle mediated by interaction of the adenovirus penton base with integrins avPi or avPs [36-40]; (iii) release of clathrin to generate an endocytotic vesicle; (iv) endosome acidification mediated by an endogenous vesicular membrane proton pump [41]; (v) penetration of the endosome membrane (endosome lysis) and release of the virion into the cytoplasm mediated by the TVD motif- containing cytoplasmic tail portion of integrin P5 [42]; (vi) virion translocation 3 5 8 Trapnell and Shanley to the nuclear membrane mediated by microtubules [39, 43]; (vii) virion bing- ing to the nuclear pore [44]; (viii) capsid disassembly (continued) at the nuclear pore [34]; and (ix) translocation of viral chromatin into the nucleus through the nuclear pore [44]. Adenovirus uptake by mononuclear phagocytes has been studied to some extent in vitro. In contrast to highly susceptible Coxsackie and adenovirus receptor (CAR)+ epithelial cells, hematopoietic lineage cells includ ing alveolar macrophages, monocytes, and related cell lines do not express CAR and internalize adenovirus about 100 to 1000-fold less w êll [45-48]. Internal ization of adenovirus by these cells in vitro requires cell surface integrin ay, similar to CAR"^ epithelial cells and upregulation of integrin a^^s and aypa on human monocytes facilitates infection [45]. Studies using RAW264.7 murine macrophages have show^n that the internalization of adenovirus by these cells is temperature-sensitive and calcium-dependent and requires phosphatidylinosi- tol 3-OH kinase [33]. Data from administration of adenovirus to mice in vivo suggest the potential involvement of other factors or an alternative mechanism of uptake. For example, in vivo uptake of adenovirus by alveolar macrophages is reduced in mice deficient in surfactant protein A [49]. Mice deficient in GM- CSF due to targeted gene ablation are unable to clear adenovirus from the lung and alveolar macrophages in these mice are unable to internalize adenovirus efficiently [50] due to a generalized defect in phagocytosis/endocytosis [51]. In contrast, mice deficient in M-CSF (osteopetrotic mice) have no apparent defect in uptake of adenovirus (Zsengeller and Trapnell, unpublished observa tions). Thus, further studies w'\\\ be required to determine the mechanism by v^hich alveolar macrophages internalize and degrade adenovirus in vitro and in vivo. A second important innate immune mechanism of clearance of adenovirus DNA has recently been demonstrated to be the clearance of virus-transduced cells by recruited NK cells [52]. Intravenous administration of adenovirus results in detectable levels of NK cells in infected tissues by 7-10 days and depletion of NK cells prolonged the duration of transgene expression. Interest ingly, variation in transgene expression betw^een different strains of mice w âs associated with significant differences in levels of IL-12 and IFNy production and NK cell activation. In summary, multiple innate immune barriers block adenovirus infection of the lung and several, redundant innate immune mechanisms of clearance contribute to elimination. Barriers to uptake include production of a mucous layer that traps virions, the ciliary escalator that ejects trapped virions, the epithelial cell glycocalyx that traps virions, and epithelial tight junctions that sequester required adenovirus cell surface receptors aw ây from the luminal surface of the airw^ay epithelial cells. Innate immune mechanisms of clearance include rapid phagocyte-mediated internalization and destruction of the virion (i.e., by primary alveolar macrophages and secondarily recruited neutrophils) and NK cells that destroy adenovirus-infected cells. 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 5 9 III. Molecular Mediators of Inflammation Until recently, little was known about the molecular inflammatory responses triggered by adenovirus infection of the lung. In contrast, bacte rial infection and sepsis has been extensively studied in humans and a variety of animal models and has provided a context for the evaluation of these responses to adenovirus infection. Recent studies of adenovirus pneumonia in children and a great number of studies in animal models and humans receiving replication-deficient adenoviral vectors have provided important details of the molecular signaling responses to adenovirus infection of the respiratory tract. The latter are the result of intense interest and efforts to develop adenovirus- based strategies for in vivo gene therapy for lung diseases such as cystic fibrosis (reviewed in [29]). Consequently, it is now known that pulmonary infection by either wild-type (replication competent) or replication-deficient adenovirus initiates expression of a complex cascade of cytokine mediators that accom panies cellular infiltration of the lung. The precise temporal relationship of expression of these mediators and their relationship to parenchymal infiltra tion by the various leukocyte populations are beginning to define their role in regulation of both innate and adaptive immune events (see below). Before discussing in detail the molecular responses to adenovirus, it is first useful to briefly review some general features of the principal cytokines involved. We will then discuss the cytokine responses during adenoviral pneumonia and the cytokine responses to pulmonary administration of replication-deficient adenoviral vectors in humans, nonhuman primates, and mice. Cytokines are proteins secreted by cells of the innate and adaptive immune systems in response to microbes and antigens that mediate many of the functions of their cellular components [4]. For historical reasons, various terms including monokine, lymphokine, and IL have been used to refer to these molecules. For simplicity, we will use only the term "cytokine," which does not make reference to the cellular origin or target. Cytokine responses to microbes are generally brief, redundant, and often include pleiotropic local and systemic effects. The effects of cytokines are mediated by binding to specific cell surface receptors resulting in alteration of gene expression and acquisition of new target cell functions or cell proliferation. Cytokine responsiveness can be regulated by expression of its receptor on the target cell and cytokines often alter the expression or effects of other cytokines, i.e., some cytokines antagonize while others synergize the effects of another cytokine. Cytokines serve as important regulators of innate immunity (e.g., TNFa, IL-1, IL-12), adaptive immunity (e.g., IL-2, IL-4, IL-5), and hematopoiesis (e.g., granulocyte macrophage- colony stimulating factor (GM-CSF), M-CSF, IL-3, stem cell factor (SCF)). Other cytokines play an important role in both innate and adaptive immunity (e.g., IFNy). While such functional grouping is useful, it is not absolute. For example, while GM-CSF is relevant to hematopoiesis, recent findings have 3 6 0 Trapnell and Shanley shown that it plays a critical role in innate immunity in the lung [53], but has only a noncritical or redundant role in hematopoiesis [54]. TNFa is a principal mediator of the acute inflammatory response to microbial infection and is responsible for many local and systemic effects of infection. The main function of TNFa is enhancement of neutrophil and monocyte recruitment to sites of infection and stimulation of their microbial clearance functions. TNFot is mainly produced by activated mononuclear phagocytes. The principal action and source of IL-1 is similar to that of TNFa. Chemokines (chemotactic cytokines) are a large family of small, structurally similar cytokines that stimulate migration of leukocytes from the blood to sites of local production in tissues (reviewed in [55]). Chemokines have been divided into four groups on the basis of cysteine motifs in their primary structure: C-chemokines (e.g., lymphotactin); CC-chemokines (e.g., MlP-la); CXC-chemokines (e.g., IL-8, MIP-2); and CXXXC-chemokines (e.g., fractalkine). In terms of inflammatory cell recruitment, CXC chemokines mainly promote neutrophil chemotaxis while CC chemokines act on monocytes, lymphocytes, and eosinophils. MIP- l a also functions in an autocrine manner to enhance TNFa expression [56]. Other cytokines are primary mediators of innate immune responses and serve to stimulate adaptive immunity. For example, both IL-12 and IL-18 are released by macrophages and stimulate NK and THI cell release of IFNy, a potent stimulator of cellular immunity. In contrast to the many cytokines that stimulate innate immune cell functions, IL-10 functions as an important inhibitor of macrophage inflammatory cytokine release (e.g., TNFa release), and thus functions as a homeostatic regulator of both innate and adaptive immune responses to microbial infection. IL-6 is a cytokine with pleiotropic functions affecting both innate and adaptive immunity. Among its diverse functions are the stimulation of acute-phase proteins by hepatocytes and stimulation of B lymphocyte proliferation and function. This background will serve as a brief context for considering the cytokine responses to adenovirus infection of the respiratory tract. A. Clinical Adenovirus Infections in Humans Cytokine responses have not been adequately studied in mild cases of natural adenovirus infection, however, a recent study of moderate to severe infections has provided important insights relating the severity of lung infection to the production of certain cytokines [57]. In this study of apparently healthy children, ages 3 weeks to 19 months, who were hospitalized for acute adenovirus pneumonia, the infection was mild in 10, moderate in 12, and fatal in 16. While neither IL-6 nor TNFa were detected in the serum of mild-moderate cases, both were detected in the serum of most fatal cases (13/16, 9/12, respectively). IL-8 was detected in all three groups with serum levels correlating with disease severity. The more severe cases were also noted to have reduced levels of complement, increased levels of circulating immune 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 6 1 complexes, and a decrease in IgG consistent with a consumptive process. IL-1 and IL-4 were rarely detected in any patients and all patients demonstrated by IgM and IgG directed against adenoviral epitopes. Finally, development of septic shock was associated with markedly increased serum levels of IL-6, IL-8, and TNFa. This study demonstrated a clear association between the level of severity of adenoviral infection of the lung, morbidity/mortality and production of certain proinflammatory cytokines. Cytokine responses have also been studied in individuals with cystic fibro sis in which recombinant, replication-deficient, El-,E3-region-deleted adenovi ral vectors were administered to either nasal or bronchial epithelium or both. In one double-blind, vehicle-controlled, dose-escalation study of nasal administra tion, nostrils receiving the adenoviral vector had a greater increase in IL-1, IL-6, IL-8, and IL-10 than vehicle control nostrils in the same patient [58]. In another study of bronchoscopic delivery of a similar vector to the lungs of individuals with cystic fibrosis, IL-6 was increased in the serum 4 h after vector adminis tration with values tapering over 8-24 h [59]. Further, the maximum increase in serum IL-6 levels was proportional to the dose of adenovirus administered. IL-6 was also detected in the bronchoalveolar lavage fluid of these individuals. Taken together, these data show that infection of the respiratory tract by either replication-competent or replication-deficient adenovirus results in release of similar proinflammatory cytokines. Further, cytokines can be detected locally and systemically and appear to be released in proportion to the magnitude of the infection. B. Adenovirus Infections in Animal Models Adenovirus infection of the respiratory tract has been recently studied in a variety of animal models including mice [30, 32, 60], Cotton rats (Sigmodon Hispidus) [15, 19, 27, 61], and primates [20-23] as part of efforts to develop adenovirus-based vectors for human gene therapy for cystic fibrosis (reviewed in [29, 62]). In nonhuman primates receiving an El-,E3-deleted vector by bronchoscopic delivery, IL-lp and IL-8 were both elevated in lung lavage fluid compared to animals receiving only vehicle control. IL-ip levels were mildly increased in the lungs of animals receiving 10^^ plaque-forming units (pfus) at 3 days, but progressively higher levels were seen at 21 and 28 days. In contrast, IL-8 levels were consistently elevated at 3,10, 21, and 28 days following vector administration. No increases were seen in monkeys receiving only low doses (10^ pfu/animal). Thus, studies in nonhuman primates are consistent with human studies and demonstrate a dose-dependent increase in lung cytokine expression following adenovirus infection. Cytokine response studies have been most thoroughly studied in mice. Inbred C57BL/6N mice infected intranasally with 10^^ pfu of wild-type human serotype 5 adenovirus (Ad5) showed elevated lung levels of TNFa, IL-1, and 362 Trapnell and Shanley IL-6 24 h after infection. While TNFa and IL-1 were not elevated in serum at any time, IL-6 was elevated as early as 24 h after infection. TNFa levels were baseline in the
lung by day 3 in contrast to IL-1 levels which rose progressively through 7 days. IL-6 levels peaked on day 1 and fell progressively but were still elevated at 7 days. Subsequent studies have evaluated cytokine responses in BALB/c mice receiving intratracheal administration of an E1-,E3- deleted adenoviral vector [32, 33]. These studies more completely defined the chronology and levels of cytokine responses and demonstrated that the different cytokines could be grouped in terms of patterns of expression at different times after infection: acute (elevated by 6 h), intermediate (not elevated at 6 h, but elevated at 24 h), and late (not elevated at 6 h, but progressively increasing thereafter through 72 h) (Fig. 2). The observation that these responses are similar in nude and control mice demonstrates that these early cytokine responses to adenovirus are independent of adaptive immunity. C. Acute Cytokine Responses Intratracheal administration of an El-,E3-deleted adenoviral vector in BALB/c mice results in elevation of TNFa, IL-6, MIP-2, and MlP-la levels in Acute 24 48 72 Time after infection (hr) Figure 2 Patterns of innate immune cytokine responses in the lung after adenovirus infection of the respiratory tract. Patterns of cytokine responses to adenovirus lung infection can be grouped into "phases" of expression including an acute phase (e.g., TNFa, IL-6) or hyperacute (MIP-2, striped area), an intermediate phase (e.g., IL-lp and IFNy), and a late phase (e.g., MCP-1). Specific cytokines elicited during these phases coordinate a number of innate immune defenses and initiate regulatory pathways that modulate the level of specific adaptive immune responses. See text for details. 12. Innate Immune Responses to In Vivo Adenovirus Infection 3 6 3 bronchoalveolar lavage (BAL) 6 h after infection [32]. In another study TNFa mRNA was detected as early as 30 min after pulmonary infection, whereas TNFa protein was detected in lung by 3 h [33]. In the later study, in situ hybridization analysis demonstrated that adenovirus-induced TNFa mRNA expression was localized to alveolar macrophages; however, expression was not seen in either respiratory epithelium or vascular endothelium for the duration of the study (6 h). The importance of TNFa in adenoviral clearance was demonstrated using mice deficient in TNFa due to targeted gene ablation (TNFa-/-) [63]. Intravenous administration of an adenoviral vector expressing a chloramphenicol transgene resulted in prolonged transgene expression in TNFa-/- mice compared to controls. Abrogation of the adenovirus-induced TNFa response by coadministration of corticosteroids or the suppressive cytokine, IL-10, also increased the duration of adenoviral vector-mediated transgene expression. Blocking TNFa receptor function prolongs adenoviral vector-mediated transgene expression as demonstrated by prolonged transgene expression after coadministration of an adenoviral vector expressing a TNFa receptor decoy with one expressing a conventional marker [52]. Together, these studies support the concept that TNFa, which is derived primarily from alveolar macrophages, plays an important role in elimination of adenovirus following pulmonary infection. MIP-2, an important neutrophil chemoattractant, is elevated within 3 h after pulmonary administration of an El-,E3-deleted adenoviral vector in mice. Levels peak at 6-8 h and then rapidly decline to baseline by 24 h. Consistent with this, MIP-2 mRNA levels are elevated by 30 min in both lung and alveolar macrophage total RNA of adenovirus-infected but not vehicle-exposed mice. These studies demonstrate that the alveolar macrophages can be a potent effector of neutrophil recruitment following adenovirus lung infection. MlP-la expression is initiated with kinetics similar to MIP-2, but in contrast, expression remained elevated at 24 h. Mice deficient in MlP-la due to targeted gene ablation also demonstrate substantially reduced inflammation and delayed viral clearance after Coxsackie virus or influenza virus infection [64]. IL-6 expression after adenoviral infection of the respiratory tract was similar to that of TNFa at both the mRNA and protein levels [33]. Similarly, in situ hybridization localized IL-6 mRNA to alveolar macrophages but not epithelium nor vascular endothelium after adenoviral vector infection of the lung [33]. Despite this chronological description of its response, the role of IL-6 in adenovirus infection of the lung is not currently known. D. Intermediate Cytokine Responses The "second wave" of cytokine responses includes IL-ip and IFNy, both of which are at baseline 6 h after adenovirus lung infection, but are increased by 24 h. While much is known about the general functions of IL-1 and IFNy in other systems, studies in IL-1 or IFNy gene-ablated mice have not been done 3 6 4 Trapnell and Shanley and specific data regarding their role in adenoviral lung infection is lacking. Interestingly, coadministration of corticosteroids abrogated the IFNy response to adenoviral lung infection [32] and vŝ as associated w îth increased adenoviral vector-mediated gene expression. Hov\^ever, since other cytokines were also altered by this treatment, the relevance of changes in IFNy w îll require further evaluation. IFNy production by NK and THI cells can be stimulated by both IL-12 and IL-18, w^hich are both stimulated by adenovirus infection of the lung [65]. However, only IL-18 is necessary for optimal production of IFNy, independent of IL-12. Further, THI cell development was unaffected by blocking both IL-12 and IL-18, demonstrating that other factors may be required for THI differentiation following adenovirus infection. Differences in IFNy levels have been demonstrated between BALB/c and C57BL mice after adenovirus infection and have been related to differences in the duration of adenoviral vector transgene expression in these two mouse strains. E. Late Cytokine Responses MCP-1 was not elevated at 6 h after adenovirus lung infection but progressively increased thereafter and was still at the highest value 3 days after infection. This pattern of expression is different from the immediate cytokines because it is of substantially longer duration. In fact, a decline in expression after adenovirus lung infection has not been defined. MCP-1 is capable of recruiting multiple mononuclear cell subsets, however, its precise role in adenoviral infection is currently unclear. In other lung inflammation models (e.g., silicosis) a network of cytokine/ chemokine signaling has been observed linking TNFa expression to MCP-1 production and T-cell recruitment (Tamez and Shanley, unpublished observations). MCP-1 is also important in recruitment of monocytes. Thus, MCP-1 may have multiple roles in adenoviral lung infection. Interestingly, overexpression of MCP-1 in the lung results in skewing toward TH2 development with increased IL-10 and IL-13 levels and decreased IL-12 and IFNy levels [66]. IV. Inflammatory Cell Recruitment While the clinical manifestations of natural adenovirus infection in the respiratory tract range from inapparent infection to overwhelming pneumonia, sepsis, and death, the histological responses have been well-described in humans only in cases of fatal pneumonia which result in necrotizing bronchiolitis [67]. In human clinical trials with replication-deficient adenoviral vectors, virus administration to the nasal epithelium has also produced mixed results. In one study in which adenoviral vector was applied to one nostril and saline to the other, viral infection was associated with an increase in the percentage of 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 6 5 neutrophils recovered by swabbing compared to the sahne-exposed nostril [68]. Neutrophilia resolved by 1 week in this study. Another study involving direct nasal administration of various doses of a similar adenoviral vector showed no differences in the number of inflammatory cells in epithilium or submucosa between biopsy specimens from adenovirus- or saline-treated nostrils [58]. Histological data are not available from clinical trials in which adenoviral vectors were administered to the lungs of patients. Histological responses to wild-type adenovirus have also been studied in cotton rats and mice in an effort to develop an animal model of human adenovirus diseases and more recently as part of preclinical studies in attempts to develop adenoviral vectors for human gene therapy. It was previously reported [61] that despite evaluation of multiple laboratory animals, clinical disease from wild-type human adenovirus infection of the respiratory tract was identified only in these cotton rats and mice. However, in recent studies, administration of large doses of replication- deficient El-,E3-deleted adenoviral vectors has produced histological evidence of cellular inflammation in several animal models including Cotton rats, mice, nonhuman primates, sheep, and others. Data suggest that the histological responses in these different models are similar. Since they have been best characterized in rodent models we will focus on that data here. Intranasal administration of Ad5 in C57BL/6N mice resulted in devel opment of pneumonia characterized by perivascular, peribronchiolar, and intraalveolar leukocyte [60]. The infiltrate was present on day 1 and was still present on day 7 after infection and consisted primarily of mononuclear cells. The infiltrate was described as consisting of an early phase noted on days 2 through 5 and an overlapping delayed phase peaking on days 5 to 7. The early phase consisted of infiltration by monocytes/macrophages and lymphocytes with scattered neutrophils while the delayed phase consisted of a very promi nent lymphocytic perivascular and peribronchial infiltration. In nude mice which lack thymus-derived T lymphocytes, the delayed lymphocytic phase was markedly reduced in all locations especially in the perivascular region [60]. In contrast, the early phase was not affected in athymic mice. Together, these data suggested that cytotoxic T cells were an important component of the delayed but not the early phase of cellular infiltration. Nasal administration of Ad5 in cotton rats, which are partially permissive for replication of Ad5, produced a similar histological response which was proportional to the dose of virus in the infecting inoculum [61]. Two phases were also noted: an early phase con sisting of monocytes-macrophages, neutrophils, and occasional lymphocytes, and a delayed phase consisting almost exclusively of lymphocytes which was especially prominent in the peribronchiolar and perivascular space. Histological responses to infection of the respiratory tract by replication- deficient adenoviral vectors has been fairly well studied in cotton rats and mice. In Cotton rats, direct comparison of histopathology following intratracheal administration of Ad5 and Ad5-derived El-,E3-deleted replication deficient 366 Trapnell and Shanley vectors showed a qualitatively similar histopathologic pattern of virus dose- dependent leukocyte infiltration [27]. Quantitatively, however, the response to Ad5 was markedly more pronounced than the response to the replication- deficient vector. This study also showed a prominent neutrophilic component early after infection, including infiltration of airway epithelium as early as 24 h after infection. This neutrophilic component was evaluated more carefully in a subsequent study in mice infected by the replication-deficient adenoviral vector, which demonstrated a very rapid neutrophil infiltration which peaked at around 6 h and resolved over the ensuing 3 to 4 days. Interestingly, this coincided with expression of the major neutrophil chemoattractant MIP-2 in these mice [32]. Recently, NK cells have been demonstrated to be an important com ponent of the delayed phase inflammatory cell infiltrate present in the liver after intravenous administration of a replication-deficient adenoviral vector in mice [52]. Increased NK cell numbers were apparent on days 7 and 10 after infection and were associated with increased levels of IL-12 and IFNy. Differences in levels of NK cell accumulation in hepatic tissues and hepatocel lular damage were strongly inversely correlated with the duration of transgene expression in BALB/c and C57BL/6 mice. These finding suggest that differences in NK cell responses may explain strain differences in the duration of transgene expression independent of CTL responses. Cytotoxic lymphocytes 4 6 8 10 Time after infection (days) Figure 3 Pattern of inflammatory cell accumulation in the lung following adenovirus infection of the respiratory tract. Infiltration of the lungs following adenovirus infection has been characterized in several animal models and the general features are similar in each. Neutrophils appear very early and recede fairly quickly. An increase in the macrophage-monocyte population probably begins quite early but is apparent by 2 - 3 days and slowly recedes over the course of a week or so. NK cells have been shown to be present in increased numbers on about days 7 - 1 0 in infected liver tissues and is presumably similar in lung. Cytotoxic lymphocytes are seen late and are prominent on days 7 - 14. These patterns of leukocyte recruitment can be correlated with specific patterns of chemokines known to be chemotactic for the specific leukocyte subsets. See text for details. 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 6 7 Taken together, these studies suggest that massive adenovirus infection of the respiratory tract as would be the case in current strategies for in vivo adenovirus-mediated gene transfer, eHcits a histopathological response consisting of "acute," "intermediate," and "delayed" phases (Fig. 3). The acute phase begins within
hours of infection, peaks within 6-24 h, and resolves thereafter. Both the peak and the duration of the inflammatory infiltrate, which consists primarily of neutrophils, are strongly dependent on the dose of infecting virus. Release of potent neutrophil chemoattractants (e.g., MIP-2 and MlP-la) from alveolar macrophages are likely part of the molecular mechanism of this recruitment. The intermediate phase begins within 1-2 days, continues for upto 7-10 days, and consists of accumulation of monocytes-macrophages and NK cells. Increased levels of MlP-lot, MCP-1, IFNy, and other factors are involved in recruitment and activation of cells during the intermediate phase, although more studies are required to delineate the specific role of these and other factors. The late phase is evident by 7 days, is still present on day 14 but probably subsides thereafter and consists primarily of adenovirus-specific lymphocytes. The cytokines responsible for this phase are not yet well-studied but multiple cytokines are likely to be involved. V. Innate Immunity and Programming of Adaptive Responses Phagocyte-based mechanisms of innate immunity are primarily respon sible for clearing the bulk of adenovirus administered to the lungs during massive infections. However, clearance of adenovirus-infected cells is due to both NK and CTL-based mechanisms belonging to innate and adaptive cel lular immunity, respectively. Further, successful reinfection by adenovirus is inversely proportional to the presence of neutralizing antibodies produced by the humoral adaptive immune system [19, 69]. While these topics are covered in detail in other chapters of this book, it is worth noting how innate immune responses to adenovirus infection in vivo regulate these adaptive immune responses. Cytokines, produced by cells of both innate and adaptive immu nity have a profound effect on the nature and magnitude of specific adaptive immune responses. TNFot, the principal mediator of the acute inflammatory response ade noviral infection of the lung, also has been shown to profoundly affect both cellular and humoral adaptive immune responses to adenovirus infection in vivo. Mice deficient in TNFa due to targeted gene ablation (TNFa -/-) had markedly reduced CTL infiltration of the liver compared to normal controls after intravenous administration of an El-,E3-deleted adenoviral vector [63]. Importantly, the absence of TNFa expression was associated with prolonged expression of the viral transgene. These mice also had substantially reduced 3 6 8 Trapnell and Shanley levels of anti-adenoviral antibodies following infection compared to normal controls. Mice deficient in both TNFa and its related protein, lymphotoxin (TNFp) had reduced inflammation and impaired production of anti-adenoviral IgG and IgA antibodies after intravenous adenovirus administration 170]. The impairment of humoral response in these TNFa/TNF^-deficient mice v^as suf ficient to permit successful reinfection by the vector. In a separate strategy targeted at the TNFa receptor, prior administration of soluble TNF receptor (type I) resulted in prolonged adenoviral vector-mediated gene expression 171]. In a similar approach, mice genetically deficient in both type I and type II TNF receptors demonstrated a significantly reduced humoral antibody response, but no significant prolongation of transgene expression [72]. In the latter study, adenoviral vector-mediated gene transfer of human IL-10, a potent deactivator of macrophages that suppresses TNFa synthesis, also abrogated the neutralizing antibody response to adenoviral vector infection, but had no effect on prolonging transgene expression. Together, these observations shov^ that TNFa, a critical regulator of innate immunity to adenovirus, is also an important regulator of the adaptive immune responses to adenovirus. Other cytokine mediators of innate immunity are also important in reg ulating the adaptive responses to adenovirus. For example, IFNy is important in activation of alveolar macrophages and also directs T helper lymphocyte development toward Tni-type responses. IL-18 has recently been defined as a critical component of adenovirus-induced IFNy production after in vivo infec tion which is independent of IL-12-induced IFNy expression [GS]. Although compelling, these studies demonstrating that cytokines produced by innate immune cells regulate both the nature and strength of adaptive immune responses represent only the beginning of our understanding of the com plex interplay between innate and adaptive immune responses to adenoviral infection. VI. Innate Immunity and In Vivo Gene Therapy Recent progress in our understanding of the significance of innate immune responses to adenovirus infection in vivo have important implications for strategies of in vivo gene therapy using adenovirus. First, the phagocyte- based immune system is present and active prior to vector administration in contrast to adaptive immune responses. Therefore, any strategy designed to deliver large amounts of vector to tissues must take into account the loss of vector due to phagocyte-mediated clearance. Second, clearance of adenovirus by macrophages results in potent inflammatory signals which profoundly influence both molecular and cellular inflammation and likely determine the extent of tissue damage and systemic effects due to adenoviral infection of the 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 6 9 lung. Consequently, if clearance of adenovirus cannot be prevented, uncoupling of phagocytic internalization from release of large amounts of proinflammatory mediators w^ould be useful. Third, because release of inflammatory cytokines determines the level of clearance of adenovirally infected cells by NK cells (e.g., IL-12, IFNy) and CTL (TNFa, TNFp), innate immunity also has a major influence on the duration of transgene expression. Thus, immunosuppressive strategies should be aimed at both innate and adaptive clearance mechanisms or their regulation cytokines. Finally, innate immune barriers to infection of epithelials cells (mucous barrier, glycocalyx, sequestration of required receptors) must be overcome in order to achieve adequate initial levels of adenoviral vector-mediated gene transfer. VII. Future Directions Recent efforts to better characterize the in vivo host responses and barriers to adenovirus infection have defined a number of hurdles to the use of adenoviral vectors for in vivo human gene therapy. With this groundw^ork laid, systematic exploration of these barriers v îll hopefully lead to development of the means to circumvent them. This is already a very active area of research and is likely to continue to be productive. Adenoviral vectors also provide excellent tools v\Aith which to study various biological processes in vivo and to dissect the specific molecular and cellular innate immune responses to viral infection of the lung. Thus, separate from the utility v^ith respect to development of adenovirus-based gene therapy, such studies are clearly increasing our know^ledge regarding the basic biology of an important respiratory pathogen vv̂ hich infects most individuals by adulthood. Acknovs^iedgments This work was supported by The Children's Hospital Research Foundation, Cincinnati, Ohio (BCT), the Cystic Fibrosis Foundation (BCT) and by NIH K08 HL/AI 04291-01 (TPS). References 1. van Furth, R., and Cohn, Z. A. (1968). The origin and kinetics of mononuclear phagocytes. / . Exp. Med. 128(3), 415-435. 2. Kennedy, D. W., and Abkowitz, J. L. (1998). Mature monocytic cells enter tissues and engraft. Froc. Natl. Acad. Set. USA 95(25), 14,944-14,949. 3. Biron, C. A. (1997). Activation and function of natural killer cell responses during viral infections. Curr. Opin. Immunol. 9(1), 24-34. 4. Abbas, A. K., Lichtman, A. H., and Pober, J. S. (2000). "Cytokines. Cellular and Molecular Immunology," 4th ed., pp. 235-269. Saunders Philadelphia. 3 7 0 Trapnell and Shanley 5. Crouch, E. C. (1998). CoUectins and pulmonary host defense. Am. J. Respir. Cell Mol. Biol. 19(2), 177-201. 6. Pels, A. O., and Cohn, Z. A. (1986). The alveolar macrophage. / . Appl. Physiol. 60(2), 353-369. 7. Welsh, R. M., and Sen, G. C. (1997). Nonspecific host responses to viral infections. In "Viral Pathogenesis" (N. Nathason, Ed.), pp. 109-141. Lippincott-Raven, Philadelphia. 8. Eraser, R. S., Muller, N. L., Colman, N., and Pare, P. D. (1999). "Viral Respiratory Diseases. Eraser and Pare's Diagnosis of Diseases of the Chest," 4th ed., pp. 994-996. Saunders, Philadelphia. 9. Horowitz, M. S. (1996). Adenoviruses. In "Eields Virology" (B. N. Eields, D. M. Knipe, P. M. Howley, Eds.), 3rd ed., pp. 2149-2171. Lippincott-Raven, New York. 10. Macek, v. , SorH, J., Kopriva, S., and Marin, J. (1994). Persistent adenoviral infection and chronic airway obstruction in children. Am. J. Respir. Crit. Care Med. 150(1), 7-10. [see comments] 11. Teichtahl, H., Buckmaster, N., and Pertnikovs, E. (1997). The incidence of respiratory tract infection in adults requiring hospitalization for asthma. Chest 112(3), 591-596. 12. Videla, C , Carballal, G., Misirhan, A., and Aguilar, M. (1998). Acute lower respiratory infections due to respiratory syncytial virus and adenovirus among hospitalized children from Argentina. Clin. Diagn. Virol. 10(1), 17-23. 13. Zahradnik, J. M., Spencer, M. J., and Porter, D. D. (1980). Adenovirus infection in the immunocompromized patient. Am. ]. Med. 68, 725. 14. Bridges, N. D., Spray, T. L., Collins, M. H., Bowles, N. E., and Towbin, J. A. (1998). Ade novirus infection in the lung results in graft failure after lung transplantation. / . Thorac. Cardiovasc. Surg. 116(4), 617-623. 15. Ginsberg, H. S., and Prince, G. A. (1994). The molecular basis of adenovirus pathogenesis. Infect. Agents Dis. 3(1), 1-8. 16. Trapnell, B. C , and Gorziglia, M. (1994). Gene therapy using adenoviral vectors. Curr. Opin. Biotechnol. 5(6), 617-625. 17. Trapnell, B. C. (1993). Adenoviral vectors for gene transfer. Adv. Drug Delivery Rev. 12, 185-199. 18. Mastrangeli, A., Danel, C , Rosenfeld, M. A., Stratford-Perricaudet, L., Perricaudet, M., Pavi- rani. A., Lecocq, J. P., and Crystal, R. G. (1993). Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. / . Clin. Invest. 91(1), 225-234. 19. Yei, S., Mittereder, N., Tang, K., O'Sullivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1(3), 192-200. 20. Zabner, J., Petersen, D. M., Puga, A. P., Graham, S. M., Couture, L. A., Keyes, L. D., Luka- son, M. J., St. George, J. A., Gregory, R. J., Smith, A. E., et al. (1994). Safety and efficacy of repetitive adenovirus-mediated transfer of CFTR cDNA to airway epithelia of primates and cotton rats. Nat. Genet. 6(1), 75-83. 21. Wilmott, R. W., Amin, R. S., Perez, C. R., Wert, S. E., Keller, G.,Boivin, G. P.,Hirsch, R.,De Inocencio, J., Lu, P., Reising, S. F., Yei, S., Whitsett, J. A., and Trapnell, B. C. (1996). Safety of adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA to the lungs of nonhuman primates. Hum. Gene Ther. 7(3), 301-318. 22. Simon, R. H., Engelhardt, J. F., Yang, Y., Zepeda, M., Weber-Pendleton, S., Grossman, M., and Wilson, J. M. (1993). Adenovirus-mediated transfer of the CFTR gene to lung of nonhu man primates: Toxicity study. Hum. Gene Ther. 4(6), 771-780. 23. Brody, S. L., Metzger, M., Danel, C , Rosenfeld, M. A., and Crystal, R. G. (1994). Acute responses of non-human primates to airway delivery of an adenovirus vector containing the human cystic fibrosis transmembrane conductance regulator cDNA. Hum. Gene Ther. 5(7), 821-836. 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 7 1 24. Grubb, B. R., Pickles, R. J., Ye, H., Yankaskas, J. R., Vick, R. N., Engelhardt, J. F., Wil son, J. M., Johnson, L. G., and Boucher, R. C. (1994). Inefficient gene transfer by adenovirus vector to cystic fibrosis airw^ay epithelia of mice and humans. Nature 371(6500), 802-806. 25. Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J., and Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia./. Biol. Chem. 274(15), 10,219-10,226. 26. Pickles, R. J., Fahrner, J. A., Petrella, J. M., Boucher, R. C., and Bergelson, J. M. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarized epithelial cells reveals the glycocalyx as a barrier to adenovirus-mediated gene transfer. / . Virol 74(13), 6050-6057. 27. Yei, S., Mittereder, N., Wert, S., Whitsett, J. A., Wilmott, R. W., and Trapnell, B. C. (1994). In vivo evaluation of the safety of adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA to the lung. Hum. Gene Ther. 5(6), 731-744. 28. Rosenfeld, M. A., Yoshimura, K., Trapnell, B. C., Yoneyama, K., Rosenthal, E. R., Dale- mans, W., Fukayama, M., Bargon, J., Stier, L. E., Stratford-Perricaudet, L., et al. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airv^ay epithelium. C^//68(l), 143-155. 29. Trapnell, B. C. (Ed.) (1997). "Gene Therapy for Cystic Fibrosis Lung Disease, The Pediatric Lung." Birkhauser Verlag, Basel. 30. Yang, Y., Li, Q., Ertl, H. C., and Wilson,]. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with
recombinant adenoviruses./. Virol. 69(4), 2004-2015. 31. Worgall, S., Leopold, P. L., Wolff, G., Ferris, B., Van Roijen, N., and Crystal, R. G. (1997). Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithehal surface of the respiratory tract. Hum. Gene Ther. 8(14), 1675-1684. 32. Otake, K., Ennist, D. L., Harrod, K., and Trapnell, B. C. (1998). Nonspecific inflammation inhibits adenovirus-mediated pulmonary gene transfer and expression independent of specific acquired immune responses. Hum. Gene Ther. 9(15), 2207-2222. 33. Zsengeller, Z. K., Otake, K., Hossain, S. -A., Berclaz, P. -Y., and Trapnell, B. C. (2000). Inter nalization of adenovirus by alveolar macrophages initiates early proinflammatory signaling during acute respiratory tract infection./. Virol. 74(20), 9655-9667. 34. Greber, U. F., Willetts, M., Webster, P., and Helenius, A. (1993). Stepwise dismantling of adenovirus 2 during entry into cells. Cell 75(3), 477-486. 35. Bergelson, J. M., Krithivas, A., CeH, L., Droguett, G., Horwitz, M. S., Wickham, T., Crow- ell, R. L., and Finberg, R. W. (1998). The murine CAR homolog is a receptor for coxsackie B viruses and adenoviruses./. Virol. 72(1), 415-419. 36. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73(2), 309-319. 37. Li, E., Stupack, D., Bokoch, G. M., and Nemerow, G. R. (1998). Adenovirus endocytosis requires actin cytoskeleton reorganization mediated by Rho family GTPases./. Virol. 72(11), 8806-8812. 38. Li, E., Stupack, D., Klemke, R., Cheresh, D. A., and Nemerow, G. R. (1998). Adenovirus endocytosis via alpha(v) integrins requires phosphoinositide-3-OH kinase. / . Virol. 72(3), 2055-2061. 39. Leopold, P. L., Ferris, B., Grinberg, I., Worgafl, S., Hackett, N. R., and Crystal, R. G. (1998). Fluorescent virions: Dynamic tracking of the pathway of adenoviral gene transfer vectors in living cefls. Hum. Gene Ther. 9(3), 367-378. 40. Wang, K., Huang, S., Kapoor-Munshi, A., and Nemerow, G. (1998). Adenovirus internaliza tion and infection require dynamin./. Virol. 72(4), 3455-3458. 41. Perez, L., and Carrasco, L. (1994). Involvement of the vacuolar H(+)-ATPase in animal virus entry./. Gen. Virol. 75(Pt. 10), 2595-2606. 3 7 2 Trapnell and Shanley 42. Wang, K., Guan, T., Cheresh, D. A., and Nemerow, G. R. (2000). Regulation of adenovirus membrane penetration by the cytoplasmic tail of integrin beta5. / . Virol. 74(6), 2731-2739. [In process citation] 43. Suomalainen, M., Nakano, M. Y., Keller, S., Boucke, K., Stidwill, R. P., and Greber, U. F. (1999). Microtubule-dependent plus- and minus end-directed motilities are competing pro cesses for nuclear targeting of adenovirus. / . Cell Biol. 144(4), 657-672. 44. Greber, U. F., Suomalainen, M., Stidwill, R. P., Boucke, K., Ebersold, M. W., and Hele- nius, A. (1997). The role of the nuclear pore complex in adenovirus DNA entry. EMBO J. 16(19), 5998-6007. 45. Huang, S., Endo, R. I., and Nemerow, G. R. (1995). Upregulation of integrins alpha v beta 3 and alpha v beta 5 on human monocytes and T lymphocytes facilitates adenovirus-mediated gene delivery./. Virol. 69(4), 2257-2263. 46. Huang, S., Kamata, T., Takada, Y., Ruggeri, Z. M., and Nemerow, G. R. (1996). Adenovirus interaction with distinct integrins mediates separate events in cell entry and gene delivery to hematopoietic cells./. Virol. 70(7), 4502-4508. 47. Von Seggern, D. J., Chiu, C. Y., Fleck, S. K., Stewart, P. L., and Nemerow, G. R. (1999). A helper-independent adenovirus vector with El , E3, and fiber deleted: Structure and infectivity of fiberless particles./. Virol. 73(2), 1601-1608. 48. Kaner, R. J., Worgall, S., Leopold, P. L., Stolze, E., Milano, E., Hidaka, C., Ramahngam, R., Hackett, N. R., Singh, R., Bergelson, J., Finberg, R., Falck-Pedersen, E., and Crystal, R. G. (1999). Modification of the genetic program of human alveolar macrophages by adenovirus vectors in vitro is feasible but inefficient, limited in part by the low level of expression of the coxsackie/adenovirus receptor. Am. J. Respir. Cell Mol. Biol. 20(3), 361-370. 49. Harrod, K. S., Trapnell, B. C., Otake, K., Korfhagen, T. R., and Whitsett, J. A. (1999). SP-A enhances viral clearance and inhibits inflammation after pulmonary adenoviral infection. Am. J. Physiol. 277(3 Pt. 1), L580-L588. 50. Trapnell, B. C., Zsengeller, Z., Chroneos, Z. C., Whitsett, J. A., and Berclaz, P. -Y. (2000). Alveolar macrophages from granulocyte-monocyte colony stimulating factor (GM-CSF) deficient mice are arrested at an early differentiation stage. Respir. Crit. Care Med. 162, AOOO. 51. Shibata, Y., Berclaz, P-Y., Chroneos, Z., Yoshida, H., Whitsett, J. A., and Trapnell, B. C. (submitted for publication). "GM-CSF Regulates Alveolar Macrophage Differentiation and Innate Immunity in the Lung Through PU.l." 52. Peng, Y., Falck-Pedersen, E., and Elkon, K. B. (2001). Variation in adenovirus transgene expression between BALB/c and C57BL/6 mice is associated with differences in interleukin-12 and gamma interferon production and NK cell activation. / . Virol. 75(10), 4540-4550. 53. LeVine, A. M., Reed, J. A., Kurak, K. E., Cianciolo, E., and Whitsett, J. A. (1999). GM-CSF- deficient mice are susceptible to pulmonary group B streptococcal infection. / . Clin. Invest. 103(4), 563-569. 54. Dranoff, G., Crawford, A. D., Sadelain, M., Ream, B., Rashid, A., Bronson, R. T., Dickersin, G. R., Bachurski, C. J., Mark, E. L., Whitsett, J. A., et al. (1994). Involvement of granulocyte-macrophage colony-stimulating factor in pulmonary homeostasis. Science 264(5159), 713-716. 55. Zlotnik, A., and Yoshie, O. (2000). Chemokines: A new classification system and their role in immunity. Immunity 12(2), 121-127. 56. Shanley, T. P., Schmal, H., Friedl, H. P., Jones, M. L., and Ward, P. A. (1995). Role of macrophage inflammatory protein-1 alpha (MIP-1 alpha) in acute lung injury in rats. / . Immunol. 154(9), 4793-4802. 57. Mistchenko, A. S., Diez, R. A., Mariani, A. L., Robaldo, J., Maffey, A. F., Bayley- Bustamante, G., and Grinstein, S. (1994). Cytokines in adenoviral disease in children: Association of interleukin-6, interleukin-8, and tumor necrosis factor alpha levels with clinical outcome./. Pediatr. 124(5 Pt. 1), 714-20. 12. Innate Immune Responses to in Vivo Adenovirus Infection 3 7 3 58. Knowles, M. R., Hohneker, K. W., Zhou, Z., OlsenJ. C , Noah, T. L., Hu, P. C , Leigh, M. W., Engelhardt, J. F., Edwards, L. J., Jones, K. R., et aL (1995). A controlled study of adenoviral-vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis. N. Engl. J. Med. 333(13), 823-831. [See comments] 59. McElvaney, N. G., and Crystal, R. G. (1995). IL-6 release and airway administration of human CFR cDNA adenovirus vector. Nat. Med. 1(3), 182-184 [Letter]. 60. Ginsberg, H. S., Moldawer, L. L., Sehgal, P. B., Redington, M., Kihan, P. L., Chanock, R. M., and Prince, G. A. (1991). A mouse model for investigating the molecular pathogenesis of adenovirus pneumonia. Proc. Natl. Acad. Sci. USA 88(5), 1651-1655. 61. Prince, G. A., Porter, D. D., Jenson, A. B., Horswood, R. L., Chanock, R. M., and Gins berg, H. S, (1993). Pathogenesis of adenovirus type 5 pneumonia in cotton rats (Sigmodon hispidus)./. Virol. 67(1), 101-111. 62. Boucher, R. C. (1999). Status of gene therapy for cystic fibrosis lung disease. / . Clin. Invest. 103(4), 441-445. [Comment] 63. Elkon, K. B., Liu, C. C , Gall, J. G., Trevejo, J., Marino, M. W., Abrahamsen, K. A., Song, X., Zhou, J. L., Old, L. J., Crystal, R. G., and Falck-Pedersen, E. (1997). Tumor necrosis factor alpha plays a central role in immune-mediated clearance of adenoviral vectors. Proc. Natl. Acad. Sci. USA 94(18), 9814-9819. 64. Cook, D. N., Beck, M. A., Coffman, T. M., Kirby, S. L., Sheridan, J. F., Pragnell, L B., and Smithies, O. (1995). Requirement of MIP-1 alpha for an inflammatory response to viral infection. Science 269(5230), 1583-1585. 65. Xing, Z., Zganiacz, A., Wang, J., Divangahi, M., and Nawaz, F. (2000). IL-12-independent Thl-type immune responses to respiratory viral infection: Requirement of IL-18 for IFN- gamma release in the lung but not for the differentiation of viral-reactive Thl-type lympho cytes./. Immunol. 164(5), 2575-2584. 66. Matsukawa, A., Flogaboam, C. M., Lukacs, N. W., Lincoln, P. M., Strieter, R. M., and Kunkel, S. L. (2000). Endogenous MCP-1 influences systemic cytokine balance in a murine model of acute septic peritonitis. Exp. Mol. Pathol. 68(2), 77-84. 67. Sly, P. D., Soto-Quiros, M. E., Landau, L. I., Hudson, L, and Newton-John, H. (1984). Fac tors predisposing to abnormal pulmonary function after adenovirus type 7 pneumonia. Arch. Dis. Child 59(10), 935-939. 68. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75(2), 207-216. 69. Smith, T. A., Mehaffey, M. G., Kayda, D. B., Saunders, J. M., Yei, S., Trapnell, B. C , McClelland, A., and Kaleko, M. (1993). Adenovirus mediated expression of therapeutic plasma levels of human factor IX in mice. Nat. Genet. 5(4), 397-402. 70. Benihoud, K., Saggio, I., Opolon, P., Salone, B., Amiot, F., Connault, E., Chianale, C , Dautry, F., Yeh, P., and Perricaudet, M. (1998). Efficient, repeated adenovirus-mediated gene transfer in mice lacking both tumor necrosis factor alpha and lymphotoxin alpha. / . Virol. 72(12), 9514-9525. 71. Zhang, H.G. , Zhou, T., Yang, P., Edwards, C. K., 3rd, Curiel, D. T., and Mountz,J. D. (1998). Inhibition of tumor necrosis factor alpha decreases inflammation and prolongs adenovirus gene expression in lung and liver. Hum. Gene Ther. 9(13), 1875-1884. 72. Minter, R. M., Rectenwald, J. E., Fukuzuka, K., Tannahill, C. L., La Face, D., Tsai, V., Ahmed, I., Hutchins, E., Moyer, R., Copeland, E. M., 3rd, and Moldawer, L. L. (2000). TNF- alpha receptor signaling and IL-10 gene therapy regulate the innate and humoral immune responses to recombinant adenovirus in the lung. / . Immunol. 164(1), 443-451. C H A P T E R Humoral Immune Response Catherine O^Riordan Genzyme Corporation Framingham, Massachusetts I. introduction Replication-deficient adenovirus vectors are useful tools for the transfer and expression of therapeutic genes into various types of cells and tissues. They have rapidly emerged as the most efficient system of in vivo gene delivery and are w îdely used for gene therapy in basic research and clinical trials. It is now^ well recognized, how^ever, that there are many limitations to the use of adenovirus vectors in gene therapy applications. In particular there is a grov^- ing body of evidence that suggests that immune responses against components of viral vectors limit gene expression and may induce immunopathological consequences. For the most part immune responses consist of conventional antigen-specific lymphocyte responses; in addition, however, there is a nonspe cific and innate response inherent to cells such as macrophages, natural killer cells and organ parenchymal cells. Antivector immune responses can be broadly divided into cellular and humoral. While the cellular immune response limits duration of transgene expression, the humoral response may reduce the therapeutic efficacy of repeated vector administration. It is also emerging that the humoral immune response to viral vectors is not limited to responses against the viral vector components but also includes anti-transgene responses that can affect the persistence of transgene expression. If gene therapy is to be successful the host immune response to the viral vector needs to be overcome. In the case of adenoviral vectors there is a robust immune response following systemic or local administration of vector. Most notably there is a significant rise in neutralizing antibodies directed against the virus which can preclude repeat administration of the vector. This may be a disadvantage in definitively correcting genetic defects where repeated administration of vector would be required. An additional problem potentially ADENOVIRAL VECTORS FOR GENE THERAPY 3 7 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 3 7 6 Catherine O'Riordan exists for human gene therapy apphcations in that most individuals have preexisting immunity to adenovirus; thus, even the first administration of an adenovirus vector to some patients is Ukely to be ineffective. In this chapter the humoral immune response to adenovirus-based vectors is discussed, in particular the many strategies that have been developed to overcome this problem are review^ed. Such strategies include modifications to the viral vector in addition to approaches that modulate the host immune response of the recipient organism. II. Adenovirus Structure and Serotype A. Classification of Adenoviruses The human adenoviruses (Ads) belong to the genus Mastadenovirus and to date 51 serotypes of human Ads have been recognized [1] and grouped into six groups (A to F) [2] on the basis of their hemagglutinating properties and biophysical and biochemical criteria.
Genera of the adenovirus (Ad) family have been further subdivided into numerous serotypes (Table I). Serotype is defined on the basis of its immunological distinctiveness as determined by quantitative neutralization with animal antisera [3]. The most common serotypes used for gene therapy applications are Ad2 and Ad5 both belonging to group C. Virus is only neutralized by antibodies raised against antigens or virus of the same type. Thus for example, types 2 and 5 are in the same species group, but antibody to type 2 w îll only neutralize type 2 virus. Early studies on neutralization of adenovirus by antibodies demonstrated that although most of the antibody made is group-specific and can bind intact virus, only type-specific antibody can neutralize the virus [4, 5]. B. Adenoviral Structural Proteins and Type-Specific Epitopes Adenoviruses share a common architecture consisting of an nonenveloped icosahedral capsid surrounding a linear dsDNA genome of approximately Table I Adenovirus Serotypes Group Serotypes A 12,18,31 B 3,7 , 11, 14, 16 ,21 ,34 ,35 ,50 C 1 ,2 ,5 ,6 D 8, 9, 10, 13, 15, 17, 19, 20, 22, 23, 24, 25, 26, 27, 28, 29, 30, 32, 33, 36, 37, 38, 39, 42, 43, 44, 45, 46, 47, 48, 49, 51 E 4 F 40,41 13. Humoral Immune Response 3 7 7 36 kbp. The viral capsid is composed of three structural proteins: hexon, fibre, and penton base. Hexon is the major structural component, forming the 20 facets of the icosahedron, whereas pentons, being complexes of penton base with fibre, form the 12 vertices [6]. The Ad structural proteins, hexon, fibre and penton base, are the antigenic determinants for both group- and type- specific antibodies. The a determinant demonstrable on hexon is responsible for cross-reacting group antigen found on most of the known human and animal Ads, while the 8 determinant of fibre give rise to type-specific neu tralization antibodies. In addition, hexon possesses a complex arrangement of antigenic determinants, including those with genus, type, intersubgenus, and intrasubgenus specificities [7]. 1. Hexon Ad2 hexon and the closely related Ad5 have been extensively studied. Hexon was the first animal viral particle to be crystallized [8-11] and the Ad2 structure has been resolved by X-ray crystallography to 2.9 A resolution [12, 13]. These studies revealed the Ad2 hexon trimer as a hexagonal "pedestal" base from which a "tower" region projects outward into the solvent. Three surface loops, LI, L2 and L4 from each monomer interdigitate to form the tower domain (Fig. la, see color insert). Sequencing studies completed on adenoviruses from groups A, B, and C have confirmed that there are common sequences within the hexon protein coding domain that are extensively shared. More than 99% of the variability between the hexons of different Ad serotypes is accounted for in seven hypervariable regions [14] that map to the exterior of the protein and include the serotype-specific epitopes [11]. In contrast, the sequences that code for the pedestal are highly conserved. In the first reported X-ray crystallography of the structure of Ad2 hexon [13], there were some unexplained findings which have now been resolved by X-ray cyrstallographic analysis of Ad5 hexon [11]. In particular, the Ad5 hexon model provides new insights into the location of the type-specific epitopes; Ad2 and Ad5 hexon sequences are homologous (86% identity), so their molecular structures are closely related. The structure of the Ad5 hexon monomer (Fig. lb , see color insert) is in general similar to the previously described Ad2 hexon structure [13]. However, the most significant difference is the localization of seven hypervariable regions (HVRs), five of which mapped to the surface of the Ad2 hexon structure and two of which were buried. The new model for Ad5 hexon clears up this anomaly, with all the HVRs locating to the top of the molecule [13]. In efforts to define the hexon residues responsible for type specificity, several analyses have been made of adenovirus hexon primary sequences and of anti-peptide sera that can neutralize adenovirus in a type-specific manner [12-19). Results from these studies suggest that adenovirus-type determinants are localized to sequences within DEI and FGl in the Ad5 3 7 8 Catherine O'Riordan hexon (Fig. lb). For Ad2, type-specific domains have been mapped to unique sequences in loop 1 (amino acids 281-292) of the hexon and loop 2 (amino acids 441-455) (Fig. la), by generating neutralizing antibodies to peptides from each of these regions [19]. 2. Fibre Pentons are the vertex structures of adenovirus capsids. They consist of a penton base protein v^hich anchors a single fibre. The fibre is a trimeric protein [20-22] w^hich allows virus attachment to cells [23], prior to penton base-mediated entry [24, 25]. The fibre has a tail, a slender shaft of variable length, and a globular head [26, 27]. The head domain facilitates attachment and there is appreciable variation in head domain amino acid sequences, w îth several amino acids fully conserved [28]. Variation in head domain sequences may explain differences in receptor specificity betw^een serotypes. For instance human adenovirus serotypes 3 and 5 have been shown to bind to two different cellular receptors via their fibre knob domain [29]. Until recently little was known about the receptor responsible for Ad attachment. However, a 46-kDa protein. Coxsackievirus and adenovirus receptor (CAR), was identified as the receptor responsible for Coxsackie B virus infection of human and mouse cells. In addition, this protein also functions in adenovirus attachment and adenovirus-mediated gene delivery [30]. Fligh-resolution X-ray crystallography of adenovirus type 5 (Ad5) head has revealed much information on the organization of this domain [31]. From these studies it was determined that strongly recognized antigenic determinants containing linear epitopes map to the outer loops or uppermost ^-sheets in the fibre head or knob domain. Studies with peptide-based epitope mapping using polyclonal or monoclonal antibodies against both native Ad2 fibre, Ad2 or Ad5 head domain further support this observation [32-34] and demonstrate that the Ad2 knob domain contains a neutralizing type-specific epitope, a neutral izing group-specific epitope, and a nonneutralizing type-specific epitope [32]. 3. Penton Base Although hexon and fibre contain most of the epitopes recognized by neutralizing antibodies, there are epitopes on penton base that are also recog nized by some neutralizing antibodies [35]. Recent studies on the identification of immunoreactive domains on penton base show that there are three major immunoreactive regions [36]. One is located at the N-terminal domain, whereas the two others are symmetrically displayed on both sides of a conserved RGD motif, one overlaps the fibre-binding site. Interestingly, MAbs against these immunoreactive domains are not neutralizing. However, the RGD motif of penton base, which is involved in binding to cell integrins and internalization of virus, is thought to escape neutralization due to steric hindrance by the fibre protein which prevents IgG binding to all RGD sites on penton base within the intact virus [37]. 13. Humoral Immune Response 3 7 9 C. chimeric Adenovirus Vectors The value of the detailed structural studies on adenovirus hexon is of significance in the design of chimeric adenoviruses. Alteration of type-specific epitopes in hexon can be achieved by exchange of epitopes betv^een adenovirus serotypes. The practical significance of changing the type determinants of a vector v^ould be to allov^ readministration of a gene to a host with circulating neutralizing antibodies. Chimeric adenoviruses were created by replacing the entire hexon in Ad5 or just the hexon FGl loop (Fig. lb) with that from Ad2 [38], the rationale behind this being that type-determining epitopes are primarily associated with this loop. However, in spite of the serotype distinc tiveness of the chimeric hexon viruses, epitope similarity between the vectors resulted in a low level of cross-reactive neutralizing antibody. Thus exchanging the Ad5 hexon with the Ad2 hexon protein did not allow readministration to animals that had previously been exposed to Ad5 virus and thus had anti-Ad5 neutralizing antibodies [38]. In contrast attempts to isolate Ad5/Ad7 chimeras failed, suggesting that it may be difficult to exchange hexons between adenoviruses of greater evolutionary distance [38]. However, a recent study demonstrates that it is indeed possible to package the Ad5 genome into virus particles that contain hexon proteins from other Ad serotypes [39]. Using viruses that represent subtypes B (Ad3), D (Ad9), and E (Ad4), it was shown that Ad5 DNA could be packaged into capsids that contain the hexons of more divergent subtypes. An alternative strategy was employed in the generation of an Ad5/Adl2 chimera where rather than replacing the entire Ad5 hexon, the external loops of hexon were just replaced [40]. With this approach an Ad5/Adl2 hexon chimera was created by replacing all four loop domains of Ad5 hexon with those of Adl2 hexon [40]. Ad 12 is in subgroup A, which is evolutionary quite distant from the Ad5/Ad2 containing subgroup C [41]. This chimeric virus efficiently evaded host immunity in mice immunized previously with an Ad5 vector. The alteration of the type-specific epitopes is not limited to the exchange of epitopes between adenovirus serotypes. For example, an eight-amino-acid sequence from the major antigenic site in the VPl capsid protein of poliovirus type 3 was inserted into two regions of Ad2 hexon [42]. Antisera specific for the poliovirus sequence efficiently neutralized the modified adenovirus and antisera raised against the modified adenovirus recognized the VPl capsid protein of poliovirus type 3. The ability to switch hexons is most Ukely due to the considerable conservation of the amino acid sequence of hexon across subtypes [39]. As already discussed, more than 99% of the variability between hexons of different Ad serotypes is accounted for in seven hypervariable regions that map to the exterior of the protein and include the serotype specific epitopes (section II.B.l). Since hexon protein is a major antigenic determinant of the Ad capsid, this approach of switching capsids or replacing epitopes may prove 3 8 0 Catherine O'Riordan useful in reducing the antigenicity of therapeutic Ad vectors to allow repeated vector administrations. Thus modifications to the hexon structure can be used as a strategy to modulate the immune response to adenoviral vectors. D. Influence of Serotypic Variations on Adenoviral Cell Interactions Entry into and trafficking through target cells has been studied mainly with subgroup C viruses. Binding to target cells occurs via a high-affinity inter action between the fibre protein and the coxsackie-Ad receptor (CAR) on the cell surface [30]. Subgroup C adenovirus then rapidly enter cells by endocytosis through interaction of the penton base protein with vitronectin binding inte- grins on the cell surface, including avp3, avP5, am^l , and a5pi integrins [24, 43-46]. Endosomal membranes are lysed by adenovirus, allowing the escape of capsids to the cytosol [24, 47, 48]. Finally, adenovirus translocates to the nucleus by using microtubules in the cytoplasm, binds to the nuclear envelope, and inserts its genome through nuclear pore complexes [49, 50]. There are three viral interactions with the host cell entry pathway which can be influenced by serotypic variations in the capsid proteins: (i) different serotypes of adenovirus bind through different cell surface receptors [29, 51], (ii) the secondary virus-cell interaction mediated through penton base varies by serotype [24, 25, 43], and (iii) escape from the endosome may involve distinct mechanisms of vesicle disruption, again in a serotype-dependent manner [46, 51]. At least two points along the pathway of gene transfer by aden ovirus are susceptible to blockage by circulating antibodies, blocking the fibre protein-cellular receptor interaction (CAR) and escape from the endo some. Escape of the viral genome from the endosome can be inhibited by capsid-bound antibodies against both hexon, the major capsid component, and penton base [35]. Antihexon antibody is considered to be the dominant neutralizing antibody in response to adenovirus infection [35]. Neutralization by anti-hexon antibodies has single hit kinetics with an average of 1.4 antibody molecules bound per virion, and it is thought that bound antibody inhibits a low pH-induced conformational change that takes place in the acidic endo- somes [35]. During this conformational change the N-terminal region of the protein is exposed and antibodies directed against an N-terminal 15 K pro teolytic fragment can neutralize virus infectivity [52]. In contrast anti-penton base antibodies play a far less significant role in the neutralization of adenovirus compared to anti-hexon antibodies, inhibiting infection by only 50% [35]. As already mentioned (section II.B.3), this may be due to the architecture of the penton-base-fibre
complex where steric hindrance by fiber may prevent IgG binding to penton base. Although antifibre antibodies can neutralize adenovirus infection [35], there are reports claiming that fibre is not an important immunogen [4, 53]. Additionally, the immunogenicity of fibre varies; it is a relatively weak 13. Humoral Immune Response 3 8 1 immunogen if it is delivered as a purified protein and a relatively strong immunogen v^hen delivered in the context of a v^hole virus particle [54]. It is thought that anti-fibre antibodies do not possess true neutralizing activity until present at very high titer [55] and only then do they prevent transduction follow^ing a systemic administration of a gene therapy vector [35]. Use of an Ad chimera, adenovirus type 5 v^ith a fibre gene from Ad7A, [55] has helped define the contribution of the antifiber humoral immune response against adenovirus infection. The chimeric virus clearly demonstrated that under standard repeat administration conditions, in the rat, the antibody generated against the fibre gene is inconsequential with regard to neutraliz ing function, suggesting that the only capsid protein that is functioning as a dominant neutralizing epitope is the hexon trimer [55]. In addition, results from a human clinical trial follow^ing administration of an Ad vector suggest that anti-fibre antibodies are only neutralizing when acting in synergy with anti-penton base antibodies [56], III. Host Response to Gene Therapy Vectors Three phases have been described in the elimination of adenovirus after intravenous delivery [57]. Phase one involves innate immune mechanisms, which occurs within 24 h postinfection and accounts for the elimination of 90% of the adenoviral DNA. Phase two is mediated by the adaptive immune system and consists of a cytotoxic T lymphocyte (CTL) and/or antibody response to the transgene and/or to the viral proteins. Phase three is characterized by a slow and constant decrease of the transgene expression even in the absence of an immune response to the transgene and is thought to be the result of leaky expression of viral gene products which leads eventually to clearance of the transduced cells. A. Innate Immune Response Although immune-related mechanisms play a significant role in eliminat ing the recombinant Ad genome following in vivo administration of Ad vectors, it is not clear how the immune response to Ad vectors is initiated, i.e., for the immune system to be sensitized to Ad antigens. Studies by Worgall et al. [58] suggest that there is some initial destruction of the Ad vectors by innate immune mechanisms. In contrast to the antigen-specific, adaptive immune response, innate immune mechanisms comprise the immediate, nonantigen- specific events which include tissue macrophages, which act as scavengers to clear incoming pathogens. In addition tissue macrophages influence the ini tiation of the adaptive immune response. Innate pathways of virus clearance are also mediated by Kupffer cells within the liver [58]. Following the innate immune response a second phase of the immune response occurs, the adaptive immune response. This results in the generation of antibodies against viral 3 8 2 Catherine O'Riordan capsid proteins and transgene, i.e., the humoral immune response, in addition CTLs against viral proteins and transgene products ensue to generate the cellular immune response. B. Adaptive Immune Response: B-T Cell Interactions Activated T cells play a critical role in the generation of humoral and cellular immune responses. In general there are tv^o major classes of T cells, HelperTCell IL4 IL-2 IL.5 Î IFN Activate B^ells AdvateCTL's Figure 2 (a) Antigen-presenting cells (APCs) such as dendritic cells and macrophages ingest foreign proteins (viral particles) nonspecifically. Ingested antigens are processed intracellularly and presented as peptide fragments in the context of the MHC class II complex. Activation of the helper T cell occurs following recognition of the foreign peptide/MHC class II molecule by the T-cell receptor, TCR. In addition a second signal is required for helper T-cell activation which occurs when the plasma membrane bound signaling molecules B7-1/B7-2 are recognized by a coreceptor protein CD28/CTLA4-lg which is present on the surface of the helper T cell. Cellular immune response: At the same time viral vectors can infect (APCs) and deposit their genomes into the nucleus. The genome encodes viral and transgene proteins that are expressed and presented by MHC class 1 molecules to CD8+ cells or cytotoxic T lymphocytes (CTLs). (b) Foreign antigens are taken up from the extracellular fluid by receptor mediated endocytosis following binding to the B cell receptor. They are then degraded and recycled to the cell surface in the form of peptides bound to MHC class H molecules. Thus the helper T cell activates the B cell that displays the same antigen in the context of the MHC class II molecule as originally activated it. in addition, interaction of CD40 ligand with CD40 activates B cells to proliferate and mature into memory and antibody-secreting cells. In secondary antibody responses, memory B cells themselves may act as APCs and activate helper T cells as well as being the subsequent targets of the helper T cells. 13. Humoral Immune Response 383 Figure 2 (continued) cytotoxic CD8+ T cells (CTLs) and helper T cells (CD4+ T cells). In the context of a viral infection, CTLs eliminate virally infected cells expressing neoantigens such as viral proteins and the transgene product. In contrast, CD4+ T cells help activate the responses to extracellular antigens by stimulating B cells to proliferate and secrete antibodies. Activation of antigen-presenting cells (APCs) and B cells by input viral capsid proteins underlies the mechanism responsible for the production of the humoral immune response to Ad vectors. Administration of UV-inactivated virus leads to a full humoral response v^ithout any CTL involvement, v^hich is consistent v^ith the role of exogenous viral capsid proteins in the activation of B cells and of endogenously produced antigens in the activation of primary CD8+ cells [59, 59a]. Hov^ever, activation of CD4+ T cells by viral capsid proteins has been shov^n to contribute to CTL- mediated clearance of Ad-transduced cells in addition to stimulating B cells to produce neutralizing antibodies [59-60]. Activation of T cells by antigens requires a complex program of molecular interactions betv^een the T cell and an APC, each of which could be a target for immune blockade in gene therapy. Initiation of a T-cell-mediated response requires APCs v^hich present short peptides derived from ingested foreign antigens (e.g., a virus particle) in association v^ith major histocompatability (MHC class II) molecules to interact with the T-cell receptor (Fig. 2a). In 3 8 4 Catherine O'Riordan addition, there are other signals that are needed for successful stimulation of the T-cell response. These include B7-1 (CD80) and B7-2 (CD86) ligands present on antigen presenting cells which bind to the CD28 / CTLA4 receptors on T cells and elicit a costimulatory response needed for this activation [61]. Such costimulatory responses result in cytokine secretion and full T-cell activation (Fig. 2a). There are two functionally distinct subclasses of helper T cells that can be distinguished by the interleukins that they secrete upon activation. Thl cells secrete IL-2 and gammainterferon and are concerned mainly with helping cytotoxic T cells and macrophages, while Th2 cells secrete interleukin (IL)-4 and IL-5 and are concerned mainly with helping B cells (Fig. 2a). Once activated, the helper T cell can stimulate a B cell that specifically displays the same complex of foreign antigen and MHC class II protein on its surface (Fig. 2b). T-cell dependent activation of B cells in turn leads to upregulation of CD40 ligand (CD40L) on the T cell, promoting the engagement of CD40 on the cognate B cell [62] (Fig. 2b). IV. Strategies to Overcome the Humoral Immune Response The humoral and cellular immune response to recombinant adenoviral vectors, as described in several animal models, result in extinction of transgene expression, severe local inflammation, and production of neutralizing antibod ies that prevent readministration [59, 63, 64]. A direct correlation between neutralizing antibody and the block to readministration of vector has been established by passive transfer of immunity by sera from treated to naive animals [59]. One approach to enhance adenoviral-mediated gene transfer is to modulate the host immune response by immunosuppression of the recipient organism. A. General Immunosuppression Chronic immune suppression with drugs such as cyclosporine and cyclophosphamide has improved the stability of adenovirus-encoded trans- gene expression in animal models of liver-, lung-, and muscle-directed gene therapy [64-66]. Cyclophosphamide is a commonly used immune suppressive agent for the treatment of autoimmune diseases and prevention of rejec tion following allograft organ transplantation [67]. It is activated by hepatic cytochrome p450 to metabolites that exhibit toxicity primarily to dividing cells, including activated T and B cells [68]. Administration of cyclophosphamide with intravenous infusion of aden oviral vector blocked activation of both CTL and T helper cells, resulting in prolonged transgene expression in the liver with reduced anti-Ad neutralizing antibody production [66]. A similar effect was seen in the lung; however, a 13. Humoral Immune Response 3 8 5 much lower dose of cyclophosphamide was needed to prevent neutralizing antibody formation. In contrast, stabilization of transgene expression was achieved only at a high dose. This difference may be a consequence of dif ferences in the route of administration of the vector, which could result in differences in presentation of antigens. For example the intravenous route more likely deposits larger quantities of antigens to tissue enriched with antigen- presenting cells such as the spleen. In addition neutralization of virus in the lung is restricted to the Th2-dependent isotope, which is easier to ablate than ablation of both Thl and Th2 subsets which contribute to formation of antiviral responses when vector is delivered systemically [66]. In contrast cyclosporin (CSA) alone failed to reduce the production of neutralizing antibodies to cFIX in hemophilia B dogs but was effective at pro longing gene expression of FIX [64, 65]. CSA reportedly inhibits early events in T-cell activation such as activation of interleukin-2 gene expression [69], which may explain why CSA most likely affected the cellular rather than the humoral immune response following adenovirus-mediated gene therapy in the hemophilia B dogs. One of the main concerns with the protocols used in animal models for general immunosuppression is the high dose necessary to successfully obtain readministration of gene therapy vectors. This is substantially higher than approved doses for use in humans. Thus it remains to be established whether clinically acceptable doses (presumably lower doses) may indeed have the same effect on immunosuppression and allow readministration of gene therapy vectors in a clinical setting. Bouvet et al. [70] report that etoposide at clinically acceptable doses suppresses the formation of neutralizing antibodies and CTLs to adenovirus and results in successful intratumor transgene expression in immunized mice. Etoposide is a semisynthetic derivative of podophyllotoxin that causes an arrest at G2 of the cell cycle. It inhibits DNA synthesis by interfering with the enzyme topoisomerase II and leads to cell death by apoptosis [71]. Thus repeated adenoviral-mediated gene therapy may be achievable in cancer patients who are concurrently undergoing treatment with chemotherapy. Most of the immunosupressants discussed so far have the distinct dis advantage of causing general immunosuppression that may not be desirable in some clinical settings. An alternative immunosuppressant, deoxyspergualin, (DSG), with more selective properties has been shown to be useful in read ministration of systemically delivered viral vectors expressing Factor IX [72] or lung-directed viral vectors expressing the human cystic fibrosis conductance regulator (hCFTR) [73]. Deoxyspergualin interferes with the differentiation of B and T cells and also with antigen processing. An important property of DSG is that it does not induce a general suppression of the immune system, but rather results in a selective lack of response to specific antigens presented at the time of drug treatment. 3 8 6 Catherine O'Riordan B. Transient Selective Immunosuppression The central role of the CD4"^ T cell provides a strategy to prevent humoral and cellular responses to adenovirus vectors through a transient blockade of CD4+ T-cell activation at the time of vector administration. The rationale for this approach is that chronic immune suppression should not be necessary if the primary stimulus for activation is the input capsid proteins. In support of this hypothesis, it has been shown that depletion of CD4^ T cells w îth a monoclonal antibody (GK1.5) at the time of vector administration can effectively prevent CTL and B-cell responses in murine models of liver- and lung-directed gene therapy [74-76]. 1. Cytokine
Treatment Selective inhibition of the TH2 subset of T helper cells by administration of the cytokine interleukin 12 or gamma interferon (IFNy) v^ith adenovirus vector has prevented the humoral immune response in mouse lung tissue [77]. The success of this approach, how^ever, depends on the relative contribution that Th2-dependent immunoglobulin (Ig) isotypes play in virus neutralization, the profile of which may be affected by strain and species of animal as well as routes of vector administrations. Th2-specific ablation with IL-12 is an effective approach for lung-directed gene therapies in the mouse where IgA is the primary source of neutralizing antibodies. However, in the case of the mouse liver both Thl and Th2 cells contribute to the production of virus- specific antibodies and although IL-12 reduced the total amount of neutralizing antibody in this organ it was not enough to allow effective readministration of the virus [75]. 2. CTLA4 Ig Interfering with the distal pathway of CD4+ activation by administering CTLA4 immunoglobulin (Ig) with adenovirus vector improved the stabil ity of recombinant gene expression in mouse liver but did not significantly impact neutralizing antibody production or allow systemic vector readmin istration [78]. muCTLA4Ig is a chimeric protein of murine immunoglobulin IgG2a fused to murine CTLA4 and is an inhibitor of the CD28-B7 pathway (Fig. 2a). In contrast in the lung huCTLA4-Ig treatment significantly blocked the formation of neutralizing antibodies allowing efficient readministration of virus, whereas transgene expression was only moderately prolonged [79]. Differences between the effects of this drug on humoral and cellular responses in lung versus liver are surprising. It is known that secretory IgA, which depends on Th2 cells, contributes to neutralization in the lung, whereas antibodies of other isotypes, such as IgGl and IgG2a, neutralize virus adminis tered systemically. As previously discussed, different routes of virus instillation may result in different mechanisms of antigen presentation, which could affect 13. Humoral Immune Response 3 8 7 inhibition of B- and T-cell activation by CTLA4Ig. For example, local injection of an adenovirus vector expressing CTLA4 Ig into the brain suppressed not only local cell infiltration in this tissue but also reduced the humoral immune response to adenovirus [80]. 3. Anti-CD40 Ligand Antibody The expression of CD40L by activated helper T cells (Th) triggers B cell cycling through binding to CD40 (Fig. 2b). CD40L is expressed transiently at high levels on activated CD4+ T cells [81, 82]. The costimulation provided by CD40L w îth CD40 is essential for thymus-dependent humoral immunity [82, 83] and is also thought to play an important role in the generation of cellular immune responses through the production of helper cytokines [83, 84]. A transient block of costimulation between T cells and B cells and other antigen- presenting cells using a monoclonal antibody against CD40 ligand (MR-1) suppressed the development of antibodies against Ad delivered to mouse or nonhuman primate lung, in addition to decreasing the cellular immune response to the vector [85-87]. This in turn resulted in an increase in persistence of transgene expression. Furthermore, when MRl was administered with a second dose of Ad vector to mice preimmunized against vector, it was able to interfere with the development of a secondary antibody response and allowed for high levels of transgene expression upon a third administration of vector to the mouse airway [86]. Similarly in the nonhuman primate lung administration of a humanized anti-CD40 ligand MAb (hu5C8) at the time of vector instillation, markedly suppressed adenovirus-induced lymphoproliferation and cytokine responses, in addition there was a marked suppression of IgA and neutralizing antibodies which permitted vector readministration [87]. In the case of systemic delivery of vector it is thought that only CD40 ligand blockade inhibits anti-Ad antibody generation sufficiently to allow redosing to the liver [88]. Thus a combination of anti-CD40 ligand and murine CTLA4Ig was necessary to allow transduction after secondary vector administration in mouse liver, whereas neither agent alone was sufficient [89]. C. Oral Tolerance Orally administered antigens have been shown to induce systemic unre sponsiveness to a subsequent exposure to the antigen. Oral tolerance primarily results in active suppression by regulatory T cells, clonal anergy, or clonal deletion. What activates one mechanism over the other is not altogether clear, although it is generally agreed that lower doses of antigen more likely lead to suppression and higher doses to clonal anergy or deletion [90]. In addition, the form of antigen and frequency of feeding influences the type of tolerance induced [91]. Long-term adenovirus-based gene expression was observed in the liver of rats with preexisting anti-adenovirus antibodies that were tolerized by feeding 3 8 8 Catherine O'Riordan viral proteins (11 x 1-mg dose) [92]. In the tolerized rats the anti-adenovirus humoral immune response was downregulated allowing systemic readminis- tration of vector. Moreover, in the tolerized rats vector readministration did not lead to a secondary humoral immune response, suggesting that repeated adenovirus-directed gene transfer may be possible despite the presence of a residual antibody titer from a previous exposure to vector [92]. Similarly, this approach has been used to enhance gene transfer to the rat parotid gland which is within the mucosal immune system [93]. As it is more difficult to induce complete mucosal tolerance compared to systemic tolerance only partial tolerance to mucosally applied viral vectors was achieved. A different feeding regimen of adenovirus (5 x 50 \|JLg dose) along with a different form of antigen, UV inactivated vector, in addition to a difference in route of viral challenge may explain the differences in the results from the two studies. Nonetheless, it is possible to induce some degree of tolerance to mucosally applied adenovirus by feeding animals the virus. In clinical situations, some concern may exist about tolerizing a host toward adenoviruses, which can be pathogenic in humans. D. Serotype Switching One strategy to circumvent Ad vector-specific neutralizing immunity is to switch the serotype of the Ad vector [94, 95]. As already discussed in section II. A, there are 51 serotypes that are classified on the basis of biological, chemical, immunological, and structural properties into six subgroups and then into serotypes based on neutralization by antisera to other Ad serotypes. Following an initial administration of adenovirus, serotype-specific antibodies are generated against the major viral capsid proteins (section II.B). Group C adenoviruses include Ad2 and Ad5, the more commonly used serotypes for gene therapy vectors. While the capsid proteins of the group C adenoviruses are highly conserved, viruses from a different subgroup have capsid proteins which are only weakly homologous to the group C viral capsid proteins. Thus the immune response against the non-group-C viruses in many instances does not block infection by a group C virus [94]. This was demonstrated in a study where Sprague-Dawley rats were injected intraperitoneally (ip) with wild-type Group B virus, WT Ad7, either alone or sequentially with WTAd4 (group E) prior to intracardial administration of an Ad5-based gene transfer vector [94]. Transgene expression in all animals that received non-group-C viruses prior to Ad5 was equivalent to naive animals. In contrast, animals that received WT Ad5 prior to the Ad5-based gene transfer vector had greatly reduced levels of transgene expression compared to naive animals. Similarly, in the development of gene therapy vectors for the lung and the treatment of cystic fibrosis, it was shown that intratracheal administration of an immunizing does of wild-type Ad 4 (subgroup E) or Ad30 (subgroup D) 13. Humoral Immune Response 3 8 9 did not affect the subsequent expression of human CFTR from an Ad5 based gene transfer vector [95]. More importantly the alternate use of Ad vectors from different serotypes (Ad2, Ad5) within the same subgroup (C) can also circumvent anti-Ad humoral immunity and permit effective gene transfer to the lung [96] and to the liver [97] upon repeat administration. In the context of future clinical applications for this approach it is relevant that Ad2- and Ad5-based vectors can be administered alternately as these are the Ad serotypes that are in current use in human clinical trials. E. Masking Neutralizing Epitopes Alternative approaches have been developed for circumventing antibody neutralization of Ad vectors that are centered on modification of the Ad virion rather than on immunosuppressive treatment of recipient animals [98-101]. One such approach involves the covalent attachment of the polymer PEG (polyethylene glycol) to the surface of adenovirus [99^ 100]. Covalent mod ification of Ad virions using chemically reactive PEG renders the virus less susceptible to neutralization, due to shielding of neutralizing epitopes on the surface of the virus by PEG molecules. The components of the capsid that elicit a neutralizing immune response, i.e., hexon, fibre, and penton base (see section II.B) are the main targets for PEGylation. Importantly the covalent attachment of a PEG polymer to the surface of the adenovirus can be achieved with retention of infectivity, while PEG-modified adenovirus have been shown to be protected from antibody neutralization in the lungs of mice with high antibody titers to adenovirus [99, 100]. Similarly, Beer et al, [98] demonstrated that adenovirus vectors could be formulated in a polymer preparation of PLGA (poly(lactic/glycolic acid) with retention of bioactivity. Mice immunized subcutaneously with encapsulated recombinant adenoviral vectors show a greater than 45-fold reduction in anti- adenovirus titers relative to nonencapsulated vectors. Although the authors do not show any in vivo data they postulate that the process of encapsulation of a vector in a polymer preparation may potentially mask the adenovirus from circulating antibodies. This is also based on the observation that encapsulated vectors are less susceptible to neutralization than nonencapsulated vectors in vitro. The possible disadvantages of this approach include the efficiency at which the Ad vector is released from the polymer and the true demonstration that this approach has any advantage in vivo. More recently another nongenetic strategy to modify the surface of the virion has been described. This involves a covalent coating using a multiva lent hydrophilic polymer based on poly-[N-(2-hydroxypropyl)methacrylamide] (pHPMA). Multivalent polymeric modification of adenovirus rendered the virus less susceptible to neutralization by anti-adenovirus antibodies. As with the studies with PLGA this approach was shown only to be effective in vitro and may not be applicable in an in vivo setting. 3 9 0 Catherine O'Riordan F. Immunoapheresis Another novel approach to overcoming the problem of serum neutralizing antibodies w âs described by Chen et al. [102], and involves the principle of immunoapheresis. An affinity column consisting of cloned recombinant capsid proteins v^as generated to specifically remove anti-adenovirus antibodies from human clinical serum samples. The authors postulate that such an affinity column could be used in conjunction w îth apheresis in a technique called immunoapheresis. During the apheresis procedure, patients' serum could pass through this immunoaffinity column removing anti-adenovirus antibodies. Anti-adenovirus antibodies would be expected to repopulate the vascular compartment eventually but a temporal v^indow of several hours for intravascular adenovirus therapy could be created [103]. V. Factors Modulating Host Responses to Gene Transfer Vectors The immune response generated to adenoviral vectors can be broadly divided into cellular and humoral responses. The cellular immune response results in cytotoxic T cells against viral proteins and transgenes that can lead to the destruction of vector-transduced cells and reduced persistence of transgene expression. In addition, there is the humoral immune response against both capsid proteins and transgene. The design of the vector backbone has been shown to influence the persistence of transgene expression by modulating the cellular immune response. Similarly, the use of tissue-specific promoters to drive transgene expression can modulate the humoral immune responses to the transgene product. A. Viral Vector Backbone 1. First-Generation Adenoviral Vectors First-generation adenoviral vectors are typically deleted for El and some times for E3, which result in decreased expression of early and late genes and deficient replication of the virus (Fig. 3). Multiple studies performed with these vectors in mice. Cotton rats, and nonhuman primates have shown successful gene transfer in a variety of tissues with high levels of expression of trans- genes [104-107]. However, a major shortcoming of these El-deleted vectors is the general loss of transgene expression at 3-4 weeks after administration [59^ 63, 108], although administration to neonatal or immune-deficient animals frequently results in more persistent expression [64, 63, 109]. The replication defect of El-deleted viruses can be overcome in part because cellular factors complement the function of the El gene, leading to the expression of viral 1 3 . H u m o
r a l I m m u n e Response 391 A d 2 D N A G e n o m e 3 6 k b p E 3 E 1 A E 1 B ITR ITR E 2 E 4 R e c o m b i n a n t A d E 3 ITR E 2 E 4 Promoter T ransgene Figure 3 Schematic of adenovirus genome. The bar indicates the DNA genome of 36 kb. The black arrows indicate the transcription units: El A immediate-early transcription unit and the delayed-early ElB, E2, E3, and E4 transcription units. The expression cassette replacing the El region is depicted. The cassette contains a promoter with transcriptional elements used to drive expression of the transgene. The transgene is the open reading frame in the recombinant transcript that translates the desired protein. First-generation adenoviruses are made by substituting an expression cassette for the El and/E3 regions. Second-generation adenovirus vectors are generated by the additional deletion of genes necessary for viral replication, e.g., E2a DNA-binding protein [114, 115]; E4 region [113]; the E2b-encoded terminal protein and viral DNA polymerase [120]. Third-generation vectors are vectors deleted for all viral genes, but retain the c/s-acting sequences necessary for viral replication and packaging (see Chapter 15). proteins that are presented in the context of MHC class 1 molecules to elicit a cytotoxic T-cell response [63]. For these reasons additional changes have been introduced into the backbone of adenovirus vectors to render them more replication-defective and thus further reduce their potential for viral gene expression. 2. Second-Generation Adenoviral Vectors Tvŝ o regions of adenovirus, E2 and E4, v\̂ hich play critical roles in viral DNA synthesis and late gene expression have been targeted for dele tion [110-113]. A temperature-sensitive mutation, ts l25, and a deletion have been introduced into the E2a region [111, 114, 115], vectors containing this mutation show^ed prolonged transgene expression in CBA mice. Cotton rats, and nonhuman primates. Hov^^ever, contrary to these reports, a recent study using BALB/C mice and hemophilia B dogs demonstrates that this E2a mutation 3 9 2 Catherine O'Riordan is insufficient for achieving persistent expression [116]. In the case of E4-deleted vectors long-term gene expression is dependent on both the promoter used to control expression and the context of the E4 region [110]. Interpretation of the earlier v^ork on deletions in the E2 and E4 regions were complicated by the immunogenic transgenes w^hich w êre used in these studies [117, 118]. Another version of a second-generation vector w âs generated using a nonimmunogenic protein the hCFTR [119]. The vector contained w^ild-type E2 and E4 w îth a partial deletion in the E3 region and w^hen instilled into the lungs of various strains of immunocompetent mice persistent transgene expression w âs mea sured in lung tissue up to 70 days. In this vector the persistence of transgene expression w âs attributed in part to the CMV enhancer-promoter used for transgene expression in conjunction with a wild-type E4 region [110, 119]. Other groups have also reported on the optimization of vectors deleted for El and DNA polymerase. This significantly modified vector expressing the highly immunogenic P-gal transgene was shown to persist in the livers of immunocompetent mice for up to 2 months [120]. Such a vector could have broad benefits for use in human gene therapy in which the encoded transgene may be seen as a neoantigen by the human immune system. 3. Helper-Dependent Vectors More recently, vectors deleted for all viral coding sequences (helper- dependent or "gutless" Ad vectors) have been developed, so that leaky expression of viral protein is eliminated [121-124] (see Chapter 15). Such a helper-dependent vector has been generated which contains the entire human alpha 1-anti-trypsin gene under the control of a tissue (liver)-specific pro moter. This vector results in more than 1 year of stable expression, provides supraphysiological levels of hAAT in the mouse, and demonstrates less hepato- toxicity compared with first-generation vectors [125, 126]. Although many of the advantages of this gutless vector can be attributed to elimination of leaky viral gene expression it was later shown that the inclusion of a tissue-specific promoter also helped reduce the development of a host immune response to the transgene [127]. 4. Tissue-Specific Promoters The use of tissue-specific promoters may be helpful in avoiding host immune responses to transgenic proteins in human gene therapy, the rationale behind this being that expression in antigen-presenting cells would be greatly reduced. Thus the transcriptional unit responsible for expression of the trans gene in an adenoviral vector could have a substantial effect on the nature of the ensuing immune response. Most experiments have used constitutively active promoters that may express efficiently in dendritic cells. A reduced immune response is seen with vectors that contain more specific promoters, which may not express efficiently in antigen presenting cells [127]. For example, when a helper-dependent Ad vector expressing the hAAT cDNA from a liver-specific 13. Humoral Immune Response 3 9 3 promoter was used to express hAAT in C3H/HeJ mice, anti-hAAT antibodies did not develop and long-term expression of hAAT resulted [128]. In contrast, use of a non-liver-specific promoter to drive expression of the same transgene resulted in antibody production to hAAT in the same mouse strain. Thus, vector-specific differences in transgene expression w^ithin APCs due to choice of promoter could explain some of the variation in immune responses that have characterized in vivo applications of gene therapy vectors. 5. E3 Region In addition to making progressive deletions of the adenoviral backbone other groups have coexpressed the Ad early region (E3) v^ith the transgene of interest [128]. Injection of Ad-overexpressing E3-encoded gene products leads to inhibition of cytotoxic activity tov^ard Ad-infected cells in addition to marked down regulation of antibody formation to structural viral proteins. Genes encoded by the E3 region downregulate surface MHC class I expression, which in turn interferes with presentation of viral peptides and reduced CD8-h cytotoxic T lymphocytes. Thus the absence of Ad-specific CTLs in animals injected with this vector was expected. What was unexpected was the inhibition of a humoral antibody response to this E3 overexpressing vector. The authors suggest that transduction of an E3 containing Ad vector into liver cells in the absence of CTL or TNFa-induced cytolysis may result in poor antigen release, consequently there is little antigen presentation by APCs to initiate an antibody response. TNFa is one of the cytokines that controls dendritic cell maturation and migration; thus, early antigen presentation may be downregulated by inhibition of this cytokine by E3 proteins [128]. However, other studies using an Ad vector overexpressing the herpes simplex ICP47 gene suggest that use of any vector that downregulates MHC class I presentation should be assessed carefully [129]. Coexpression of ICP47 has a similar result to expression of E3 in that there is downregulation of MHC class I presentation. Administration of this vector to the lungs of rhesus mon keys inhibited the generation of Ad-specific CTLs. However, natural killer cell activity was enhanced, suggesting that strategies to protect the Ad-transduced cell without interfering with MHC class 1 expression should also be explored. B. Species and Strain To date the majority of animal studies evaluating the efficacy of aden ovirus vectors have been performed with vectors expressing bacterial or human proteins. Clearly these proteins also constitute potential antigens recognized as foreign by the host immune response. Administration of vectors encoding the murine erythropoietin resulted in long-lasting elevated hematocrit lev els in mice [130]. In contrast, injection of adenoviruses carrying the human erythropoietin induced a strong immune response directed against the human protein, which resulted in transient expression of the transgene. 3 9 4 Catherine O'Riordan Most in vivo studies are performed in inbred mouse strains of various MHC haplotypes whose immune systems might react differently to a given antigen. Inbred immunocompetent C57BL/6 mice have been a favored strain to study transgene expression of human blood coagulation Factor IX from viral vectors. This is in part because systemic expression of the secreted protein is not limited by antibody responses following intravenous (iv) injection of vector. Importantly iv injection of an Ad vector results in sustained expression of human FIX in normal or hemophilic C57B1/6 mice, while antibodies against FIX develop in other strains [131, 132]. A similar observation was seen with an Ad vector encoding human Factor VIII under the control of a liver-specific promoter following treatment of hemophilic C57B1/6 mice. High-level human FVIII expression was detected in the serum of the mice for over 5 months with no antibody production against the transgene [133]. In contrast treatment of FVIII-deficient hemophilic dogs with an Ad vector encoding human FVIII resulted in a strong antibody response directed to the human protein [133]. A reason for the difference in antibody response between different mouse strains was thought to be due to the MHC haplotype. C57BL/6 mice (haplotype H-2b) lack MHC class II allele IE, and may therefore have some deficiency in humoral immune responses. However, mice of another strain with the same haplotype, and therefore the same lack of the IE allele, did mount an immune response to human FIX following systemic administration of a similar adenoviral vector. This suggests that the data produced in studies based on C57BL/6 mice often cannot be extrapolated to other species. The mechanism of tolerance to FIX or FVIII by iv injection of adenoviral vector in C57BL/6 mice remains elusive, but illustrates the difficulty of extrapolation of results obtained in inbred strains of mice and highlights the importance of studies in other animal models [132]. Similarly, others have reported [109, 134] that intravenous administra tion of an El-deleted adenovirus vector carrying the human alpha-antitrypsin (hAAT) cDNA leads to a strain-related variation in persistence of expression of transgene. Transient expression of hAAT was seen in C3H/HeJ and Balb C mice with longer persistence of expression seen in C57B1/6 mice [109, 134]. Persistence was shown to correlate with poor anti-hAAT antibody formation in these mouse strains while Balb C and C3 H mice developed significant levels of anti-hAAT antibodies which resulted in a corresponding disappearance of hAAT in the serum [134]. In contrast, when a helper-dependent Ad vector expressing the hAAT cDNA from a liver-specific promoter was used C3H/HeJ mice failed to develop antibodies and demonstrated long-term expression of hAAT [127]. Careful identification and characterization of the host factors involved in the formation of anti-transgene antibody responses should provide insight into the development of useful gene therapy systems for the treatment of patients with genetic diseases involving null mutations. A good understanding 13. Humoral Immune Response 3 9 5 of these immune responses is critical to the appropriate interpretation of many previous gene therapy studies and to the design of future studies. Ahhough new generations of adenoviral vectors may offer many advantages compared to first-generation vectors in terms of persistence of transgene expression, it is important to establish an improved experimental paradigm to evaluate the effect of vector modifications on transgene expression, especially in the context of a highly immunogenic transgene. C. Route of Delivery 1. Intravenous versus Intraperitoneal Studies by Gahery-Segard et al. [135] investigating the humoral immune response to Ad capsid components demonstrated that routes of immunization modulate virus-induced Ig subclass shifts. Two routes of immunization, intra venous (iv) and intraperitoneal (ip) w êre compared for the response induced against the adenovirus particle in particular the three major components of the viral capsid, hexon, penton base, and fiber. The molecular components of the viral capsid are differentially recognized depending on the route of administration. The sera from mice immunized ip recognized only the hexon protein and a preferential switch to the IgG2a subclass was obtained. The sera from mice immunized iv had a more complex response. At the beginning of the response an isotype bias toward the IgG2a subclass was observed, but the isotype distribution changed during the period of the response. Neutralizing activity was maximum 45 days after immunization by both routes. However, iv serum displayed a higher neutralizing activity than ip serum, while the two routes of immunization did not induce the same IgG isotypes to neutralize viral infectivity. 2. Lung Instillation The delivery of adenoviral vectors to the lung has received much attention due to the concerted efforts of many groups to develop gene therapy vectors for the treatment of lung disorders such
as cystic fibrosis. To correct the CFTR defect, CFTR cDNA needs to be delivered to the respiratory epithelium in situ and must direct gene expression independent of cell division. Many groups have shown that Ad vectors can deliver CFTR cDNA to airway epithelial cells, leading to protein expression [105, 108, 136] and correction of the CF phenotype in vivo and in vitro [137-139], although the efficiency of repeated Ad administrations is diminished by the development of serum and mucosal neutralizing antibodies to the Ad vector [140]. In a study with repeat administrations to the nonhuman primate lung both IgG and sIgA antibodies against Ad2 were detected and it was shown that sIgA alone can contribute to neutralization of the infectivity of Ad particles entering the lung [105, 140, 141]. 3 9 6 Catherine O^Riordan 3. Delivery to the Brain Interestingly, injection of an El-deleted adenovirus into the brain trig gered a humoral immune response to the adenovirus and its gene products but no neutralizing antibody was detected thus repeat administration of the adenovirus w âs possible [142]. The authors claim that one reason for the lack of neutralizing activity may be due to the relative immunological privilege in the brain. Similarly, when adenovirus vectors are injected into the subretinal space, which is also considered to be immunologically privileged, they do not elicit humoral immune responses and repeated administration of adenovirus vectors is possible [143]. Thus there are regions within the body that may be more resistant to immune clearance on the basis of their anatomic structure. The retina for example, which is a derivative of the central nervous system, has the equivalent of a blood-brain barrier. In another report intranasal immunization of mice with wild-type adenovirus 1 month before intratumoral administration with an Ad vector of the same serotype did not efficiently inhibit repeat administration to the tumor [144]. It is likely that the structural integrity of the tumor or the extracellular matrix around the tumor presented a barrier to the neutralizing antibodies. 4. Intramuscular Delivery More recently it was shown that effective repeat administration of adenovirus vectors to muscle was not hindered by the presence of neutralizing antibodies in the serum [145]. The authors reasoned that the concentration of adenovirus-specific neutralizing antibodies in the muscle may be considerably lower than in the serum, thus permitting effective multiple dosing to the muscle. The ability to repeat dose to the muscle has significant implications for cardiovascular gene therapy where it has been shown that intramuscular administration of adenovirus vectors expressing vascular endothelial growth factor (VEGF)-stimulated angiogenesis in hind-limb ischemia in rats [146]. Thus, the ability to repeat dose to the muscle for both peripheral and coronary vascular disease could significantly improve the efficacy of gene therapies for cardiovascular disorders. VI . Immune Response to Adenoviral-Based Vectors in Humans Host immune response can play a significant role in the outcome of in vivo gene therapy. Experiments with adenoviral vectors clearly demonstrate the development of neutralizing antibodies that block readministration and cellular responses that extinguish gene expression. However, most of the work described in this field relates to animal models that are naive to the virus. This will not be the case in humans, many of whom have been exposed 13. Humoral Immune Response 3 9 7 to Ad due to a naturally acquired infection. A study performed by Chirmule et al. [147] surveyed normal subjects and cystic fibrosis patients to demonstrate the relevance of pre-existing immunity to Ad to the outcome of in vivo gene therapy. They found that antibodies reactive to Ad capsid proteins were present in 97% of individuals; however, serum from only SS% of subjects actually neutralized Ad infection in vitro. Due to this discrepancy between seropositivity and neutralization of virus in vitro, the authors suggest that human trials should include all patients irrespective of in vitro measurements of preexisting immunity. This conclusion is also based on results from a Phase 1 gene therapy clinical trial for localized mesothelioma where it was shown that preexisting humoral immune responses did not preclude gene transfer [148], Similarly, in human clinical trials where an adenovirus vector encoding hCFTR was repeatedly administered to the nasal epithelium of patients with cystic fibrosis [149], a complex immune response ensued which varied from patient to patient. Importantly, the pattern of the immune response did not differentiate patients with either large or absent correction of the CF defect following exposure to an Ad/CFTR vector [149]. Thus, what are the strengths and the limits of using experimental animals to predict human responses to gene transfer vectors? The intensity and the nature of the anti-Ad humoral immune response in experimental animals is dependent on the dose and on the route of administration of the vector. But is this the case in humans? To address this question a study was designed to determine the variability of human systemic humoral immune responses to adenovirus administered to different organs [150]. The study aimed to determine (a) if the administration of Ad vectors to humans always produced systemic anti-Ad neutralizing antibodies, (b) if the extent of the neutralizing antibody response depended on the route of administration, (c) if the systemic anti-Ad humoral response was dose dependent, and (d) how much preexisting anti-Ad antibodies influence the subsequent humoral response to Ad vector administrations. Vectors were administered to the airway epithelium of individuals with cystic fibrosis, or individuals with liver metastatic tumors from colon cancer, or the skin of healthy normal individuals or the myocardium of individuals with coronary artery disease. Interestingly, the administration of the Ad vector to the bronchial epithelium of CF patients yielded the lowest antibody response, while direct injection of the Ad vector to colon carcinoma metastases in the liver resulted in the most vigorous antibody response. For those individuals that received Ad vector intradermally or intramyocardially there was a varying response, with some individuals having no increase in anti-Ad neutralizing anti body titer with others having a robust response. The most significant observa tion was the strong correlation between preexisting neutralizing antibodies and the likelihood that an individual would mount a higher titer following vector administration. Irrespective of route of administration and underlying disease 3 9 8 Catherine O'Riordan state individuals with higher baseUne anti-Ad neutraUzing antibodies mounted a higher neutraUzing antibody response after exposure to an Ad vector. How^ much does disease state modify the systemic humoral host response to Ad vectors? In the case of individuals v^ith CF they yielded the low^est antibody response following intrabronchial administration of an Ad vector. The authors suggest that the minimal responses to bronchial administration of Ad in CF patients could be due to the fact that the airway epithelium of these individuals is covered by mucus, which can preclude efficient Ad vector infection of the airway epithelial cells. To address this concern the same authors have just recently reported the results of a clinical trial using an El-E3-deleted Ad vector, which was repeat edly administered to the lung airway of six normal individuals [151], There were minimal to no systemic or local (epithelial lining fluid) anti-Ad neutraliz ing antibodies in the normal individuals following vector administration. This is a significant observation as in this situation there are no adverse conditions in the normal lung unlike the CF lung, that might affect host immune responses. Thus, in contrast to experimental animals where it has been shown that there is a robust anti-Ad response following repeated vector administration to the lung, it appears that for Ad-based vectors for use in human lung gene therapy this maybe less of a problem. VII. Conclusion There are several important conclusions on host responses to adenovirus- based vectors that can be made on the basis of extensive studies in experimental animals and some limited studies in humans. In particular, genetic composition of the Ad vector, dosing regimen, and routes of administration all modulate the humoral immune response generated to an adenoviral vector. In addition, fac tors other than the Ad-specific adaptive immune responses play a significant role in modulating gene expression following in vivo Ad transduction. These factors are related to host species and the immediate innate host responses following vector administration. Importantly, responses in experimental animals are not always predictive of responses in a human and care should be taken in extrap olating data from animal studies to predict outcomes in human clinical trials. Several strategies that may be used to overcome host humoral immune responses to Ad-based vectors have been developed. Administration of different-serotype Ad vectors may circumvent the local host immunity elicited by a first vector administration. Vectors with capsid components modified at specific capsid sites known to be targets for the anti-Ad-neutralizing antibodies might be useful in overcoming preexisting, serotype-specific anti-Ad immunity. In addition strategies to suppress humoral immune response in the host such as cytokine treatment, use of monoclonal antibodies, T-cell depletion strategies, immunosuppressive drugs have all shown efficacy as being effective in allowing 13. Humoral Immune Response 3 9 9 repeat administration of Ad vectors. To date, all of these strategies have been evaluated only in experimental animals, while their efficacy and safety have yet to be tested in humans. References 1. De Jong, J. C , Wermenbol, A. G., Verweij-Uijterwaal, M. W., Slaterus, K. W., Wertheim- Van Dillen, P., Van Doornum, G. J., Khoo, S.H., and Hierholzer, J. C. (1999). Adenoviruses from human Immunodeficiency virus-infected individuals, including two strains that rep resent new^ candidate serotypes Ad50 and Ad51 of species Bl and D respectively. / . Clin. Microbiol. 37, 3940-3945. 2. Benko, M., Harrach, B., and Russell, W. C. (1999). Family adenoviridae. In "Virus Tax onomy" (M. H. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wick- ner, Eds.), Seventh Report of the International Committee on Taxonomy of Viruses, pp. 227-238. Academic Press, New York. 3. Francki, R. I. B., Fauquet, C. M., Knudson, D. L., and Brow^n, F. (1991). Classification and nomenclature of viruses. Fifth report of the International Committee on Taxonomy of viruses. Arch. Virol. 1991 (Suppl. 2), 140-144. 4. Kjellen, L., and Pereira, H. G. (1968). Role of adenovirus antigens in the induction of virus neutralizing antibody./. Gen. Virol. 2, 177-185. 5. Wilcox, N., and Mautner, V. (1976). Antigenic determinants of adenovirus capsids. II. Homogeneity of hexons, and accessibility of their determinants, in the virion. / . Immunol. 116,25-29. 6. Ginsberg, H. S. (Ed.) (1984). "The Adenoviruses." Plenum, Nev̂ ^ York. 7. Norrby, E., and Wadell, G. (1969). Immunological relationship betw^een hexons of certain human adenoviruses./. Virol. 4, 663-670. 8. Cornick, G., Sigler, P. B., and Ginsberg, H. S. (1971). Characterization of crystals of type 5 adenovirus hexon./. Mol. Biol. 57, 397-401. 9. Franklin, R., Petterson, U., Akervall, K., Strandberg, B., and Philipson, L. (1971). Structural proteins of adenovirus V. Size and structure of the adenovirus type 2 hexon. / . Mol. Biol. 57,383-395. 10. Pereira, H. G., Valentine, R. C , and Russell, W. C. (1968). Crystallization of an adenovirus protein (the hexon). Nature 219, 946-947. 11. Rux, J. J., and Burnett, R. M. (2000). Type-Specific epitope locations revealed by X-ray crystallographic study of adenovirus type 5 hexon. Mol. Ther. 1, 18-29. 12. Athappilly, F. K., Murali, R., Rux, J.J. Cai, Z., and Burnett, R. M. (1994). The refined crystal structure of hexon, the major coat protein of adenovirus type 2, at 2.9 A resolution. / . Mol. Biol. 242, 430-452. 13. Roberts, M. M., White, J. L., Grutter, M. G., and Burnett, R. M. (1986). Three dimensional structure of the adenovirus major coat protein hexon. Science 232, 1148-1151. 14. Crav\^ford-Micksa, L., and Schnurr, D. P. (1996). Analysis of 15 adenoviruses hexon proteins reveals the location and structure of seven hypervariable regions containing serotype-specific residues./. Virol. 70, 1836-1844. 15. Eiz, B., Adrian, T., and Pring-Akerblom, P. (1995). Immunological adenovirus variant strains of subgenus D: Comparison of the hexon and fiber sequences. Virology 213, 313-320. 16. Kinloch, R., Mackay, N., and Mautner, V. (1984). Adenovirus hexon: Sequence comparison of subgroup C serotypes 2 and 5. / . Biol. Chem. 259, 6431-6436. 17. Pring-Akerblom, P., and Adrian, T. (1993). The hexon genes of adenoviruses of subgenus C: Comparison of variable regions. Res. Virol. 144, 117-127. 4 0 0 Catherine O'Riordan 18. Pring-Akerblom,
P., Trijssenaar, F. E., and Adrian, T. (1995). Sequence characterization and comparison of human adenovirus subgenus B and E hexons. Virology 212, 232-236. 19. Toogood, C. I. A., Crompton, J., and Hay, R. T. (1992). Antipeptide antisera define neu- trahzing epitopes on the adenovirus hexon. / . Gen. Virol. 73, 1429-1435. 20. Sundquist, B., Petterson, U., Thelander, R., and Philipson, L. (1973). Structural proteins of adenoviruses. IX. Molecular weight and subunit composition of adenovirus type 2 fibre, y/ro/ogy 51, 252-256. 21. Chatellard, C. and Chroboczek, J. (1989) Synthesis of human adenovirus type 2 fibre protein in E. Coh. cells. Gene 81, 267-274. 22. Stouten, P. F., Sander, C , Ruigrok, R. W. H., and Cusack, S. (1992). A new triple-helical model for the adenovirus fibre shaft. / . Mol. Biol. 226, 1073-1084. 23. Philipson, L., Lonberg-Holm, K., and Petterson, U. (1968). Virus-receptor interaction in an adenovirus system./. Virol. 35, 204-215. 24. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrins avp3 and OLv^S promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 25. Bai, M., Campisi, L., and Freimuth, P. (1994). Vitronectin receptor antibodies inhibit infection of HeLa and A549 cells by adenovirus type 12 but not by adenovirus type 2. / . Virol. 68, 5929-5932. 26. Valentine, R. C , and Pereira, H. G. (1965). Antigens and the structure of the adenoviruses. / . Mol. Biol. 13, 13-20. 27. Green, N. M., Wrigley, H. G., Russell, W. C., Martin, S. R., and McLachlan, A. (1983). Evidence for a repeating cross-beta sheet structure in the adenovirus fibre. EMBO J. 2, 1357-1365. 28. Kidd, A. H., Chroboczek, J., Cusack, S., and Ruigrok, R. W. H. (1993). Adenovirus type 40 virions contain two distinct fibres. Virology 192, 73-84. 29. Stevenson, S. C, RoUence, M., White, B., Weaver, L., and McClelland, A. (1995). Human adenovirus serotypes 3 and 5 bind to two different cellular receptors via the fiber head domain./. Virol. 69, 2850-2857. 30. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, JA., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 31. Xia, D., Henry, L. J., Gerard, R. D., and Deisenhofer, J. (1994). Crystal structure of the receptor-binding domain of adenovirus type 5 fibre protein at 1.7 A resolution. Structure 2, 1259-1270. 32. Watson, G., Burdon, M. G., and Russell, W. C. (1988). An antigenic analysis of the adenovirus type 2 fibre polypeptide./. Gen. Virol. 69, 525-535. 33. Fender, P., Kidd, A. H., Brebant, R., Oberg, M., Drouet, E., and Chroboczek, J. (1995). Antigenic sites on the receptor binding domain of human adenovirus type 2 fiber. Virology 214,110-117. 34. Liebermann, H., Lotz, K., Mentel, R., Bauer, U., and Seidel, W. (2001). Mapping of linear epitopes on fibre knob of human adenovirus serotype 5. Virus Res. 73, 145-151. 35. Wohlfart, C , (1988). Neutralization of adenoviruses: kinetics, stoichiometry, and mecha nisms./. Virol. 62, 2321-2328. 36. Hong, S. S., Bardy, M., Monteil, M., Gay, B., Denesvre, C , Tournier, J., Martin, G., Eliot, M., and Boulanger, P. (2000), Immunoreactive domains and integrin-binding motifs in adenovirus penton base capsomer. Virol. Immunol. 3, 353-371. 37. Stewart, P. L., Chiu, C. Y., Huang, S., Muir, T., Zhao, Y., Chait, B., Mathias, P., and Nemerow, G. R. (1997). Cryo-EM visualization of an exposed RGD epitope on adenovirus that escapes antibody neutralization. EMBO ]. 16, 1189-1198. 38. Gall, J. G. D., Crystal, R. G., and Falck-Pedersen, E. (1998). Construction and character ization of hexo-chimeric adenoviruses: Specification of adenovirus serotype. / . Virol. 72, 10,260-10,264. 13. Humoral Immune Response 4 0 1 39. Ostapchuk, P., and Hearing, P. (2001). Pseudopackaging of adenovirus type 5 genomes into capsids containing the hexon proteins of adenovirus serotypes B, D, or E. / . Virol. 75, 4 5 - 5 1 . 40. Roy, S., Shirley, P. M., McClelland, A., and Kaleko, M. (1998). Circumvention to Immunity to the adenovirus major coat protein hexon. / . Virol. 72, 6875-6879. 41. Bailey, A., and Mautner, V. (1994). Phylogenetic relationships among adenovirus serotypes, y/ro/og)/205, 438-452. 42. Crompton, J., Toogood, C. I., Wallis, N., and Hay, R. T. (1994). Expression of a foreign epitope on the surface of the adenovirus hexon./. Gen. Virol. 75, 133-139. 43. Bai, M., Harfe, B., and Freimuth, P. (1993). Mutations that alter an Arg-Gly-Asp (ROD) sequence in the adenovirus type 2 penton base protein abolish its cell-rounding activity and delay virus reproduction in flat cells. / . Virol. 67, 5198-5205. 44. Davison, E., Diaz, R. M., Hart, I. R., Santis, G., and Marshall, J. F. (1997). Integrin a5bl- mediated adenovirus infection is enhanced by the integrin activating antibody TS2/16. / . Virol. 71, 6204-6207. 45. Huang, S., Kamata, T., Takada, Y., Ruggeri, Z. M., and Nemerow, G. R. (1996). Adenovirus interaction with distinct integrins mediates separate events in cell entry and gene delivery to hematopoietic cells. / . Virol. 70, 4502-4508. 46. Wickham, T. J., Filardo, E. J., Cheresh, D. A., and Nemerow, G. R. (1994). Integrin alpha V beta 5 selectively promotes adenovirus mediated cell membrane permeabilization. / . Cell. Biol. 127, 257-264. 47. Blumenthal, R., Seth, P., Willingham, M. C , and Pastan, I. (1986). pH-dependent lysis of liposomes by adenovirus. Biochemistry 25, 2231-2237. 48. Leopold, P. L., Ferris, B., Grinberg, I., Worgall, S., Hackett, N. R., and Crystal, R. G. (1998). Fluorescent virionic dynamic tracking of the pathway of adenoviral gene transfer vectors in living cells. Hum. Gene Ther. 9, 367-378. 49. Wisnivesky, J. P., Leopold, P. L., and Crystal, R. G. (1999). Specific binding of the adenovirus capsid to the nuclear envelope. Hum. Gene Ther. 10, 2187-2195. 50. Saphire, A. C , Guan, T., Schirmer, E. C , Nemerow, G. R., and Gerace, L., (2000). Nuclear import of adenovirus DNA in vitro involves the nuclear protein import pathway and hsc 70. / . Biol. Chem. 275, 4298-4304. 51. Defer, C , Belin, M. T., Caillet-Boudin, M. L., and Boulanger, P. (1990) Human adenovirus host cell interactions comparative study with members of subgroups B and C. / . Virol. 64, 3561-3673. 52. Varga, M.J,, Bergman, T., and Everitt, E., (1990). Antibodies with specificities against a dispase-produced 15-kilodalton hexon fragment neutralize adenovirus type 2 infectivity. / . V/ro/. 64,4217-4225. 53. Pettersson, U., Philipson, L., and Hoglund, S. (1968). Structural proteins of adenovirus 11. Purification and characterization of the adenovirus type 2 fibre antigen. Virology 35, 204-215. 54. Mautner, V., and Wilcox, H. N. (1974). Adenovirus antigens: a model system in mice for subunit vaccination./. Gen. Virol. 25, 325-336. 55. Gall, J., Kass-Eisler, Leinwand, L., and Falck-Pedersen, E. (1996). Adenovirus type 5 and 7 capsid chimera: Fiber replacement alters receptor tropism without affecting primary immune neutralization epitopes./. Virol. 70,2116-2123. 56. Gahery-Segard, H., Farace, F., Godfrin, D., Gaston, J., Lengagne, R., Tursz, T., Boulanger, P., and Guillet, J. (1998). Immune response to recombinant capsid proteins of adenovirus in humans: Antifiber and anti-penton base antibodies have synergistic effect on neutralizing activity./. Virol. 72,2388-2397. 57. Pastore, L., Morral, N., Zhou, H., Garcia, R., Parks, R. J. Kochanek, S., Graham, F., Lee, B., and Beaudet, A. L. (1999). Use of a liver-specific, promoter reduces immune response to the transgene in adenoviral vectors. Hum. Gene Ther. 10, 1773-1781. 4 0 2 Catherine O'Riordan 58. Worgall, S., Wolff, G., Falck-Pedersen, E., and Crystal, R. (1997). Innate immune mecha nisms dominate elimination of adenoviral vectors follov^ing in vivo administration. Hum. Gene Ther. 8, 37-44. 59. Yang, Y., Li, Q., Ertl, H. C. J., and Wilson, J. M. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy with recombinant adenoviruses./. Virol. 69,2004-2015. 59a. Kaplan, J. M., Armentano, D., Sparer, T. E., Wynn, S. G., Peterson, P. A., Wadsw^orth, S. C , Couture, K. K., Pennington, S. E., St. George, J. A., Gooding, L. R., and Smith, A. E. (1997) Characterization of factors involved in modulating persistence of transgene expression from recombinant adenovirus in the mouse lung. Hum. Gene Ther. 8, 45-56. 60. Yang, Y., Xiang, Z., Ertl, H., and Wilson, J. M. (1995). Upregulation of class I major histocompatibility complex antigens by interferon gamma is necessary for T-cell mediated elimination of recombinant adenovirus-infected hepatocytes in vivo. Proc. Natl. Acad. Sci. USA 92, 7257-7261. 61. Linsley, P. S., and Ledbetter, J. A. (1993). The role of the CD28 receptor during T cell responses to antigen. Annu. Rev. Immunol. 11, 191-212. 62. Durie, F. H., Foy, T. M., Masters, S. R., Laman, J. D., and Noelle, R. J. (1994). The role of CD40 in the regulation of humoral and cell-mediated immunity. Immunol. Today 15, 406-411. 63. Yang, Y., Nunes, F. A., Berencsi, K., Furth, E. E, Gonczol, E., and Wilson, J. M. (1994). Cellular immunity to viral antigens limits El-deleted adenoviruses for gene therapy. Proc. Natl. Acad. Sci. USA 91, 4407-4411. 64. Dai, Y., Schwarz, E. M., Gu, D., Zhang, W., Sarvetnick, N., and Verma, I. M. (1995). Cellular and humoral immune responses to adenoviral vectors containing factor IX gene: Tolerization of factor IX and vector antigens allows for long-term expression. Proc. Natl. Acad. Sci. USA 92, 1401-1405. 65. Fang, B., Eisensmith, H., Wang, H., Kay, M. A., Cross, R. E., Landen, C. N., Gordon, G., Bellinger, D. A., Read, M. S., Hu, P. C , Brinkhous, K. M., and Woo, S. L. C. (1995). Gene therapy for hemophilia B: host immunosuppression prolongs the therapeutic effect of adenovirus-mediated factor IX expression. Hum. Gene Ther. 6, 1039-1044. 66. Joos, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, 1555-1566. 67. Berge, R. J. (1994). Immunosuppressive drugs in clinical medicine. Netherlands./. Med. 45, 329-338. 68. Clarke, L., and Waxman, D. J. (1989). Oxidative metabolism of cyclophosphamide: Iden tification of the hepatic monooxygenase catalysts of drug activation. Cancer Res. 49, 2344-2350. 69. Borel, J. K., and Gunn, H. C. (1986). Cyclosporine as a new approach to therapy of autoimmune diseases. Ann. NY Acad. Sci. 475, 307-318. 70. Bouvet, M., Fang, B., Ekmekcioglu, S., Ji, L., Bucana, C. D., Hamada, K., Grimm, E. A., and Roth, J. A. (1998). Suppression of the immune response to an adenovirus vector and enhancement of intratumoral transgene expression by low-dose etoposide. Gene Ther. 5, 189-195. 71. Lock, R. B., and Stribinskine, L. (1996). Dual modes of death induced by etoposide in human epithelial tumor cells allow Bcl-2 to inhibit apoptosis without affecting clonogenic survival. Cancer Res. 56, 4006-4012. 72. Smith, T. A. G., White, B. D., Gardner, J. M., Kaleko, M., and McClelland, A. (1996). Transient immunosuppression permits successful repetitive intravenous administration of an adenovirus vector. Gene Ther. 3, 496-502. 13. Humoral Immune Response 4 0 3 73. Kaplan, J. M., and Smith, A. E. (1997) Transient immunosuppression with deoxysperguaUn improves longevity of transgene expression and ability to readminister adenoviral vector to the mouse lung. Hum. Gene Ther. 8, 1095-1104. 74. Kolls, J. K., Lei, D., Odom, G., Nelson, S., Summer, W., Gerber, M. A., and Shellito, J. E. (1996). Use of transient CD4 lymphocyte depletion to prolong transgene expression of El-deleted adenoviral vectors. Hum. Gene Ther. 7, 489-497. 75. Yang, Y., Greenough, K., and Wilson, J. M. (1996). Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allov^̂ s repeated gene transfer to mouse liver. Gene Ther. 3, 412-420. 76. Ye, X., Robinson, M. B., Pabin, C., Batshav^, M. L., and Wilson, J. M. (2000). Transient depletion of CD4 lymphocyte improves efficacy of repeated administration of recombinant adenovirus in the ornithine transcarbamylase deficient sparse fur mouse. Gene Ther. 7, 1761-1767. 77. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 78. Kay, M. A., Holterman, A-X., Meuse, L., Gown, A., Ochs, H. D., Linsley, P. S., and Wilson, C. B. (1995). Long-term hepatic adenovirus-mediated gene expression in mice following CTLA4Ig administration. Nat. Genet. 11, 191-197. 79. Jooss, K., Turka, L. A., and Wilson,}. M. (1998). Blunting of immune responses to adenoviral vectors in mouse liver and lung with CTLA4Ig. Gene Ther. 5, 309-319. 80. Ideguichi, M., Kajiwara, K., Yoshikawa, K., Uchida,
T., and Ito, H. (2000). Local adenovirus mediated CTLA4-Ig expression suppresses the immune responses to adenovirus vectors in the brain. Neuroscience 95, 217-226. 81. Noelle, R. J., Roy, M., Shepherd, D. M., Stamenkovic, L, Ledbetter, J. A., and Aruffo, A. (1992). A 39-kDa protein on activated helper T cells binds CD40 and transduces the signal for cognate activation of B cells. Proc. Natl. Acad. Set. USA 89, 6550-6554. 82. Foy, T. M., Shepherd, D. M., Durie, F. H., Aruffo, A., Ledbetter, J. A., Noelle, R. J. (1993). In vivo CD40-gp39 interactions are essential for thymus dependent humoral immunity. II. prolonged suppression of the humoral immune response by an antibody to the ligand for CD40, gp39./ . Exp. Med. 178, 1567-1575. 83. Foy, T. M., Aruffo, A., Bajorath, J., Buhlmann, J. E., Noelle, R. J. (1996). Immune regulation by CD40 and its ligand gp39. Annu. Rev. Immunol. 14, 591-617. 84. Stuber, E., Strober, W., and Neurath, M. (1996). Blocking of CD40-CD40L interaction in vivo specifically prevents priming of T helper 1 cells through the inhibition of IL-12 secretion. / . Exp. Med. 183, 693-698. 85. Yang, S., Su, Q., Grewal, I. S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues. / . Virol. 70, 6370-6377. 86. Scaria, A., St. George, J. A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C., Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40 ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airway. Gene Ther. 4, 611-617. 87. Chirmule, N., Raper, S. E., Burkly, L., Thomas, D., Tazelaar, J., Hughes, J. V., and Wilson, J. M. (2000). Readministration of adenovirus vector in nonhuman primate lungs by blockade of CD40-CD40 ligand interactions./. Virol. 74, 3345-3352. 88. Stein, C. S., Ghodsi, A., Derksen, T., and Davidson, B. (1999). Systemic and central nervous system correction of lysosomal storage in mucopolysaccharidosis type VII mice. / . Virol. 73, 3424-3429. 89. Kay, M., Meuse, L., Gown, A. M., Linsley, P., Hollenbraugh, D., Aruffo, A., Ochs, H. D., and Wilson, C. B. (1997). Transient immunomodulation with anti-CD40 ligand antibody 4 0 4 Catherine O'Riordan and CTLA4Ig enhances persistence and secondary adenovirus mediated gene transfer into mouse liver. Proc. Natl. Acad. Set. USA 94, 4686-4691. 90. Chen, Y. H., and Weiner, H. L. (1996). Dose-dependent activation and deletion of antigen- specific T cells following oral tolerance. Ann. NY Acad. Sci. 778, 111-121. 91. Friedman, A. (1996) Induction of anergy in Thl lymphocytes by oral tolerance. Importance of antigen dosage and frequency of feeding. Ann. NY Acad. Sci. 11%^ 103-110. 92. Ilan, Y., Prakash, R., Davidson, A., Jona, V., Droguett, G., Horw^itz, M. S., and Chowdhury, N. R. (1997). Oral tolerization to adenoviral antigens permits long-term gene expression using recombinant adenoviral vectors./. Clin. Invest. 99, 1098-1106. 93. Kagami, H., Atkinson, J. C , Michalek, S. M., Handelman, B., Yu, S., Baum, B. J., and O'Connell, B. (1998). Repetitive adenovirus administration to the parotid gland: Role of immunological barriers and induction of oral tolerance. Hum. Gene Ther. 9, 305-313. 94. Kass-Eisler, A., Leinward, L., Gall, J., Bloom, B., and Falck-Pedersen, E. (1996). Cir cumventing the immune response to adenovirus mediated gene therapy. Gene Ther. 3, 154-162. 95. Mastrangeli, A., Harvey, B., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck- Pedersen, E. (1996) "Sero-sv^itch" adenovirus mediated in vivo gene transfer: Circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 96. Mack, C. A., Song, W., Carpenter, H., Wickham, T. J., Kovesdi, I., Harvey, B., Magov- ern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangeli, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 97. Parks, R. J., Evelegh, C. M., and Graham, F. L. (1999). Use of helper-dependent adenovi ral vectors of alternative serotypes permits repeat vector administration. Gene Ther. 6, 1565-1573. 98. Beer, S. J., Matthews, C. B., Stein, C. S., Ross, B. D., Hilfinger, J. M., and Davidson, B. L. (1998). Poly (-lactic-glycolic) acid copolymer encapsulation of recombinant adenovirus reduces immunogenicity in vivo. Gene Ther. 5, 740-746. 99. O'Riordan, C. R., Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S. C , Smith, A. E., and Francis, G. E. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum. Gene Ther. 10,1349-1358. 100. Croyle, M. A., Chirmule, N., Zhang, Y., and Wilson, J. M. (2001). "Stealth" adenoviruses blunt cell-mediated and humoral immune responses against the virus and allow for significant gene expression upon readministration in the lung. / . Virol. 75, 4792-4801. 101. Fisher, K. D., Stallwood, Y., Green, N. K., Ulbrich, K., Mautner, V., and Seymour, L. W. (2001). Polymer-coated adenovirus permits efficient retargeting and evades neutralizing antibodies. Gene Ther. 8, 341-348. 102. Chen, Y., Yu, D-C, Charlton, D., and Henderson, D. R. (2000), Pre-existent adenovirus antibody inhibits systemic toxicity and anti-tumor activity of CN706 in the nude mouse LNCaP Xenograft model: Implications and proposals for human therapy. Hum. Gene Ther. 11, 1553-1567. 103. Dau, P. C. (1991). Immunologic rebound./. Clin. Apheresis 10, 210-217. 104. Rosenfeld, M. A., Siegfried, W., Yoshimura, K., Yoneyama, K., Fukayama, M., Stier, L. E., Paakko, P. K., Gilardi, P., Stratford-Perricandet, L. D., Perricaudet, M., Jallat, S., Pavirani, A., and Lecocq, J. (1991) Adenovirus mediated transfer of a recombinant a 1-antitrypsin gene to the lung epithelium in vivo. Science ISl^ 431-434. 105. Zabner, J., Petersen, D. M., Puga, A. P., Graham, S. M., Couture, L. A., Keyes, L. D., Luckason, M. J., St. George, J. A., Gregory, R. J., Smith, A. E., and Welsh, M. (1994). Safety and efficacy of repetitive adenovirs-mediated transfer of CFTR cDNA to airway epithelia of primates and cotton rats. Nat. Genet. 6, 75-83 . 13. Humoral Immune Response 4 0 5 106. Ohno, T., Gordon, D., San, H., Pompili, V. J., Imperiale, M. J., Nabel, G. J., and Nabel, E. G. (1994). Gene therapy for vascular smooth muscle cell proUferation after arterial injury. Science 265, 7H1-7H4. 107. Akli, S., Caillaud, C., Vigne, E., Stratford-Perricaudet, L. D., Poenaru, L., Perricaudet, M., Kahn, A., and Peschanski, M. R. (1993). Transfer of a foreign gene into the brain using adenovirus vectors. Nat. Genet. 3, 224-228. 108. Engelhardt, J. F., Simon, R. H., Yang, Y., Zepeda, M., Weber-Pendelton, S., Doranz, B., Grossman, M., and Wilson, J. M. (1993). Adenovirus-mediated transfer of the CFTR gene to lung of non-human primates: Biological efficacy study. Hum. Gene Ther. 4, 759-769. 109. Barr, D., Tubb, J., Ferguson, D., Scaria, A., Lieber, A., Wilson, C., Perkins, J., and Kay, M. A. (1995). Strain related variations in adenovirally mediated transgene expression from mouse hepatocytes in vivo: Comparison between immunocompetent and immune deficient inbred strains. Gene Ther. 2, 151-155. 110. Armentano, D., Zabner, J., Sacks, C., Sookdeo, C. C., Smith, M. P., St. George, J. A., Wadsworth, S. C., Smith, A. E., and Gregory, R. J. (1997). Effect of the E4 region on the persistence of transgene expression from adenovirus vectors. / . Virol. 71, 2408-2416. 111. Engelhardt, J. F., Litsky, L., and Wilson, J. M. (1994). Prolonged transgene expression in cotton rat lung with recombinant adenoviruses defective in E2a. Hum. Gene Ther. 5, 1217-1229. 112. Yeh, P., Dedieu, J. F., Orsini, C., Vigne, E., Denefle, P., and Perricaudet, M., (1996). Efficient dual transcomplementation of adenovirus El and E4 regions from a 293-derived cell line expressing a minimal E4 functional unit. / . Virol. 70, 559-565. 113. Lusky M., Christ, M., Rittner, K., Dieterle, A., Dreyer, D., Mourot, B., Schultz, H., Stoeckel, F., Pavirani, A., and MehtaH, M. (1998). In vitro and in vivo biology of recombinant adenovirus vectors with El , E1/E2A, or E1/E4 deleted./. Virol. 72, 2022-2032. 114. Gorziglia, M. I., Kadan, M. J., Yei, S., Lim, J., Lee, G. M., Luthra, R., and Trapnell, B. (1996). Elimination of both El and E2a from adenovirus vectors further improves prospects for in vivo human gene therapy. / . Virol. 70, 4173-4178. 115. Zhou, H., O'Neal, W., Morral, N., and Beaudet, A. L. (1996). Development of a com plementing cell line and a system for construction of adenovirus vectors with El and E2a deleted./. Virol. 70, 7030-7038. 116. Fang, B., Wang, H., Gordon, G., Bellinger, D. A., Read, M. S., Brinkhous, K. M., Woo, S. L. C , and Eisensmith, R. (1996). Lack of persistence of El-recombinant adenoviral vectors containing a temperature sensitive E2a mutation in immunocompetent mice and hemophilia B dogs. Gene Ther. 3, 217-222. 117. Engelhardt, J. F., Ye, X., Doranz, B., and Wilson, J. M. (1994). Ablation of E2a in recom binant adenoviruses improves transgene persistence and decreases inflammatory response in mouse liver. Proc. Natl. Acad. Sci. USA 91, 6196-6200. 118. Yang, Y., Nunes, F. A., Berencsi, K., Gonczol, E., Engelhardt, J. F., and Wilson, J. M. (1994). Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nat. Genet. 7, 362-369. 119. Scaria, A., St. George, J., Jiang, C , Kaplan, J., Wadsworth, S. C , and Gregory, R.J. (1998). Adenovirus-mediated persistent cystic fibrosis transmembrane conductance regulator expression in mouse airway epithelium./. Virol. 72, 7302-7309. 120. Hu, H., Serra, D., and Amalfitano, A. (1999). Persistence of an [E1-, polymerase-] adenovirus vector despite transduction of a neoantigen into immune-competent-mice. Hum. Gene Ther. 10, 355-364. 121. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector, replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Froc. Natl. Acad. Sci. USA 93, 5731-5736. 122. Fisher, K. J., Choi, H., Burda, J., Chen, S. J., and Wilson, J. M. (1996). Recombinant adenovirus deleted of all viral genes for gene therapy. Virology 217, 11-22. 4 0 6 Catherine O'Riordan 123. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M. A., and Graham, F. L. (1996). A new helper-dependent adenovirus vector system. Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 124. Morsy, M. A., Gu, M. C., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franlin, H., Parks, R. J., Graham, F. L., Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 125. Morral, N., Parks, R. J., Zhou, H., Langston, C., Scheidner, G., Quinones, J., Graham, F. L., Kochanek, S., and Beaudet, A. L. (1998) High doses of a helper dependent adenoviral vector yield supraphysiological levels of a 1-antitrypsin with negligible toxicity. Hum. Gene Ther. 9, 2709-2716. 126. Scheidner, G., Morral, N., Parks, R. J., Wu, Y., Koopmans, S. C., Langston, C., Graham, F. L., Beaudet, A. L., and Kochanek, S. (1998). Genomic DNA transfer with a high capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nat. Genet. 18, 180-183. 127. Pastore, L., Morral, N., Zhou, H., Garcia, R., Parks, R. J., Kochanek, S., Graham, F. L., Lee, B., and Beaudet, A. L. (1999). Use of a liver-specific promoter reduces immune response to the transgene in adenoviral vectors. Hum. Gene Ther. 10, 1773-1781. 128. Ilan, Y., Droguett, G., Chowdhury, N. R., Yongan, L., Sengupta, K., Thummala, N. R., Davidson, A., Chowdhury, J. R., and Horwitz, M. S. (1997). Insertion of the adenoviral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression. Proc. Natl. Acad. Sci. USA 94,2587-2592. 129. Scaria, A., Sullivan, J. A., St. George, J. A., Kaplan, J. M., Luckason, M. J., Morris, J. E., Plog, M., Nicolette, C , Gregory, R. J., and Wadsworth, S. C. (2000). Adenoviral vec tor expressing ICP47 inhibits adenovirus specific cytotoxic T lymphocytes in nonhuman primates. Mol. Ther. 2, 505-513. 130. Tripathy, S. K., Black, H. B., Goldwasser, E., and Leiden, J. M. (1996). Immune responses to transgene-encoded proteins hmit the stability of gene expression after injection of replication- defective adenovirus vectors. Nat. Med. 2, 545-550. 131.
Michou, A. L, Santoro, L., Christ, M., Julliard, V., Pavirani, A., and Mehtafi, M. (1997). Adenovirus-mediated gene transfer: Influence of transgene, mouse strain, and type of immune response on persistence of transgene expression. Gene Ther. 4, 473-482. 132. Fields, P. A., Armstrong, E., Hagstrom, J. N., Arruda, V. R., Murphy, M. L., Farrell, J. P., High, K. A., and Herzog, R. W. (2001). Intravenous administration of an El/E3-deleted adenoviral vector induces tolerance to Factor IX in C57B1/6 mice. Gene Ther. 8, 354-361. 133. Connelly, S., Gardner, J. M., McClelland, A., and Kaleko, M. (1996). High-level tissue specific expression of functional human Factor VIII in mice. Hum. Gene Ther. 7, 183-195. 134. Schowalter, D. B., Himeda, C, L., Winther, B. L., Wilson, C. B., and Kay, M. (1999). Implication of interfering antibody formation and apoptosis as two different mechanisms leading to variable duration of adenovirus mediated transgene expression in immune- competent mice. / . Virol. 73, 4755-4766. 135. Gahery-Segard, H., Juillard, V., Gaston, J., Lengagne, R., Pavirani, A., Boulanger, P., and Guillet, J-G. (1997). Humoral immune response to the capsid components of recombinant adenoviruses: Routes of immunization modulate virus-induced Ig subclass shifts. Eur. J. Immunol. 27, 653-659. 136. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangeli, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994) Administration of an adenovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8, 8-9. 137. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75, 207-216. 13. Humoral Immune Response 4 0 7 138. Zabner, J., Couture, L. A., Smith, A. E., and Welsh, M.J . (1994). Correction of cAMP- stimulated fluid secretion in cystic fibrosis airway epithelia: Efficiency of adenovirus-mediated gene transfer in vitro. Hum. Gene Ther. 5, 585-593. 139. Rosenfeld, M.A., Yoshimura, K., Trapnell, B.C., Yoneyama, K., Rosenthal, E.R., Dalemans, W., Fukayama, M., Bargon, J., Stier, L.E., Stratford-Perricaudet, L., Perricaudet, M., Guggino, W. B., Pavirani, A., Lecocq, J-P., and Crystal, R. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airw^ay epithelium. Ce//68, 143-155. 140. Kaplan, J. M., St. George, J. A., Pennington, S. E., Keyes, L. D., Johnson, R. P., Wadsv^orth, S. C , and Smith, A. E. (1996). Humoral and cellular immune responses of nonhuman primates to long-term repeated lung exposure to Ad2-CFTR-2. Gene Ther. 3, 117-127. 141. Van Ginkel, F. W., Liu, C , Simecka, J. W., Dong, J-Y., Greenway, T., Frizzell, R. A., Kiyono, H., McGhee, J. R., and Pascual, D. W. (1995). Intratracheal gene delivery with adenoviral vector induces elevated systemic IgG and mucosal IgA antibodies to adenovirus and p-galactosidase. Hum. Gene Ther. 6, 895-903. 142. Kajiwara, K., Byrnes, A. P., Ohmoto, Y., Charlton, H. M., Wood, M. J. A., and Wood, K. J. (2000). Humoral immune responses to adenovirus vectors in the brain. / . Neurol. Immunol. 103 ,8-15 . 143. Bennett, J., Pakola, S., Zeng, Y., and Maguire, A. (1996). Humoral response after admin istration of El deleted adenoviruses: Immune privilege of the subretinal space. Hum. Gene Ther. 7, 1763-1769. 144. Bramson, J. L., Hitt, M., Gauldie, J., and Graham, F. L. (1997). Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther. 4, 1069-1076. 145. Chen, P., Kovesdi, I., and Bruder, J. T. (2000). Effective repeat administration with aden ovirus vectors to the muscle. Gene Ther. 7, 587-595. 146. Mack, C. A, Magovern, C. J., Budenbender, K. T., Patel, S. R., Schwarz, E. A., Zanzonico, P., Ferris, B., Sanborn, T,, Isom, P., Ferris, B., Sanborn, T., Isom, O. W., Crystal, R. G., and Rosengart, T. K. (1998). Salvage angiogenesis induced by adenovirus mediated gene transfer of vascular endothelial growth factor protects against vascular occlusion. / . Vase. Surg. 4, 699-709. 147. Chirmule, N., Propert, K. J., Magosin, S. A., Qian, Y., Qian, R., and Wilson, J. M. (1999). Immune responses to adenovirus and adeno-associated virus in humans. Gene Ther. 6, 1574-1583. 148. Molnar-Kimber, K. L., Sterman, D. H., Chang, M., Kang, E. H., ElBash, M., Lanuti, M., Elshami, A., Gelfand, K., Wilson, J. M., Kaiser, L. R., and Albeda, S. M. (1998). Impact of preexisting and induced humoral and cellular immune responses in an adenovirus-based gene therapy phase I clinical trial for localized mesotheHoma. Hum. Gene Ther. 9, 2121-2133. 149. Zabner, J., Ramsey, B. W., Meeker, D. P., Aitken, M. L., Balfour, R. P., Gibson, R. L., Launspach, J., Moscicki, R. A., Richards, S. M., Standaert, T. A., WiUiams-Warren, J., Wadsworth, S. C , Smith, A. E., and Welsh, M.J . (1996). Repeat administration of an adenovirus vector encoding cystic fibrosis transmembrane conductance regulator to the nasal epithelium of patients with cystic fibrosis./. Clin. Invest. 97, 1504-1511. 150. Harvey, B-G., Hackett, N. R., El-Sawy, T., Rosengart, T. K., Hirschowitz, E. A., Lieberman, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs. / . Virol. 73, 6729-6742. 151. Harvey, B-G., Hackett, N. R., Ely, S., and Crystal, R. C. (2001). Host responses and persistence of vector following intrabronchial administration of an El~/E3~ adenovirus gene transfer vector to normal individuals. Mol. Ther. 3, 206-215. C H A P T E R Novel Methods to Eliminate the Immune Response to Adenovirus Gene Therapy Huang-Ge Zhang/'^ Hui-Chen Hsu/ and John D. Mountz"̂ '̂ *Department of Medicine Division of Clinical Immunology and Rheumatology University of Alabama at Birmingham and "'"Birmingham Veterans Administration Medical Center Birmingham, Alabama I. Introduction The immune response to adenovirus (Ad) vectors or their transgene is a hmiting factor in the successful appHcation of gene therapies [1-3] (Fig. 1). Components of the adenovirus are recognized for their abihty to eUcit either a strong antigenic response or to subvert the immune response. Early proteins (E), w^hich are produced continuously by adenovirus, can both enhance and inhibit the immune response. El (including ElA and ElB) and E2 are necessary for Ad replication but also evoke a strong immune response. E4 is a p70 antigen that promotes early and late transportation of viral mRNA and is highly immunogenic. E3 can be immunogenic but also produces a 19 K product that inhibits major histocompatibility complex-I (MHC-I) transportation to the surface of antigen-presenting cells (APCs) and therefore subverts the immune response [4, 5]. Adenovirus late proteins include the penton base which is in a cryptic position but can evoke an immune response. The neutralizing antibody response is formed against the fiber knob which is also a strong antigen on the surface of adenovirus. For applications to gene therapy, the transgene expressed by the Ad vector can also evoke an immune response, especially when combined in the environment of viable transduced adenovirus. ADENOVIRAL VECTORS FOR GENE THERAPY 4 0 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 410 Zhang et aL Adanovlrus CytotoKic T Cells f ^ Helper T Cells B Cells Neutralizing Ab t j ^ Prcrtitii \|MiNi# Onai}! Figure 1 Components of adenovirus that can evoke an immune response. Adenovirus expresses early proteins including E l , E2, E3, and E4, most of which can provoke a strong immune response. E3 is known to inhibit MHC class I transportation of antigens to the surface of antigen-presenting cells (APCs), and minimizes the immune response to adenovirus. Late proteins include the penton base and the fiber-knob of the adenovirus. The fiber knob can elicit a strong antigenic response and promote production of neutralizing antibody against the fiber knob. The gene therapy transgene can also evoke an immune response. II. Immune Suppression Both cellular and humoral immune responses have been implicated in the shortening of the time span of transgene expression. Transgene expression is limited by eradication of the transfected cells. Induction of anti-Ad neutral izing antibodies precludes the opportunity to readminister the gene therapy. Immunosuppressive drugs including cyclophosphamide [6], cyclosporine [7], and FK506 [8-10], have reduced the T-cell immune response. Lochmuller et al. [8] used FK506, resulting in prolonged expression of adenovirus-mediated dystrophin gene transfer in mdx adult mice for at least 2 months, even though the FK506 treatment was discontinued after 1 month. There w âs a marked reduction in inflammation and reduced levels of nitric oxide synthesase in macrophages in the muscles of such treated animals. Howell et al. [9] used the dystrophin-deficient golden retriever dog model and showed that cyclosporine significantly prolonged transgene expression after Ad-mediated expression of a truncated human dystrophin gene. Ilan et al. [10] showed that com bined immunotherapy in humans resulted in prolonged transgene expression. 14. Novel Methods to Eliminate the immune Response 4 1 1 Combined therapy with cyclosporine, azathioprin, and prednisone has been shown to reduce the immune response to adenovirus-mediated gene therapy and prolonged transgene expression. Other strategies reported to control the immune response include reduc tion of T-cell response by oral tolerance [11], thymic tolerance, anti-T-cell therapy, and anti-CD4 monoclonal antibody therapy [12-15]. Modulation of T-cell subset development after adenovirus therapy has successfully been attempted using recombinant interleukin 12 (IL-12). IL-12 activates Th-1 cells to secrete gamma interferon (IFNy) which diminishes Th-2 T-cell formation and reduces formation of neutralizing antibodies [16]. III. Immune Modulation Other specific strategies include reduction of the costimulatory signal ing activity using the CTLA4 immunoglobulin Fc (CTLA4-Ig) and blocking CD40-CD40L interaction (Fig. 2). Interaction of APC with processed ade novirus antigens or adenovirus transgene antigens with T cells through the MHC-T-cell receptor (TCR) ligation constitutes signal 1, which is an incom plete signal and can induce T-cell nonresponsiveness or anergy. A second signal can be provided by interaction with B7-1 or B7-2 (CD80/CD86) on the APC with CTLA4 (CD152) or CD28 on the T cell (Fig. 2). A soluble form of CTLA4-Ig (sCTLA4-Ig) can bind to B7-1 and B7-2 and block interactions of this molecule with membrane bound CTLA4 on T cells. The anti-adenovirus response can be decreased and there is prolonged expression of the aden ovirus transgene in the presence of either sCTLA4-Ig or in the presence of an adenovirus that expresses CTLA4-Ig (AdsCTLA4-Ig). Kay et aL [17, 18] demonstrated that systemic coadministration of recombinant adenovirus with sCTLA4-Ig leads to persistent adenovirus gene expression in mice without long-term immunosuppression. Ideguchi et al. [19] utilized local administration of adenovirus that expressed p-galactosidase as well as CTLA4-Ig (AdsCTLA4-Ig) in the central nervous system and showed that this combination decreased T-cell infiltration and also decreased the anti- adenovirus antibody titer. Expression of p-galactosidase at the injection site in the striatum and corpus callosum peaked at day 6 and remained until day 60 in both control and treated groups at about the same level despite suppression of the inflammatory response. Guibinga et al. [20] showed that the combination of CTLA4-Ig plus FK506 resulted in prolonged adenovirus vector-mediated production of dystrophin compared to treatment with either immunosup pressive alone. Schowalter et al. [21] demonstrated that murine CLTA4-Ig markedly prolonged adenovirus transgene expression in the liver and dimin ished formation of neutralizing antibodies as well as decreasing the proliferative response without causing irreversible immune suppression. Ali et al. [11] used AdsCTLA4-Ig administration in association with intraocular administration 412 Zhang ef al. sCD40«Ig <CDI52) (CD86) sCTLA4-Ig Figure 2 Role of costimulatory molecules to induce cytotoxic or helper T-cell response and promote anti-Ad antibody production. Signal 1 consists of the processed antigen presented by the MHC expressed by APCs stimulation of T cells. These antigens are recognized by specific T-cell receptors (TCRs) on T cells. This interaction is also assisted by CDS expressed on cytotoxic T cells or CD4 expressed on helper T cells that interact with MHC. In addition to this central, specific T-cell-APC interaction, costimulatory molecules are necessary for optimal T-cell response. These consist of CD28 and CTLA4 (CD! 52) expressed on T cells that interact with B7.1 and B7.2 (CD80 and CD86), expressed on APCs. This interaction can be blocked by soluble CTLA4-lg (sCTLA4-lg) that tightly binds to B7.1 and B7.2 and prevents the interaction of this molecule expressed on APCs with CD28/CTLA-4 expressed on T cells. A second costimulatory molecule pathway consists of CD40
ligand (CDl 54) expressed on T cells that interact with CD40 expressed on APCs. This interaction can be blocked by administration of a soluble CD40-lg (sCD40-lg) which binds with the CD40 ligand and prevents the interaction between CD40 and CD40 ligand. of adenovirus encoding p-galactosidase and demonstrated reduced immune response to adenovirus, as w êll as prolonged expression of the transgene in retinal cells. Kay et al. [17] show^ed that combined treatment v^ith sCTLA4-Ig and anti-CD40 ligand resulted in prolonged adenovirus-mediated gene expres sion for up to 1 year in the liver and the ability to readminister adenovirus in 50% of mice. Follow^ing readministration, there w âs persistent secondary gene expression lasting 200-300 days, and diminished spleen proliferative response, tumor necrosis factor (TNF)-a and IFNy production and decreased production of neutralizing antibodies. Chirmule et al. [23] showed that despite the absence of CD40-CD40 ligand interaction in CD40 ligand knockout mice, after administration of LacZ into the mouse lung, these mice devel oped a functional humoral response to the vector evidenced by germinal center formation and anti-adenovirus IgGl and IgA that resulted in effective neutralization of virus and prevented effective readministration of the virus. 14. Novel Methods to Eliminate the immune Response 4 1 3 Wilson et al. [24, 25] used combined treatment with an adenovirus vector expressing sCTLA4-Ig to block CD28 stimulation and a monoclonal antibody against CD40 ligand to demonstrate prolonged adenovirus transgene expres sion after intratracheal administration. In addition, secondary administration and transgene expression after secondary administration w âs prolonged in the lung, but there w âs increased reaction from the liver. These results indicate that the mechanisms limiting transgene expression in the airv^ays and the alveoli are different to those of the liver. Stein et al, [26] have shov^n that combined treatment of Ad-human factor IX (FIX) w îth an anti-CD40 ligand antibody MR-1 as w êll as depletion of macrophage liposomes resulted in prolonged expression of AdFIX as vŝ ell as higher levels of plasma FIX. This persistence Mras accompanied by inhibition of anti-adenovirus IgG, and decreased IL-10 and IFN-y production from spleen lymphocytes follov^ing reexposure to virus particles in vitro. This treatment regimen also enabled secondary and tertiary infusions of AdFIX w^hich w âs superior to treatment w îth CD40 ligand block ade alone. Kuzmin et al. [27] utilized macrophage depletion in combination w îth blockade of CD40 ligation to demonstrate the prolonged expression of transgene after administration of El-deleted adenovirus. This resulted in a decreased cellular and humoral response as w êll as the induction of transgene tolerance in the animals. Animals that v^ere rendered immunologically unre sponsive to vector and transgene antigens regained their ability to mount a productive immune response against the vector after recovery of immune func tion but remained unresponsive to the transgene product. Stein et al, [28] used an anti-CD40 ligand (anti-CD 154) in combination v^ith adenovirus-mediated low^-density-lipoprotein receptor (LDLR) gene transfer in LDLR-deficient mice to demonstrate that these mice express LDLR on hepatocytes and maintain cholesterol levels below^ or w^ithin the normal range for at least 92 days. It has been more difficult to eliminate B-cell responses. B-cell produc tion of neutralizing antibodies is decreased after treatment w îth anti-CD40 or soluble CD40 [29] and deoxyspergualin [30-32]. Readministration of ade novirus vector has been achieved in the lungs of nonhuman primate by blocking of CD40-CD40 ligand interactions. A humanized anti-CD40 ligand antibody hu5C8 w âs used to treat primates in the presence of administra tion of adenovirus vectors [23]. These animals produced IgM but did not develop secretory IgA or neutralizing antibodies. This is significant since this is the first demonstration that anti-Ad neutralizing antibodies could be inhibited in a primate system by inhibiting the CD40 interaction with CD40 ligand. A third approach includes modification of the adenovirus vector to reduce the immune response [33-36]. A more universal strategy for decreas ing response to adenovirus vectors includes production of the "gutless" adenovirus which greatly reduces the immune response to Ad and its trans gene [37-40]. It was initially demonstrated that constitutive expression of the 4 1 4 Zhang efo/. immune modulatory gpl9 K protein in adenovirus vectors reduced the cyto toxic response. Further refinement of vectors including the removal of E4 also resulted in prolonged transgene expression [34]. A gutless Ad that v^as depleted of all adenovirus genes, showed prolonged expression of P-galactosidase in muscle. This prolonged expression correlated w îth a decrease in the infiltration of CD4+ and CD8"^ lymphocytes. However, in LacZ transgenic mice, which was predicted to result in immunologic tolerance to p-galactosidase expression, there was prolonged expression of the vector DNA, indicating that the immune response to this "gutless" Ad was primarily against p-galactosidase and that the response to the adenovirus vector lacking all genes was minimal [37]. Gene therapy expression using adenovirus vectors with deletions of the El , E2A, E3, and E4 regions could be prolonged when combined with immunosuppressive drugs including cyclophosphamide and FK506. One limitation of immunomodulating therapy has been that it is not specific for the adenovirus or transgene. The present review will focus on our attempts to reduce the immune response mediated by TNFot and other cytokines. A second strategy to prolong gene therapy expression is to ablate the immune response to cells that are the target of gene therapy. Such apoptosis-inducing factors include TNFa but also Fas ligand and TNF recep tor apoptosis-inducing ligand (TRAIL). We have also developed methods to specifically reduce the T-cell response to Ad and also new methods to prevent B cell responses including blocking of the TNF receptor (TNFR) homolog trans membrane activator and calcium modulator and cyclophilin ligand (CAML) interactor (TACI) signal in B cells. These strategies strongly suggest that it will be possible to develop strategies to ablate the immune response to adenovirus including the cytotoxic response that leads to the loss of cells carrying the transgene. IV. Treatment with Soluble TNFR1 to Eliminate Ad Inflammation in Lung and Liver The rationale for use of soluble TNF receptor as a modulator of ade novirus inflammation stems from the observation that TNFa is one of the principal mediators of inflammation after adenovirus gene therapy [41-43]. Neutralization of TNFa with TNFa inhibitors, such as soluble TNFRl (sTNFRl) greatly reduces tissue injury and cell death after endotoxin and other inflammatory agents. This is a rational approach, since adenovirus takes advantage of TNFa as an immune mediator to promote expression of several immunosubversive proteins supporting its escape from immunosurveil- lance [5]. The interaction of TNFa with its receptor is a strong virulence factor for inflammation and elimination of virus infection. The E3-gpl9 K protein not only prevents CTL recognition of Ad-infected fibroblasts by sequestering 14. Novel Methods to Eliminate the Immune Response 4 1 5 MHC class I proteins in the endoplasmic reticulum, but also E3 proteins 10.4 K, 14.5 K, and 14.7 K function to protect infected cells from TNFa cytolysis. Transgenic mice that express the E3 gene encoding these proteins have been shown to exhibit decreased pulmonary infiltration after intranasal inoculation [42]. Peng et al. [43] showed that adenovirus gene transfer of an sTNFR results in effective blockade of tumor necrosis factor activity and also prolongs the gene therapy. Therefore, neutralization of TNFa is a rational approach to decrease chronic inflammation as well as prolonged transgene expression. Certain cytokines such as TNFa can result in rapid clearance of ade novirus or viral therapy. Administration of anti-inflammatory cytokines, such as IL-10, can reduce inflammation and prolong gene therapy [44]. We have evaluated the effect of the treatment with a novel TNF-binding protein (TNF-bp), a polyethylene-glycol (PEG)-linked dimer of sTNFRl, on inflammation of the lung and viral clearance after intranasal administration of AdCMVLacZ (1 x W^ pfu) [45, 46] (Fig. 3, see color insert). Three days after intranasal administration, there was a moderate inflammatory infiltrate in the lungs of control (CT)-treated C57BL/6-+/-h mice, which peaked at day 7 and was nearly resolved by day 30 (Fig. 3A). In contrast, 3 days after admin istration of AdCMVLacZ, there was no evidence of an inflammatory infiltrate in the lungs of TNF-bp-treated C57BL/6—h/-h mice and only minimal evidence of infiltration was observed from day 3 through day 30. We next determined the expression of LacZ adenovirus gene-therapy product. The results indicate that the expression of ^-galactosidase (P-Gal) in control-treated C57BL/6—h/+ mice was high at day 3, but was considerably reduced by day 30 (Fig. 3B). The expression of the p-Gal in TNF-bp-treated C57BL/6-+/+ mice was equivalent at day 3 but, in contrast to the control-treated mice, the expression of p-Gal remained high in the lung through day 30. These results indicate that there is greatly decreased inflammatory disease and prolonged gene expression in AdCMVLacZ-infected mice treated with TNF-bp compared to vehicle-treated mice. The results also indicate that TNFa is a key factor in the pathogene sis of inflammation in AdCMVLacZ-virus-infected mice. Thus, the TNF-bp PEG-linked dimer may be therapeutically useful in reducing the inflammatory response to adenovirus gene therapy. V. Inhibition of Cell Cytolysis Which Combines Treatment vŝ ith Soluble DR5, Soluble Fas, and Soluble TNFR1 A major factor limiting prolonged transgene expression is due to the elimination of the cells infected by the adenovirus gene therapy that expresses the gene therapy product. Elimination of cells by either nonspecific "bystander" mediators or specific induction of cell death by T cells and other inflammatory 416 Zhang ef aL cells is carried out by the process of either necrosis or apoptosis. Necrosis results in lysis of the cell and is mediated by TNFa as well as other cytokines. Apoptosis results in elimination of the cell by triggering programmed cell death followed by phagocytosis of the cell into nearby reticulo-endothelial cells. The primary molecules that contain an intracellular death domain include Fas, TNF receptor (TNFR), and death domain receptor (DR3, -4, and -5) mediated by TRAIL (Fig. 4). The relative contribution of TNFa-mediated necrosis compared to Fas ligand (FasL) or TRAIL-mediated apoptosis was investigated using systemic treatment or adenovirus that expressed soluble forms of receptors capable of neutralizing these factors. We have previously shown that Fas-Fc is capable of neutralizing Fas ligand and preventing Fas ligand-mediated apoptosis [47]. Similarly, a soluble form of the death domain receptor 5 (sDR5-Fc) can neutralize TRAIL and inhibit TRAIL-mediated apoptosis [48]. Adenoviruses were constructed that expressed soluble forms of DR5-Fc (sDR5), AdsDR5, and soluble forms of Fas-Fc (sFas), AdsFas. The pretreatment with AdsFas can prevent liver cell apoptosis after iv administration of anti-Fas Jo-2 [49]. AdsDR5 was shown to protect TRAIL-mediated apoptosis of Jurkat T cells. TNFRI Figure 4 Death domain receptor family. Death domain family members are exemplified by Fas and TNF receptor 1 (TNFRI). These have three and four extracellular cystine-rich repeat domains, respectively. There is an 9- to 31-amino-acid linker between the extracellular domain and the transmembrane domain. Both molecules have a homologous intracellular death domain represented by a rectangle. Other members include cytotoxic apoptosis receptor 1 (CAR-1) and also death domain receptors that bind TNF-related apoptosis-inducing ligand (TRAIL). These receptors include death domain receptor 3 (DR3), DR4, and DR5. Also, there is a decoy receptor (DcRI) that can bind TRAIL but lacks the intracellular death domain and therefore binds to TRAIL but does not introduce apoptosis. 14. Novel Methods to Eliminate the Immune Response 417 S AdsDRS S AdsFas D STNFR1 S AdsDRS+AdsFas • AdsDR5+sTNFR1 • AdsFas+sTNR1 DPBS 7 14 Time (days) Figure 5 Inhibition of liver apoptosis by soluble TNFRl, soluble Fas, and soluble DR5. Mice were treated with adenovirus-expressing soluble Fas (AdsFas) and soluble DR5 (AdsDR5) as well as soluble TNFRl (100 ixg/mouse, iv). Mice were also given an Ad-luciferase. The luciferase activity was measured at 3, 7, 14, 30, and 50 days in mice treated with AdsDR5, AdsFas, sTNFRl protein, AdsDR5 plus AdsFas, AdsDRS plus sTNFRl, or AdsFas plus sTNFRl. As a control, mice were given Ad-luciferase plus PBS. To determine if adenovirus gene expression can be prolonged by protecting liver cells from apoptosis, mice vŝ ere pretreated v^ith either AdsDRS, AdsFas, or sTNFRl, or different combinations of these cytoprotective therapies. Pre- treatment v^ith AdsDR5 alone resulted in a greatly prolonged expression by the liver after subsequent administration of an Ad vector expressing luciferase (AdLuc) (Fig. 5). Consistent v^ith our previous results, the second most effec tive molecule to prolong luciferase expression v^as treatment v^ith
sTNFRl. Pretreatment v^ith AdsFas provided only modest prolongation of the luciferase gene expression. Combined treatment v^ith AdsDR5 and sTNFRl provided the greatest protective effect after administration of AdLuc and the greatest prolongation of gene expression. These results indicate that liver gene therapy is limited primarily by expression of TRAIL by either infected liver cells or the immune response to this adenovirus gene therapy and TNF and FasL play a lesser role. VI . Immune Privilege One physiologic mechanism for induction or maintenance of tolerance to self-antigens in the body is for the antigens to be present in an immune privileged site [50-52]. Although anatomical barriers and soluble mediators 4 1 8 Zhang efo/. have been implicated in immune privilege, it appears that apoptotic cell death of Fas-positive cells by tissue-associated FasL is an important component. Constitutive expression of FasL occurs in immune privilege sites including the retina, ciliary body, iris and cornea of the eye, and the testes, w^hich have been knov^n to be an immune privilege site. T cells that interact w îth antigens in immune privilege site upregulate Fas and enable Fas apoptosis signaling and are killed by FasL present in these sites. This prevents inflammation of these sites since the mouse cornea expresses abundant FasL and immune privilege has been implicated in the success of these corneal transplants. The ability of the eye to kill invading inflammatory cells helps maintain immune privilege and minimize bystander tissue damage, v^hile tolerance regulates dangerous inflammatory reactions to prevent autoimmunity. Adenovirus delivered to the eye fails to elicit an immune response [53-55]. The immune privilege site has been proposed to prevent reactivity in other tissues including the thyroid gland and pancreatic P-islet cells. Belgreu et al. [50] demonstrated that FasL expression by testicular Sertoli cells pro tected P-islet from rejection when transplanted heterotopically into the kidney capsule. Similarly, Griffith et al, [51, 52], w êre able to prevent rejection of allo geneic pancreatic islet cells by cotransplantation w îth FasL positive myoblast which were also transplanted to the kidney capsule. These observations were presumably the result of induction of apoptotic cell death of Fas-positive cells invading the graft from the Fas-positive graft tissue. The implication of these studies is that manipulation of the Fas-FasL system might provide a mechanism to prevent local inflammation. We have utilized the immune privilege concept to prolong gene therapy expression in muscle [56, 57]. For this purpose, we have produced a binary adenovirus system consisting of an AdLoxpFasL plus an AxCANCre [56]. AdLoxpFasL can be grown to high titer in 293 cells and does not produce Fas ligand in the absence of AxCANCre. Therefore, these viruses can be grown to high titers separately. However, when transfected into the same cell line, this leads to high-titer production of FasL. To create a local immune privilege site, we used gene therapy to reproduce the immune privilege site created by muscle cells as described above [56, 57], BALB/c mice were injected intraglossally with either AdLoxpFasL plus AxCANCre plus AdCMVLuciferase or with AdLoxpFasL plus AdCMVTK (thymidine kinase) plus AdCMVLuciferase. As a control, mice were injected with luciferase. The mice were analyzed at days 7, 21, 35, and 50 postinjection and luciferase was determined in the harvested tissue. There was no increase in the prolongation of the expression of the vector-encoded transgene by attempting to produce an immune privilege site in muscle and diminish the immune eradication of these vector-transduced cells. This brings up several issues related to the use of FasL for prolongation of gene therapy. First, it is possible that, in the attempt to produce an immune privilege site, ectopic expression of FasL can actually elicit an inflammatory response. 14. Novel Methods to Eliminate the Immune Response 4 1 9 Second, the coexpression of Fas with an ectopic FasL can induce an autocrine loop which might induce target cell apoptosis. In addition, the magnitude and temporal pattern of FasL expression may be critical to determine its efficacy in creation of an immune privilege site. For these reasons, creation of a local immune privilege site in muscle by FasL does not result in prolonged transgene expression. VII. APC-AdFasL Prolongs Transgene Expression and Specifically Minimizes T-Cell Response Adenovirus gene therapy is limited by induction of an immune response to the virus or gene therapy protein product. APCs lead to antigen processing and presentation of T cells which can be highly immunogenic or tolerogenic, depending on costimulatory molecules and production of other cytokines, such as FasL. T-cell tolerance after an immune response to adenovirus is also maintained by activation-induced cell death (AICD) of T cells mediated by Fas/FasL interactions. We surmise that APCs such as macrophages, which express FasL, might directly induce apoptosis of T cells that express Fas as cell therapy resulting in an adenovirus-specific T-cell tolerance without toxic effects of FasL (Fig. 6). The AdLoxpFasL can be used to infect APCs from Ipr/lpr mice and does not kill these APCs since these APCs lack Fas expression [58, 59]. These AdLoxpFasL plus AxCANCre-infected APCs (APC-AdFasL) resuh in high production of FasL capable of lysing A20 target cells. The macrophages infected by the adenovirus exhibited at least a 50- to 100-fold higher FasL titer compared to PMA-activated T cells. High levels of FasL expression by the macrophages were sustained for at least 7 days of in vitro culture. These results indicate that adenovirus can deliver FasL into the primary-culture macrophages from Fas mutant Ipr/lpr mice, and this leads to a high level of FasL expression by the macrophages without toxicity to the macrophages. To determine if APC-AdFasL could inhibit an immune response to Ad, mice were pretreated with APC-AdFasL every 3 days for five doses. After 7 days, the mice were inoculated intravenously with 10^^ pfu of AdCMVLacZ. P-Gal staining was determined up to 50 days later (Fig. 7) [58]. The levels of LacZ gene expression in the liver of control-treated mice decreased rapidly after pretreatment with APC-Ad control. In contrast, in mice treated with APC- AdFasL, the levels of LacZ expression did not decrease but were sustained for at least 50 days after infection. These results indicate that pretreatment with APC-AdFasL significantly prolonged AdCMVLacZ transgene expression. To determine if the APC-AdFasL therapy resulted in a preferential specific deletion of Ad-reactive T cells, but not T cells reactive with other viruses, wild-type C57BL/6-+/-h mice were treated with APCs, APC-Ad control, or APC-AdFasL 420 Zhang ef aL Ad-FasL FasL Apoptosis Ad-specific T cells Ad-Ag Figure 6 Specific apoptosis of T cells by APC-Ad-FasL therapy. Macrophages are infected with an AdFas ligand (Ad-FasL) gene expression system. This results in high expression of FasL on the surface of macrophages. Macrophages do not undergo autocrine apoptosis since they are derived either from Ipr mice (Fas mutant) or express an anti-apoptosis gene. In addition, macrophages will process and present adenovirus antigens (Ad-Ag) specifically to T cells. Activation by processing Ad-Ag by macrophage upregulates Fas expression and also Fas apoptosis signaling, facilitating apoptosis of Ad-specific T cells in the presence of FasL produced by the macrophage. c 'S n APC-AdFasL O 100000 Q. k. H APC-AdControl 0) • PBS > o •5; 10000 o O) E c I 1000 4 'E 3 0) > 2 100 I bt tt 7 14 21 30 50 Days post-injection (IV) with AdCI\/IVLacZ Figure 7 AdLuc transgene expression after APC-AdFasL followed by AdCMVLacZ. Wild-type C57BL/6 -+ /+ mice were treated with 1 x 1C^ of APCs cotransfected with AdLoxpFasL plus AxCAN- Cre (APC-AdFasL), or APCs cotransfected with AdLoxpFasL plus AdCMVLUC (APC-AdControl), or phosphate-buffered saline (PBS) every 3 days until five closes were given. After 7 days, the mice were inoculated iv with 1 x 10^^ pfu of AdCMVLacZ and p-Gal was determined up to 50 days later. The error bars represent the mean ± standard error of the mean (SEM) for three mice analyzed separately in triplicates. 14. Novel Methods to Eliminate the Immune Response 421 ou - ? 60- ^ 3 40- 1 T • Control CM • Ad ^ 20- n _ 1 J nMCMV APC-AdControl APC-AdFasL Treatment Figure 8 IL-2 production by T cells stimulated with APC plus MCMV after APC-AdFasL. Wild-type mice were treated with either APC-AdFasL or APC-Ad Control. Seven days later, mice were challenged in vitro with either AdCMVLacZ or MCMV. Seven days after splenic T cells were stimulated in vitro with either APCs, AdCMVLacZ transfected APCs, or MCMV-infected APCs. IL-2 production in the supernatants was determined by ELISA. every 3 days until five doses as above. To determine w^hether the T-cell tolerance induced by APC-AdFasL vŝ as specific, the T-cell response of APC-AdFasL- and APC-Ad control-tolerized mice to murine cytomegalovirus (MCMV) infection was evaluated. C57BL/6-+/+ mice v^ere treated as described above and then challenged 7 days later v^ith either adenovirus or MCMV. Although there was a reduction in the T-cell response through adenovirus vector, the T-cell response to MCMV was not impaired as demonstrated by comparable levels of IL-2 produced by T cells from both APC-Ad control- and APC-AdFasL-treated mice (Fig. 8). These results indicate that inhibition of the T-cell response in APC-AdFasL-tolerized mice is specific for the adenovirus vector. VIII. Production of AdsTACI Prolongs Gene Expression and Minimizes B-Cell Response The TNF receptor family includes apoptosis-signaling molecules as described above including TNFRl, TNFR2, Fas, CD40, DR4, and DR5 [60-64] (Fig. 4]). In addition, the TNF receptor family contains factors related to B-cell growth including TNF- and apoptosis ligand-related lymphocyte-expressed ligand 1 (TALL-1)/B lymphocyte stimulator (BlyS) factor that belongs to the TNF family. TALL-1 is a potent B cell costimulatory factor and acts by direct binding and activating its cell surface receptor on B cells, referred to as transmembrane activator and calcium modulator and cyclophilin ligand (CAML) interactor (TACI). The interaction between TALL-1 and TACI 422 Zhang et aL is important for regulation of B-cell growth and humoral immunity. Stimulation through this pathway promotes production of antibody and autoantibodies. We surmise that blocking this pathway with a soluble TACI-Fc (sTACI-Fc) that binds to TALL-1 would inhibit the B-cell response to adenovirus gene therapy. We therefore constructed an adenovirus expressing sTACI-Fc in the El A site of adenovirus. C57BL/6-+/+ mice were injected on day 0 with AdsTACI (5 x 10^ pfu, iv) and AdLacZ (5 x 10^ pfu iv). On day 3, the mice were either untreated or treated with APC-AdFasL to modulate the T-cell response to adenovirus. On days 7,14, 30, and 50, the antibody production to Ad was determined using an Ad neutralization assay. The Ad neutralization assay was carried out using two fold dilution of sera, which was then incubated with an Ad vector expressing green fluorescent protein (AdGFP) for 1 h (Fig. 9). The AdGFP was then inoculated with 293 cells for an additional hour and the unbound AdGFP was washed with PBS. The infected 293 cells were incubated at 37°C for another 3 days, and the percent of GFP-positive cells was assayed as an indicator of the level of adenovirusneutralizing antibody. In control mice, there were high levels of anti-Ad IgG immunoglobulin that reached a maximum titer at day 30 in 800 ^ 700 Days post-treatment o 1 • 0 S 600-\| • 7 O 500^ N 400 S 300-j I m 14 0 30 ^ 5 0 3 O 200-\| 100-1 1 I Control APC/FasL APC/FasL/sTACI sTACI 0 Treatment Figure 9 Reduction of onti-adenovirus antibody response by treatment with AdsTACI. C57BL/6 mice were injected on day 0 with AdsTACI (5 x 10^ pfu, iv) and AdLacZ (5 x 10^ pfu, iv). On day 3, the mice were either untreated or treated with AdAPC-FasL to modulate the T-cell response to adenovirus. The Ad neutralization assay was carried out using a twofold solution of sera which was incubated with AdGFP for 1 h. Sera were collected on days 0, 7, 14, 30, and 50 after administration of AdLacZ or AdsTACI. 14. Novel Methods to Eliminate the immune Response 4 2 3 the absence of any immunosuppressive treatment. In the presence of AdsTACI administered on day 0, the IgG anti-Ad neutraUzation titers remained very lov^ throughout the time course of the study. APC-AdFasL therapy reduced the peak titer especially on days 30 and 50, but the neutralization titer at these time points w âs higher than AdsTACI treatment alone. The combined treatment vŝ ith AdsTACI and APC-AdFas ligand vv̂ as similar
to treatment v^ith AdsTACI alone. These results indicate that treatment v^ith APC-AdFasL or blocking B cells signaling w îth AdsTACI can greatly inhibit the peak anti-Ad immunoglobulin production and also prevent long-term antibody production against adenovirus. IX. Summary Suppression of the T-cell main response to adenovirus, to date, has gen erally been achieved using the same paradigms to reduce the cellular immune response as applied in other systems. This includes reducing the T-cell response either by inhibiting T-cell activation at the surface by blocking costimula- tory molecules such as the CD28/CTLA4 or B7.1/B7.2 ligand pathw^ay or by blocking intracellular signaling using cyclosporine or FK506. More general immunosuppressants such as prednisone and cyclophosphamide also suppress the immune response and are synergistic v̂ îth more specific T-cell surface or intracellular signaling pathv^ays. Similarly, more general immunosuppres sants such as TNF receptor Fc or sTNF receptor can block proinflammatory cytokines after stimulation of an immune response by adenovirus and are synergistic v^ith direct immunosuppressants of the T cells. Methods to elimi nate these cells rather than to suppress them include treatment w îth anti-CD4 or anti-CD3, or more specific cell gene therapy methods using APC-AdFasL v^hich kill T cells that interact v̂ îth APCs that express Ad virus or transgene. All of these three approaches can be used together to exhibit synergistic effects to reduce the number of Ad-reactive T cells, the activation of Ad-specific T cells, and the inflammatory mediators produced by these Ad-specific T cells. A second approach is to reduce the antigenicity of the adenovirus or the transgene. Such methods are analogous to, for example, decreasing the cel lular immune response to organ transplant by tissue typing. In the case of adenovirus, certain components of the virus are know^n to be more antigenic than others and can be eliminated to produce replication-deficient Ad. The ultimate result is the "gutless" adenovirus that only contains the transgene v^ith the Ad inverted terminal repeats (ITRs). The immune response to the transgene is similar to the immune response to any biological administered reagent such as factor IX or soluble TNF receptor-Fc. These responses lead to neutralizing antibodies to the transgene or administered biologic protein and mechanisms to eliminate antibody response can also be successfully reduced or eliminated. 4 2 4 Zhang et at. References 1. Yang, Y., Nunes, F. A., Berencsi, K., Furth, E. E., Gonczol, E., and Wilson, J. M. (1994). Cellular immunity to viral antigens limits El-deleted adenoviruses for gene therapy. Proc. Natl. Acad. Sci. USA 91, 4407-4411. 2. Yang, Y., Ertl, H. C , and Wilson, J. M. (1994). MHC class I-restricted cytotoxic T lym phocytes to viral antigens destroy hepatocytes in mice infected with El-deleted recombinant adenoviruses. Immunity 1, 433-442. 3. Chirmule, N., Hughes, J. V., Gao, G. P., Raper, S. E., and Wilson, J. M. (1998). Role of E4 in eliciting CD4 T-cell and B-cell responses to adenovirus vectors delivered to murine and nonhuman primate lungs./. Virol. 72, 6138-6145. 4. Bennett, E. M., Bennink, J. R., Yewdell, J. W., and Brodsky, F. M. (1999). Cutting edge: Adenovirus El9 has two mechanisms for affecting class I MHC expression./. Immunol. 162, 5049-5052. 5. Wold, W. S., Doronin, K., Toth, K., Kuppuswamy, M., Lichtenstein, D. L., and Tollefson, A. E. (1999). Immune responses to adenoviruses: Viral evasion mechanisms and their impli cations for the clinic. Curr. Opin. Immunol. 11, 380-386. 6. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, \555-1566. 7. Fang, B., Eisensmith, R. C , Wang, H., Kay, M. A., Cross, R. E., Landen, C. N., Gordon, G., Bellinger, D. A., Read, M. S., Hu, P. C , et al. (1995). Gene therapy for hemophilia B: Host immunosuppression prolongs the therapeutic effect of adenovirus-mediated factor IX expression. Hum. Gene Ther. 6, 1039-1044. 8. Lochmuller, H., Petrof, B. J., Pari, G., Larochelle, N., Dodelet, V., Wang, Q., Allen, C , Prescott, S., Massie, B., Nalbantoglu, J., and Karpati, G. (1996). Transient immunosuppres sion by FK506 permits a sustained high-level dystrophin expression after adenovirus-mediated dystrophin minigene transfer to skeletal muscles of adult dystrophic (mdx) mice. Gene Ther. 3, 706-716. 9. Howell, J. M., Lochmuller, H., O'Hara, A., Fletcher, S., Kakulas, B. A., Massie, B., Nalban toglu, J., and Karpati, G. (1998). High-level dystrophin expression after adenovirus-mediated dystrophin minigene transfer to skeletal muscle of dystrophic dogs: Prolongation of expression with immunosuppression. Hum. Gene Ther. 9, 629-634. 10. Ilan, Y., Jona, V. K., Sengupta, K., Davidson, A., Horwitz, M. S., Roy-Chowdhury, N., and Roy-Chowdhury, J. (1997). Transient immunosuppression with FK506 permits long-term expression of therapeutic genes introduced into the liver using recombinant adenoviruses in the rat. Hepatology 26, 949-956. 11. Ilan, Y., Prakash, R., Davidson, A., Jona, Droguett, G., Horwitz, M. S., Chowdhury, N. R., and Chowdhury, J. R. (1997). Oral tolerization to adenoviral antigens permits long-term gene expression using recombinant adenoviral vectors. / . Clin. Invest. 99, 1098-1106. 12. DeMatteo, R. P., Raper, S. E., Ahn, M., Fisher, K. J., Burke, C , Radu, A., Widera, G., Clay- tor, B. R., Barker, C. F., and Markmann, J. F. (1995). Gene transfer to the thymus. A means of abrogating the immune response to recombinant adenovirus. Ann. Surg. Ill, 229-239. 13. Sawchuk, S. J., Boivin, G. P., Duwel, L. E., Gall, W., Bove, K., Tarpnell, B., and Hirsch, R. (1996). Anti-T cell receptor monoclonal antibody prolongs transgene expression follow ing adenovirus-mediated in vivo gene transfer to mouse synovium. Hum. Gene Ther. 7, 499-506. 14. DeMatteo, R. P., Markmann, J. F., Kozarsky, K. F., Barker, C. F., and Raper, S. E. (1996). Prolongation of adenoviral transgene expression in mouse liver by T lymphocyte subset depletion. Gene Ther. 3, 4 -12 . 14. Novel Methods to Eliminate the Immune Response 4 2 5 15. Chirmule, N., Truneh, A., Haecker, S. E., Tazelaar, J., Gao, G. P., Raper, S. E., Hughes, J. V., and Wilson, J. M. (1999). Repeated administration of adenoviral vectors in lungs of human CD4 transgenic mice treated v^ith a nondepleting CD4 antibody./. Immunol. 163, 448-455. 16. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 17. Kay, M. A., Holterman, A. X., Meuse, L., Gov^n, A., Ochs, H. D., Linsley, P. S., and Wil son, C. B. (1995). Long-term hepatic adenovirus-mediated gene expression in mice following CTLA4Ig administration. Nat. Genet. 11, 191-197. 18. Kay, M. A., Meuse, L., Gown, A. M., Linsley, P., HoUenbaugh, D., Aruffo, A., Ochs, H. D., and Wilson, C. B. (1997). Transient immunomodulation with anti-CD40 ligand antibody and CTLA4Ig enhances persistence and secondary adenovirus-mediated gene transfer into mouse liver. Froc. Natl. Acad. ScL USA 94, 4686-4691. 19. Ideguchi, M., Kajiwara, K., Yoshikawa, K., Uchida, T., and Ito, H. (2000). Local adenovirus- mediated CTLA4-immunoglobulin expression suppresses the immune responses to adenovirus vectors in the brain. Neuroscience 95, 217-226. 20. Guibinga, G. H., LochmuUer, H., Massie, B., Nalbantoglu, J., Karpati, G., and Petrof, B. J. (1998). Combinatorial blockade of calcineurin and CD28 signaling facilitates primary and secondary therapeutic gene transfer by adenovirus vectors in dystrophic (mdx) mouse muscles. / . V/Vo/. 72,4601-4609. 21. Schowalter, D. B., Meuse, L., Wilson, C. B., Linsley, P. S., and Kay, M. A. (1997). Constitutive expression of murine CTLA4Ig from a recombinant adenovirus vector results in prolonged transgene expression. Gene Ther. 4, 853-860. 22. Ah, R. R., Reichel, M. B., Byrnes, A. P., Stephens, C. J., Thrasher, A. J., Baker, D., Hunt, D. M., and Bhattacharya, S. S. (1998). Co-injection of adenovirus expressing CTLA4-Ig prolongs adenovirally mediated lacZ reporter gene expression in the mouse retina. Gene Ther. 5, 1561-1565. 23. Chirmule, N., Raper, S. E., Burkly. L., Thomas, D., Tazelaar, J., Hughes, J. V., and Wilson, J. M. (2000). Readministration of adenovirus vector in nonhuman primate lungs by blockade of CD40-CD40 ligand interactions./. Virol. 74, 3345-3352. 24. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., HoUenbaugh, D., Linsley, P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and facilitates expression after secondary vector administration./. Virol. 72, 7542-7550. 25. Jooss, K., Turka, L. A., and Wilson, J. M. (1998). Blunting of immune responses to adenoviral vectors in mouse liver and lung with CTLA4Ig. Gene Ther. 5, 309-319. 26. Stein, C. S., Pemberton, J. L., van Rooijen, N., and Davidson, B. L. (1998). Effects of macrophage depletion and anti-CD40 ligand on transgene expression and redosing with recombinant adenovirus. Gene Ther. 5, 431-439. 27. Kuzmin, A. L, Galenko, O., and Eisensmith, R. C. (2000). An immunomodulatory procedure that stabilizes transgene expression and permits readministration of el-deleted adenovirus vectors. Mol. Ther. 3, 293-301. 28. Stein, C. S., Martins, L, and Davidson, B. L. (2000), Long-term reversal of hypercholes terolemia in low density lipoprotein receptor (LDLR)-deficient mice by adenovirus-mediated LDLR gene transfer combined with CD154 blockade. / . Gene Med. 2, 4 1 - 5 1 . 29. Yang, Y., Su, Q., Grewal, L S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues. / . Virol. 70, 6370-6377. 30. Cichon, G., and Strauss, M. (1998). Transient immunosuppression with 15-deoxyspergualin prolongs reporter gene expression and reduces humoral immune response after adenoviral gene transfer. Gene Ther. 5, 85-90. 4 2 6 Zhang ef al. 31. Kaplan, J. M., and Smith, A. E. (1997). Transient immunosuppression with deoxysperguahn improves longevity of transgene expression and ability to readminister adenoviral vector to the mouse lung. Hum. Gene Ther. 8, 1095-1104. 32. Smith, T. A., White, B. D., Gardner, J. M., Kaleko, M., and McClelland, A. (1996). Transient immunosuppression permits successful repetitive intravenous administration of an adenovirus vector. Gene Ther. 3, 496-502. 33. Lee, M. G., Abina, M. A., Haddada, H., and Perricaudet, M. (1995). The constitutive expression of the immunomodulatory gpl9 k protein in E1-, E3- adenoviral vectors strongly reduces the host cytotoxic T cell response against the vector. Gene Ther. 2, 256-262. 34. Wang, Q., Greenburg, G., Bunch, D., Farson, D., and Finer, M. H. (1997). Persistent transgene expression in mouse liver follov^ing in vivo gene transfer with a delta El/delta E4 adenovirus vector. Gene Ther. 4, 393-400. 35. Yang, Y., Su, Q., and Wilson, J. M. (1996). Role of viral antigens in destructive cellu lar immune responses to adenovirus vector-transduced cells in mouse lungs. / . Virol. 70, 7209-7212. 36. Harvey, B. G., Worgall, S., Ely, S., Leopold, P. L., and Crystal, R. G. (1999). Cellular immune responses of healthy individuals to intradermal administration of an El-E3-adenovirus gene transfer vector. Hum. Gene Ther. 10, 2823-2837. 37. Chen, H. H., Mack, L. M., Kelly, R., Ontell, M., Kochanek, S., and Clemens, P. R. (1997). Persistence in muscle of an adenoviral vector that lacks all viral genes. Proc. Natl. Acad. Set. USA 94, 1645-1650. 38. Christ, M., Lusky, M., Stoeckel, F., Dreyer, D., Dieterle, A., Michou, A. I., Pavirani, A., and Mehtali, M. (1997). Gene therapy with recombinant adenovirus vectors: Evaluation of the host immune response. Immunol. Lett. 57, 19-25. 39. Molinier-Frenkel, V., Gahery-Segard, H., Mehtali, M., Le Boulaire, C , Ribault, S., Boulanger, P., Tursz, T., Guillet, J. G., and Farace, F. (2000). Immune response to recombinant adenovirus in humans: Capsid components from viral input are targets for vector-specific cytotoxic T lymphocytes./. Virol. 74, 7678-7682. 40. Harvey, B. G., Worgall, S., Ely, S., Leopold, P. L., and Crystal, R. G. (1999). Cellular immune responses of healthy individuals to intradermal administration of an El-E3-adenovirus gene transfer vector. Hum. Gene Ther. 10, 2823-2837. 41. Kolls, J. K., Lei, D., Nelson, S., Summer, W. R., Greenberg, S., and Beutler, B. (1995). Adenovirus-mediated blockade of tumor necrosis factor in mice protects against endotoxic shock yet impairs pulmonary host defense. / . Infect. Dis. 171, 570-575. 42. Harrod, K. S., Hermiston, T. W., Trapnell, B. C , Wold, W. S., and Whitsett, J. A. (1998). Lung-specific expression of adenovirus E3-14.7 K in transgenic mice attenuates adenoviral vector-mediated lung inflammation and enhances transgene expression. Hum. Gene Ther. 9, 1885-1898. 43. Peng, Y., Trevejo, J., Zhou, J., Marino, M. W., Crystal, R. G., Falck-Pedersen, E., and Elkon, K. B. (1999).
Inhibition of tumor necrosis factor alpha by an adenovirus-encoded soluble fusion protein extends transgene expression in the liver and lung./. Virol. 73, 5098-5109. 44. Minter, R. M., Rectenwald, J. E., Fukuzuka, K., Tannahill, C. L., La Face, D., Tsai, V., Ahmed, I., Hutchins, E., Moyer, R., Copeland, E. M., 3rd, and Moldawer, L. L. (2000). TNF- alpha receptor signaling and IL-10 gene therapy regulate the innate and humoral immune responses to recombinant adenovirus in the lung. / . Immunol. 164, 443-451. 45. Zhang, H. G., Zhou, T., Yang, P., Edwards, C. K., 3rd, Curiel, D. T., and Mountz, J. D. (1998). Inhibition of tumor necrosis factor alpha decreases inflammation and prolongs adenovirus gene expression in lung and liver. Hum. Gene Ther. 9, 1875-1884. 46. Zhang, H. G., Xie, J., Yang, P., Wang, Y., Xu, L., Liu, D., Hsu, H. C , Zhou, T., Edwards, C. K., 3rd, and Mountz, J. D. (2000). Adeno-associated virus production of soluble tumor necrosis factor receptor neutralizes tumor necrosis factor alpha and reduces arthritis. Hum. Gene Ther. 11,2431-2442. 14. Novel Methods to Eliminate the Immune Response 4 2 7 47. Cheng, J., Zhou, T., Liu, C , Shapiro, J. P., Brauer, M. J., Kiefer, M. C , Barr, P. J., and Mountz, J. D. (1994). Protection from Fas-mediated apoptosis by a soluble form of the Fas molecule. Science 263, 1759-1762. 48. Strehlow, D., Jodo, S., and Ju, S. T. (2000). Retroviral membrane display of apoptotic effector molecules. Proc. Natl. Acad. Sci. USA 97, 4209-4214. 49. Matsuki, Y., Li, L., Hsu, H. - C , Yang, P., Zheng, R., Edwards, C. K. Ill, Chaudry, I. H., Mountz, J. M., Zhang, H. -G., and Mountz, J. D. (2002). Soluble Fas gene therapy protects against Fas-mediated apoptosis of hepatocytes but not the lethal effects of Fas-induced TNF-a production by Kupffer Cells. Cell Death Diff., in press. 50. Bellgrau, D., Gold, D., Selawry, H., Moore, J., Franzusoff, A., and Duke, R. C. (1995). A role for CD95 ligand in preventing graft rejection. Nature 377, 630-632. 51. Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R., and Ferguson, T. A. (1995). Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270, 1189-1192. 52. Griffith, T. S., Yu, X., Herndon, J. M., Green, D. R., and Ferguson, T. A. (1996). CD95- induced apoptosis of lymphocytes in an immune privileged site induces immunological tolerance. Immunity 5, 7-16. 53. Bennett, J., Pakola, S., Zeng, Y., and Maguire, A. (1996). Humoral response after administra tion of El-deleted adenoviruses: Immune privilege of the subretinal space. Hum. Gene Ther. 7, 1763-1769. 54. Reichel, M. B., Ah, R. R., Thrasher, A. J., Hunt, D. M., Bhattacharya, S. S., and Baker, D. (1998). Immune responses limit adenovirally mediated gene expression in the adult mouse eye. Gene Ther. 5, 1038-1046. 55. Rubinchik, S., Ding, R., Qiu, A. J., Zhang, F., and Dong, J. (2000). Adenoviral vector v̂ ĥich delivers FasL-GFP fusion protein regulated by the tet-inducible expression system. Gene Ther. 7, 875-885. 56. Bilbao, G., Zhang, H., Contreras, J. L., Zhou, T., Feng, M., Saito, I., Mountz, J. D., and Curiel, D. T. (1999). Construction of a recombinant adenovirus vector encoding Fas ligand with a CRE/Loxp inducible system. Transplant Proc. 31, 792-793. 57. Zhang, H. G., Bilbao, G., Zhou, T., Contreras, J. L., Gomez-Navarro, J., Feng, M., Saito, I., Mountz, J. D., and Curiel, D. T. (1998). Application of a Fas ligand encoding a recombinant adenovirus vector for prolongation of transgene expression./. Virol. 72, 2483-2490. 58. Zhang, H. G., Liu, D., Heike, Y., Yang, P., Wang, Z., Wang, X., Curiel, D. T., Zhou, T., and Mountz, J. D. Induction of specific T-cell tolerance by adenovirus-transfected. Fas ligand-producing antigen presenting cells. Nat. Biotechnol. 16, 1045-1049. 59. Zhang, H. G., Zhou, T., Yang, P., Edwards, C. K., 3rd, Curiel, D. T., and Mountz, J. D. (1998). Inhibition of tumor necrosis factor alpha decreases inflammation and prolongs adenovirus gene expression in lung and liver. Hum. Gene Ther. 9, 1875-1884. 60. Rennert, P., Schneider, P., Cachero, T. G., Thompson, J., Trabach, L., Hertig, S., Holler, N., Qian, F., Mullen, C , Strauch, K., Browning, J. L., Ambrose, C , and Tschopp, J. A. (2000). Soluble form of B cell maturation antigen, a receptor for the tumor necrosis factor family member APRIL, inhibits tumor cell growth. / . Exp. Med. 192, 1677-1684. 61. von Bulow, G. U., and Bram, R. J. (1997). NF-AT activation induced by a CAML-interacting member of the tumor necrosis factor receptor superfamily. Science 278, 138-141. 62. Gross, J. A., Johnston, J., Mudri, S., Enselman, R., Dillon, S. R., Madden, K., Xu, W., Parrish-Novak, J., Foster, D., Lofton-Day, C , Moore, M., Littau, A., Grossman, A., Haugen, H., Foley, K., Blumberg, H., Harrison, K., Kindsvogel, W., and Clegg, C. (2000). TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 404, 995-943. 63. Xia, X. Z., Treanor, J., Senaldi, G., Khare, S. D., Boone, T., Kelley, M., Theill, L. E., Colombero, A., Solovyev, I., Lee F., McCabe, S., Elliott, R., Miner, K., Hawkins, N., Guo, J., Stolina, M., Yu, G., Wang, J., Delaney, J., Meng, S. Y., Boyle, W. J., and Hsu, H. (2000). 4 2 8 Zhang ef al. TACI is a TRAF-interacting receptor for TALL-1, a tumor necrosis factor family member involved in B cell regulation./. Exp. Med. 192, 137-143. 64. Wu, Y., Bressette, D., Carrell, J. A., Kaufman, T., Feng, P., Taylor, K., Gan, Y., Cho, Y. H., Garcia, A. D., Gollatz, E., Dimke, D., LaFleur, D., Migone, T. S., Nardelli, B., Wei, P., Ruben, S. M., Ullrich, S. J., Olsen, H. S., Kanakaraj, P., Moore, P. A., and Baker, K. P. (2000). Tumor necrosis factor (TNF) receptor superfamily member TACI is a high affinity receptor for TNF family members APRIL and BLyS. / . Biol. Chem. 275, 35,478-35,485. C H A P T E R High-Capacity ''Gutless'' Adenoviral Vectors: Technical Aspects and Applications Gudrun Schiedner/ Paula R. Clemens,^ Christoph Volpers,'' and Stefan Kochanek'' *Center for Molecular Medicine University of Cologne Cologne, Germany "'"Department of Neurology University of Pittsburgh Pittsburgh, Pennsylvania •• Introduction Successful somatic gene therapy fundamentally depends on the availabil ity of vectors that allow the efficient and nontoxic delivery of nucleic acids into the appropriate target cells. El-deleted first-generation adenoviral vectors have been used in a number of clinical trials for the treatment of neoplastic and inherited disorders. So far these vectors have been based on adenovirus serotypes 2 and 5 and have usually been produced in the El-complementing 293 cell line [1]. These vectors may still find an application in the treatment of cancer diseases or for vaccination in which "immunostimulation" by viral functions may act as a beneficial adjuvant to the function of the transgene. However, it is unlikely that in the future these vectors will still be used for the treatment of inherited recessive or dominant disorders that would require durable expression of the therapeutic gene. Immune responses to viral proteins expressed from the vector have been observed in various systems. Immediate toxic effects following gene transfer with high vector doses have been attributed both to the viral capsid and to viral gene expression. Chronic toxicity, apparently unrelated to a specific antiviral immune response has been noted [2]. A DNA capacity of 7-8 kb allows the expression of many cDNAs ADENOVIRAL VECTORS FOR GENE THERAPY 4 2 9 Copyright 2002, Elsevier Science (USA). All rights reserved. 4 3 0 Schiedner ef al. but not of all. However, the main reason why first-generation vectors should not be used for the treatment of inherited disorders in which long-term gene expression is required lies in the realistic appreciation that our knowledge of potential interactions between functions from different viruses from the same or different species or between viral functions and exogenous factors is very slim. As has been discussed before [3], it is likely that there could and would be interactions between viral functions of the gene transfer vector and of other virus species. Because the consequences of such interactions are currently largely unpredictable, gene transfer studies in humans that are based on vectors that still carry viral genes have to be subjected to extremely careful risk-benefit considerations. In an attempt to address several of the disadvantages of first and second- generation adenoviral vectors, a new vector has been developed [4-11] that has been variably named "high-capacity (HC)," "gutless," "gutted," "mini," "deleted," "third-generation," "delta (A)," or "helper-dependent (HD)" ade noviral vector. For simplicity the term HC-Ad vector is used throughout this text. This chapter is divided into two parts. In the first part, technical aspects are discussed as they relate to the production and the design of HC-Ad vectors. In the second part the results of gene transfer experiments are summarized. II. Technical Aspects A. Vector Production The production of first-generation adenovirus vectors is relatively simple: only the El functions that are absent from the vector have to be complemented in a producer cell line. The 293 cell line [1] has been extremely valuable in serv ing the production needs for gene transfer vectors for many years. Vectors with additional mutations in the E2 and/or E4 genes (second-generation vectors) can still be relatively easily complemented by cell lines that provide the missing functions in trans. The production is considerably more complicated with vec tor genomes that have increasingly large deletions. The successful completion of a productive infection cycle and the generation of a large number of infec tious particles during production require the precise coordination of a complex viral transcription and replication program. The current production of HC-Ad vectors is based on earlier studies in which the accidental generation of hybrid vector genomes was observed. These consisted of both adenovirus and human or SV40 DNA, respectively, and were dependent on the presence of a wild-type helper virus [12, 13]. Based on these studies, several research groups success fully rescued recombinant adenoviral vector particles that did not contain any viral coding sequences and expressed different transgenes [4, 5, 8, 14]. The 15. High-Capacity '^Gutless'' Adenoviral Vectors 4 3 1 first vector that expressed a reporter gene and that was deleted in LI, L2, VAI+II, and pTP was produced by using wild-type adenovirus type 2 as helper virus [4]. It was possible to rescue, serially propagate, and partially purify a recombinant, although not fully deleted adenoviral vector. In one system [4, 15] a replication-deficient helper virus was engineered to carry a partially defective packaging signal in order to impair the packaging of the helper virus and thereby to enhance vector production. The packaging signal of Ad5 has been characterized in a series of elegant studies that involved the generation and analysis of a large number of packaging-deficient adenoviral mutants [16-19]. The adenoviral packaging element is located between nucleotides 230 and 370 and consists of seven elements, the so-called consensus A repeats AI-AVII. The detailed molecular mechanism of adenoviral DNA packaging is still not clear [20]. To attenuate the packaging capability of the helper virus, 91 bp of the packaging element involving AII-AV were deleted [5] using the packaging impaired adenoviral mutant dl309-267/358 as a template [17]. Compared to wild-type Ad5, this mutant can be grown in cell culture with about 90-fold reduced titer. Using this mutated packaging signal in an El-deleted helper virus it was possible to serially propagate a plaque isolate containing the vector and helper virus genome on 293 cells, and to separate helper virus and vector particles by CsCl equilibrium centrifugation. The HC-Ad vector was obtained in fairly high titers with a 1% contamination by helper virus. In these early studies an HC-Ad vector was generated that contained the 13.8-kb full-length murine dystrophin cDNA under the control of a 6.5-kb muscle-specific pro moter and a lacZ reporter gene. The only viral elements retained on the vector genome are the inverted terminal repeats (ITRs), which is the viral origin of replication, and the packaging signal. Using a comparable strategy, an HC-Ad vector that expressed the human Factor VIII gene was generated [15]. In these systems the recombinant vector DNA with the wild-type packaging signal is preferentially packaged into capsids. Because of differences in the densities of the particles it is possible to separate vector particles from helper virus by CsCl equilibrium centrifugation so that contamination of the vector with the helper virus is around 1%.
However, our own experiences indicate that by using this production system it would be very difficult if not impossible to produce clinical grade material in large amounts. A different and improved produc tion scheme, which takes advantage of the Cre-loxP recombination system of bacteriophage PI [21] considerably increased the ease of vector production and resulted in an increased vector yield and purity. This system utilizes a helper virus with the packaging signal being flanked by two loxP-recognition sites [9, 10]. As in the earlier production system the helper virus is El deficient and corresponds, therefore, to a replication-defective first-generation aden ovirus vector. The recombinant vector carrying the transgene is produced in 293 cells constitutively expressing Cre recombinase [22]. Following infection of producer cells the packaging signal of the helper virus is excised with high 432 Schiedner ef al. efficiency without affecting viral replication. Having lost the packaging signal by Cre-mediated excision, the helper virus is excluded from the capsids while the recombinant vector is efficiently packaged. Although the Cre-mediated removal of the packaging signal was shown to efficiently suppress helper virus contamination, sometimes overgrowth of the helper virus during amplifica tion has been observed [23]. The helper virus could escape suppression if one of the loxP sites flanking the packaging signal was lost by an intermolecular recombination event that occurred between the two identical packaging signals that are present on the helper virus and on the vector genome. Exchanging the DNA sequences between the consensus A repeats reduced the chances of homologous recombination between vector and helper virus genomes [23]. In a modification of the original Cre-loxP system, additional gene functions (DNA polymerase and preterminal protein) were deleted from the helper virus genome and supplied in trans in a packaging cell line [24, 25]. For clinical-grade production of HC-Ad vectors it is likely that Cre- recombinase-expressing cell lines will be used that are not based on 293 cells. As with first-generation adenovirus vectors there is sequence overlap between the El region in 293 cells and the helper virus genome. Therefore, a generation of replication-competent adenovirus (RCA) by homologous recombination is expected to be likely, especially if large amounts of vector are produced. Cell lines that exclude the generation of RCA have been developed [26, 27]. When Cre recombinase is expressed in these cells, efficient production of HC-Ad vectors with low helper virus contamination is possible [G.S., unpublished observation]. For construction of HC-Ad vector genomes, plasmid cloning strategies have been implemented. Most plasmids for HC-Ad vector construction harbor the left and right adenoviral ITRs, including the packaging signal, and different sizes of stuffer DNAs to accommodate different insert sizes. In these plasmids the ITRs are flanked by unique restriction sites that are used to release the plasmid backbone prior to the rescue of vector in the producer cell line. Following transfection of the vector plasmid into El and Cre expressing producer cells that are coinfected with a loxP helper virus, the vector titer is increased through four to six serial amplifications. In every amplification the cells are coinfected with loxP helper virus. Although excision of the packaging signal of the helper virus is not 100% efficient, the final helper virus contamination in this system can be less than 0 .1%. The vector yield per cell can be as high as 1000-2000 infectious units [G.S., unpubfished observation]. B. Stuffer DNA Earlier experiences with Ad5-SV40 hybrid vectors had suggested that the lower size limit for efficient production of adenoviral genomes is about 25 kb [66]. However, most expression cassettes that are currently in use for gene transfer are of much smaller sizes. Rearrangements and/or amplifications 15. High-Capacity '^Gutless'' Adenoviral Vectors 4 3 3 of the vector genome resulting in concatamerization of a starting monomer has been the rule in several studies in w^hich small expression cassettes v^ere rescued as deleted adenoviral vectors. The vector preparations consisted of viral particles that contained both monomeric and dimeric genomes and frequently w êre mixtures of particles v^ith head-to-head, head-to-tail, or tail-to-tail DNA concatemers [6, 14, 28, 29]. This size-dependence of stable vector production vŝ as confirmed with the loxP production system that w âs used to rescue and propagate HC-Ad vectors w îth differently sized vector genomes as starting material. Only vectors w îth genome sizes of at least 27 kb allov^ed efficient and stable vector amplification [30]. Thus, "stuffer" DNA has to be added to the therapeutic gene cassette to bring the total vector genome size to at least 27 kb. Some practical considerations are outlined here. Since approximately 30-kb plasmids are typically used for vector construction, the stuffer DNA should not contribute to instability during plasmid propagation in Escherichia coli. Larger stretches of repetitive elements might increase the likelihood of vector instability during cloning and production procedures and therefore should be avoided. Likewise, stuffer DNA should support stability and growth during viral vector amplification. Stuffer DNA should not interfere with transgene expression in vivo and should be transcriptionally silent. Other elements like matrix or scaffold attachment regions (MARs or SARs) may have positive influences on vector stability in the transduced cells. Stuffer DNA has the potential to promote recombination between HC-Ad vectors and the recipient cell genome since these vectors may share large stretches of homology with the genomic DNA of the target cell. This could increase the possibility of vector integration by homologous recombination. However, experimental evidence from in vitro studies suggests that, compared to first-generation adenoviral vectors, integration frequencies might be somewhat increased but are unlikely to be high [31]. There is some evidence that the source of the stuffer sequences may have an impact on the levels of transgene expression from the vector. An HC-Ad vector containing CpG-rich stuffer DNA derived from phage lambda resulted in significantly reduced and only short-term hepatic expression of a lacZ transgene when compared to an HC-Ad vector containing noncoding stuffer DNA from the human hypoxanthine-guanine phosphoribosyltransferase (HPRT) locus [32]. One explanation that could account for this observation was a possible inadvertent expression of phage lambda genes in eukaryotic cells resulting in toxicity or immunogenicity. In addition, lambda DNA harbors a high number of immunostimulatory CpG motifs which could contribute to the immunogenicity of the transgene protein. Human DNA sequence is probably the best source of stuffer DNA. Various HC-Ad vectors carrying human stuffer DNA have demonstrated high and long-lasting transgene expression in vivo [2, 29, 33-36]. These vectors either contained noncoding stuffer DNA from the human HPRT locus and/or from the human cosmid C346. Even though these 4 3 4 Schiedner ef al. stuffer DNAs were stable through cloning and amplification in most HC-Ad vectors, some reports have indicated instability of the stuffer DNA that was derived from the HPRT gene [23]. In these analyses, HC-Ad vectors containing stuffer DNAs from other human genomic loci seemed to have some growth advantages during amplification and also showed improved expression levels when compared to vectors containing HPRT stuffer DNAs. Future experiments will likely add to the understanding of the impact of human stuffer DNA on expression levels and stability. C. Vector Capsid Modification Experimental strategies directed toward the improvement of efficacy and safety of adenoviral, including HC-Ad vector-mediated, gene transfer by modification of the vector capsid involve three different aspects: first, attempts to circumvent the neutralizing immune response raised within the recipient following the initial vector delivery and preventing repeated administration; second, efforts to abolish the native adenoviral tropism in order to minimize transduction of nontarget tissues; and third, introduction of new ligands or binding domains to target the vector to specific cell types. The capsid of HC-Ad vectors, whose protein components are encoded by the helper virus genome, is not different from that of first-generation vectors. Therefore, neutralizing antibodies produced as a consequence of the first vector delivery still represent a significant problem in readministration schemes. Based on the observation that neutralizing antibodies are Ad type-specific [37], Parks et al. recently demonstrated that this problem can be overcome by the sequential use of HC-Ad vectors of alternative serotypes [38]. In addition to the Ad5-based helper virus originally used in the Cre/loxP system [9], a new helper virus was constructed that was based on serotype 2. An HC-Ad vector with an Ad2 capsid was injected into mice, followed 3 months later by administration of a HC-Ad vector that had either an Ad2 capsid or an Ad5 capsid. The repeat administration of the HC-Ad vector of the same serotype resulted in a 30- to 100-fold reduction in reporter gene expression in the liver, compared with unimmunized animals, whereas no decrease in transgene expression was observed when the second HC-Ad vector was of the different serotype. No Ad5-cross-reactive antibodies were produced in mice immunized with the Ad2- based vector [38]. Similarly, successful repeat vector delivery was achieved in baboons by sequential administration of Ad5- and Ad2-based first-generation Ad vectors [39]. These data indicate that such an approach, taking advantage of the availability of different adenoviral serotypes, might allow repeated gene transfer in immunocompetent individuals. With respect to strategies that aim at a modification of the tropism of adenoviral vectors, HC-Ad vector technology will build on the experience and results collected with first-generation vectors. Considerable progress has 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 3 5 recently been made to develop infectious vector particles v^ith reduced or no affinity for the native coxsackie-and-adenovirus receptor, CAR, by site-directed mutagenesis of the CAR-binding region in the fiber knob domain [40, 41], by the design of knobless vector particles [42], or by production of completely fiberless particles in specialized producer cells [43]. These modifications, when applied to HC-Ad vectors in the future, could further add to their targeting efficiency and safety by reducing undesired infection of nontarget cells and increasing vector concentration at target sites in vivo. Retargeting of first- generation vectors to cell surface molecules of interest has been achieved by the use of bispecific "adapter" molecules like bispecific recombinant antibod ies [44] or CAR fusion proteins [45], by chemical cross-linking of binding moieties to the vector capsid [46] or by genetic insertion of ligands either into the fiber knob protein [47] or the hexon protein [48]. (For comprehensive description of these strategies, see Chapter 8 in this volume). For retargeting of HC-Ad vectors, we have recently constructed a new Ad5-based helper virus containing two unique restriction sites in the fiber gene which facilitate inser tion of binding ligands into the fiber knob HI loop. In one line of experiments, an RGD peptide motif was inserted into this reengineered HI loop site for redirecting vectors to av integrins. HC-Ad reporter vectors produced using this helper virus transduced ovarian carcinoma cells as well as primary endothelial and smooth muscle cells with a 2- to 20-fold higher efficiency, depending on the cell type, than unmodified vectors [49], providing proof-of-concept experiments for the powerful combination of HC-Ad vector technology and retargeting strategies. III. Applications A. Liver Gene Transfer The liver possesses a variety of characteristics that make this organ very attractive for gene therapy. Because of the fenestrated structure of its endothelium, the liver parenchymal cells are readily accessible to large particles such as viruses present in the blood. With respect to blood circulation, the liver can serve as a secretory organ for the systemic delivery of many therapeutic proteins. In addition, in many inborn errors of metabolism the liver is the mainly affected organ. Adenoviral vectors gained considerable interest for liver gene therapy owing to their capacity to very efficiently transduce quiescent hepatocytes in vivo. In fact, upon intravenous injection into the tail vein of mice, a large proportion of adenovirus particles preferentially localizes to the liver. However, in immunocompetent animals and with first-generation adenoviral vectors, transgene expression in general is transient both due to the loss of transduced hepatocytes and to promoter inactivation. Immunological 4 3 6 Schiedner ef al. and toxic effects in transduced cells due to viral gene expression significantly limit the use of first-generation vectors for hepatic gene transfer in vivo. An HC-Ad vector expressing the human a 1-antitrypsin gene w âs used in several instructive experiments. Using the loxP helper virus production system, an HC-Ad vector w âs generated containing the 19-kb genomic human a 1-antitrypsin locus that included both the macrophage and liver- specific promoters, all exons and introns, and the natural polyadenylation signal [2]. al-Antitrypsin antagonizes
neutrophilic elastase and is abundantly expressed in hepatocytes and at a low^er level in macrophages. Expression in the tw ô cell types is regulated by different tissue-specific promoters. Currently, al-antitrypsin-deficient patients have a shortened life expectancy due to emphy sema. Patients are treated with v^eekly injections of human a 1-antitrypsin purified from human plasma. Gene transfer of 2 x 10^^ particles of this vector in immunocompetent C57BL/6J mice resulted in tissue-specific and stable gene expression for longer than 1 year. Transcription of the human a 1-antitrypsin RNA in the liver of transduced animals v^as initiated from the liver-specific promoter, but not from the macrophage-specific promoter. Gene transfer w îth increasing vector doses resulted in high and stable al-antitrypsin levels in serum. Significantly, w îth increasing vector doses, serum levels of a 1-antitrypsin w êre obtained that w^ould be considered supraphysiological in humans. Even these very high vector doses w êre not accompanied by liver toxicity. Mice that received the same dose of a first-generation vector carrying the human a 1-antitrypsin cDNA under the control of the murine phosphogylcerate kinase (PGK) promoter experienced liver damage as documented by histological abnormalities and elevated liver enzymes detected in the serum of transduced mice [50]. Gene transfer of this vector in baboons resulted in relatively stable transgene expression for longer than 16 months in tw ô of three baboons [39]. In these animals only a slow decline was observed to 19% and 8% of peak levels at 16 and 24 months, respectively. This was not surprising for two reasons. First, hepatocytes are not postmitotic and there is a regular, albeit slow, turnover in this cell type. Second, the animals were young and still growing when they were injected. Therefore, a decline of a 1-antitrypsin levels correlated with animal growth. In a third baboon, the generation of anti-al-antitrypsin antibodies was associated with a short duration of expression of only 2 months. Transgene expression in all three animals injected with a first-generation vector was limited to 3 to 6 months. The lack of anti-al-antitrypsin antibodies in these animals and further immunological studies suggested that cellular immune responses against viral proteins might have resulted in the elimination of vector-transduced hepatocytes. In summary, these studies demonstrated the main advantages of HC-Ad vectors: increased capacity allowing the incorporation of large DNA fragments and even some genes in the genomic context, improved levels and persistence of transgene expression, and significantly reduced toxicity. 15. High-Capacity "Gutless'' Adenoviral Vectors 4 3 7 Improved expression and decreased liver toxicity has also been observed follov^ing gene transfer v^ith an HC-Ad vector expressing the murine leptin cDNA from the human cytomegalovirus (HCMV) promoter [29]. Leptin is a potent modulator of weight and food intake. In leptin-deficient ob/ob mice, daily delivery of recombinant leptin protein suppresses appetite, induces weight reduction, and decreases blood insulin and glucose levels. Results from gene transfer experiments with a first-generation vector suggested that delivery of the leptin cDNA might provide therapeutic benefit equivalent to daily leptin protein treatment. However, the effects were only transient in both lean and ob/ob mice due to the loss of DNA and due to significant inflammatory changes in liver. Using an HC-Ad vector carrying the same expression cassette, leptin expression and physiological consequences were analyzed following gene transfer. In lean mice, tail vein injection of 1-2 x 10^^ particles of the HC-Ad vector resulted in long-term leptin expression. Gene expression in ob/ob mice (which are leptin-deficient and therefore not tolerant to leptin) following gene transfer with the same dose of an HC-Ad vector was improved, prolonged, and associated with increased weight loss. However, even in HC-Ad vector transduced ob/ob mice leptin serum levels declined and finally disappeared due to the generation of anti-leptin antibodies. Relatively realistic disease targets for HC-Ad vectors are the clotting disorders hemophilias A and B. The hemophilias are characterized by sponta neous and prolonged bleeding into joints, muscle, and internal organs. Current treatment of the hemophilias, which are often life-threatening and frequently associated with disabling arthropathy due to recurring joint bleeding, consists of protein-replacement therapy with infusion of plasma-derived or recom binant factor VIII (FVIII) or factor IX (FIX). The hemophilias are attractive candidates for gene therapy since they are due to single gene defects. A signif icant advantage is the fact that the therapeutic window is relatively broad. In addition, tissue-specific expression and precise control of the transgene expres sion is probably not required. Importantly, even moderate increases of FVIII or FIX levels would be sufficient to convert a severe hemophilia to a milder form. Intravenous injection of first-generation adenoviral vectors expressing the human or canine B-domain-deleted FVIIII cDNA in normal or hemophilic mice and dogs resulted in therapeutic and physiological levels of biologically active FVIII that was accompanied by a correction of bleeding tendency. However, both in hemophilic mice and dogs FVIII levels gradually declined, resulting in only short-term phenotypic correction. In mice transduced with a first-generation adenoviral vector expressing the human FVIII gene, anti-FVIII antibodies were not detectable. However, in hemophilic dogs, neutralizing FVIII antibodies were generated upon gene transfer of first generation vectors expressing either the human or canine FVIII cDNA [for review see 51]. Recently, an HC-Ad vector that carries the full-length human FVIII cDNA under the control of the 12.5-kb albumin promoter was injected into 4 3 8 Schiedner ef aL hemophilic mice, resulting in efficient hepatic gene transfer and therapeutic FVIII expression which led to the correction of the phenotype. However, FVIII levels declined, possibly due to the generation of inhibitory antibodies to the human FVIII protein. Histopathological findings of vector-induced toxicity were not observed [52]. Therapeutic expression levels could only be observed with relatively high vector doses (2 x 10^^ viral particles per mouse). With a 10-fold lower vector dose FVIII could not be detected in the serum. These results suggested a nonlinear "threshold" effect which also has been observed with first-generation vectors [53]. Two further examples of liver gene transfer by HC-Ad vectors are men tioned since they point to additional advantages of this new vector type. In one instance an HC-Ad vector was generated to express murine erythro- poetin (mEPO), a glycoprotein regulating erythropoiesis [35]. EPO is mainly secreted by kidney peritubular cells in response to hypoxia and promotes late erythroid precursor proliferation and terminal differentiation of erythrocytes. Patients suffering from chronic renal failure show anemia as a major compli cation resulting from the destruction of EPO-secreting cells. These patients are treated with administration of recombinant human EPO protein. As an alterna tive treatment, delivery of the human EPO gene via an HC-Ad vector was tested and compared to a first-generation adenovirus vector with the same expression cassette. Relatively low amounts of an HC-Ad vector (3 x 10^ infectious units or 3 X 10^ particles per mouse) were sufficient to elevate hematocrit levels significantly, although with varying efficiencies, in different immunocompetent mouse strains. In this system the HC-Ad vector was at least 100-fold more efficient than a first generation vector. Because the low vector doses did not initiate any detectable neutralizing antibody response, intravenous readminis- tration of the vector was possible without a need for immunosuppression. In contrast, a second injection of a first-generation virus into mice that had been previously transduced with the same vector induced a much smaller and only transient hematocrit increase. A second example concerns the use of the mifepristone inducible gene expression system within the HC-Ad vector context [34]. In this system a chimeric ^mws-activator was used consisting of a mutated progesterone receptor ligand-binding domain, part of the activation domain of the human p65 subunit of the NF-KB complex, and a GAL4 DNA-binding domain. Expression of the ^r^ws-activator was under the transcriptional control of the liver-specific transthyretin (TTR) promoter. A second expression cassette was located on the same vector and consisted of a 17-mer GAL4-binding site just upstream of a minimal TATA box containing the promoter and cDNA of human growth hormone (hGH). In the presence of the progesterone antagonist mifepristone the transactivator dimerizes, binds to the Gal4 DNA binding site and induces hGH expression. In vitro studies in HepG2 cells and in vivo experiments in mice demonstrated extremely tight control of gene expression and very strong 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 3 9 induction of hGH expression upon administration of mifepristone. Following liver gene transfer, repetitive induction was possible for longer than 1 year [34, and unpublished data]. B. Gene Transfer into Skeletal Muscle The first in vivo application of HC-Ad vectors was for gene transfer studies toward a treatment for Duchenne muscular dystrophy (DMD), an inherited muscular dystrophy caused by mutations in the dystrophin gene. The dystrophin cDNA is 14-kb in length; thus, only shortened versions of this cDNA could be accommodated by first-generation or second-generation adenoviral vectors. Therefore, HC-Ad vectors provided the potential to deliver the full-length dystrophin cDNA with an adenoviral vector. DMD is the most common form of muscular dystrophy with an incidence of 1:3500 male births. Mutations in the dystrophin gene result in the absence of the cytoskeletal dystrophin protein that is normally located at the cytoplasmic face of the cell membrane in skeletal and cardiac muscle. In normal muscle, dystrophin serves as a link in a network of proteins that span from actin within the muscle cell to laminin in the extracellular matrix. The absence of dystrophin results in a secondary loss of dystrophin-associated proteins, increased fragility of the muscle membrane, and cycles of degeneration followed by regeneration. Ultimately, the regenerative process fails and muscle fibers are replaced with fibrosis. HC-Ad vectors encoding the dystrophin cDNA were developed by sev eral groups [5, 8, 14]. Two groups incorporated a muscle-specific muscle creatine kinase (MCK) promoter [5, 8], allowing demonstration of striated muscle-specific expression of dystrophin from the vector. Direct intramuscular injection of these dystrophin-encoding HC-Ad vectors in the dystrophin- deficient mdx mouse model resulted in expression of recombinant dystrophin that properly localized to the muscle sarcolemma [7, 14]. Furthermore, dystrophin-associated proteins, which are lost in DMD and mdx muscle secondary to the primary absence of dystrophin, were restored in muscle fibers expressing HC-Ad vector-delivered dystrophin [54]. The prevention of dystrophic morphologic changes in muscle of mdx mice receiving an intramus cular injection of dystrophin-encoding HC-Ad vector was a second indicator of normal function provided by the recombinant dystrophin that was expressed from the HC-Ad vector [7]. One HC-Ad vector encoding a MCK-driven murine dystrophin cDNA and an HCMV-controUed lacZ gene, called AdDYSPgal, resulted in a profound cellular infiltrate composed primarily of CD4+ and CD8+ T cells when injected intramuscularly in nondystrophic, normal mice, even when gene delivery was performed during the neonatal period [54]. Expression of P-galactosidase was identified as the principal cause of the observed cellular immune response 4 4 0 Schiedner ef al. by performing parallel intramuscular injections of AdDYSPgal in neonatal mice with a germline lacZ transgene on the same genetic background. LacZ- transgenic mice did not develop a cellular infiltrate in skeletal muscle at any time point after intramuscular AdDYSPgal delivery [54]. Further studies demonstrated that dystrophin expression from AdDYSPgal in skeletal muscle of mdx mice also could induce at least an antibody-mediated immune response to dystrophin antigens (P.R.C., unpublished observations). When immunity to the vector v^as largely eliminated in direct muscle gene transfer studies, the AdDYSPgal vector DNA w âs stably maintained in skeletal muscle for at least 5 months [33]. Furthermore, the integrity of vector DNA remained intact [33]. This provided assurance that HC-Ad vector DNA could remain as a stable episome in transduced muscle cells. These studies clearly show^ the utility of HC-Ad vectors for muscle gene transfer. An important issue to address in future studies is the nature of immunity induced by transgene proteins and adenoviral capsid antigens in the context of specific disease applications. It is likely that the underlying pathology of a muscle disorder v îll influence immunity induced or augmented by HC-Ad vector-mediated gene delivery. The low efficiency and extent of gene delivery to muscle is a second issue that currently prevents clinical applications of HC-Ad vectors. Targeting of HC-Ad vectors for muscle gene delivery may permit systemic administration that could result in transduction of muscle tissue widespread throughout the body. C. Gene Transfer into the Eye and into the CNS Adenoviral vectors have successfully been used for transgene delivery to different anatomic compartments and cell
types of the eye, in vitro and in vivo. Several groups have demonstrated efficient transduction of retinal cells with first-generation adenoviral vectors expressing reporter or therapeutic genes [see for example 55-61]. The eye is considered a site of immune privilege, which is immunologically tolerant to foreign antigens similar to the testis, ovary, and uterus [62]. However, following adenoviral-mediated gene transfer into different ocular cell types, gene expression has always been transient. The short duration of gene expression obtained, together with the limited insertion capacity of first-generation Ad vectors, recently prompted studies that aimed at developing HC-Ad vectors for somatic gene therapy of human retinal degenerative diseases. R. Kumar-Singh et al. constructed an "encapsi- dated adenovirus mini-chromosome" containing a full-length murine cDNA encoding the P-subunit of the guanosine 3^,5^-monophosphate (cyclic GMP) phosphodiesterase (P-PDE) under control of a human p-PDE promoter which is transcriptionally active in photoreceptor cells of the neuronal retina [28, 63]. This vector was prepared by cotransfection of 293 cells with helper virus DNA and a circular plasmid with head-to-head-oriented adenoviral ITRs generat ing linear adenoviral "mini-chromosomes" following rescue in 293 cells. The 15. High-Capacity ''Gutless'' Adenoviral Vectors 4 4 1 vector particles contained either monomers of the 13-kb starting material, or dimers in a head-to-head, head-to-tail, or tail-to-tail configuration [28, 63]. The P-PDE HC-Ad vector was delivered to the subretinal space of homozy gous rd mice. These mice, w^hich show^ a similar retinal phenotype as retinitis pigmentosa patients, suffer from an early-age onset of degeneration of reti nal photoreceptors due to a loss-of-function mutation in the P-PDE gene. Expression of p-PDE in transgenic rd mice is know^n to rescue photoreceptor degeneration in this model [64]. In the P-PDE HC-Ad vector-treated animals, expression of the transgene in the neuronal retina v^as demonstrated by RT- PCR, Western blot analysis and functional enzymatic assays [28, 63]. When the thickness of the outer nuclear layer, as a marker of photoreceptor cell rescue, v^as evaluated at l-week intervals, significant differences v̂ êre observed betw^een mice injected w îth the p-PDE HC-Ad vector and control vector up to 12 v̂ êeks postinfection [28, 63]. Despite these encouraging results the expres sion of the P-PDE Ad vector was transient and loss of expression w âs complete at 120 days follov^ing subretinal injection. Whether the loss of expression was due to an immune response directed against contaminating first-generation helper virus or against the transgenic protein, to promoter shutdow^n, or sim ply to instability of the vector DNA is not clear at the time of this w^riting. Since quiescent cells of the CNS allows efficient gene transfer by adenoviral vectors, glial and neuronal cells are very interesting target cells for HC-Ad vectors. In an in vitro study primary neuronal cells isolated from the cerebellum of 8- to 9-day-old mice v^ere transduced w îth either a first-generation or an HC-Ad vector expressing £. coli P-galactosidase [65]. Compared to gene transfer with a first-generation vector, transduction of these primary cells vŝ ith the HC-Ad vector resulted in a marked decline in vector-mediated toxicity as assessed by morphological and metabolic studies. In particular, this was evident at moder ate vector doses, corresponding to up to 50 multiplicities of infection (m.o.i.), a vector dose that resulted in an 85% transduction rate. However, at very high doses, the HC-Ad vector exhibited cytotoxicity, though not as severe as could be observed with a first-generation vector control. A problem of clinical significance that has been rarely addressed concerns the fate of a viral vector following the superinfection by a virus of the same or a closely related serotype. Stereotactic injection in rats into the striatum of the brain of both a first-generation and an HC-Ad vector expressing lacZ resulted in stable gene expression over at least 60 days with both vectors [36]. However, challenge by peripheral subcutanous injection of a first-generation vector expressing an immunologically unrelated transgene resulted in a strong inflammatory response in the brain of rats that had received the first-generation vector but not the HC-Ad vector. Gene expression was completely abolished in rats that were injected with the first-generation vector while expression from the HC-Ad vector was stable. This experimental setup is mirrored by a 4 4 2 Schiedner ef al. clinical situation in which therapeutic gene transfer is followed at a later time by infection with a virus of the same or a closely related serotype. IV. Conclusion Studies to date convincingly demonstrate the utility of HC-Ad vectors for gene transfer into different tissues. Safety and expression features of HC-Ad vectors are improved over earlier-generation adenoviral vectors. The increased capacity may allow coexpression of different therapeutic genes and improved control of gene expression. A critical issue that stands between the current status of HC-Ad vector development and clinically useful applications for human patients is at the level of vector production. It is felt, however, that with recently improved producer cell lines, vectors, and helper viruses the production under GMP will be possible in the near future. Retargeting strategies will increase the spectrum of therapeutic applications and will further add to the safety of HC-Ad vectors. References 1. Graham, F. L., Smiley, J., Russel, W. C , and Nairn, R. (1977). Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol, 36, 59-74. 2. Schiedner, G., Morral, N., Parks, R. J., Wu, Y., Koopmans, S. C., Langston, C., Graham, F. L., Beaudet, A. L., and Kochanek, S. (1998). Genomic DNA transfer with a high-capacity adenovirus vector results in improved in vivo gene expression and decreased toxicity. Nat. Genet. 18, 180-183. 3. Kochanek S. (1999). High-capacity adenoviral vectors for gene transfer and somatic gene therapy. Hum. Gene Ther. 10, 2451-2459. 4. Mitani, K., Graham, F. L., Caskey, C. T., and Kochanek, S. (1995). Rescue, propagation and partial purification of a helper virus-dependent adenovirus vector. Proc. Natl. Acad. Set. USA 92, 3854-3858. 5. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. -H., Chan, S., and Caskey, C. T. (1996). A new^ adenoviral vector: replacement of all viral coding sequences v^ith 28 kb of DNA independently expressing both full-length dystrophin and ?-galactosidase. Proc. Natl. Acad. Sci. U5A 93, 5731-5736. 6. Fisher, K. J., Choi, H., Burda, J., Chen, S.-J., and Wilson, J. M. (1996). Recombinant adenovirus deleted for all viral genes for gene therapy of cystic fibrosis. Virology 217, 11-22. 7. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. -H., Campbell, K. P., and Caskey, C. T. (1996). In vivo muscle gene transfer of full-length dystrophin w îth an adenoviral vector that lacks all viral genes. Gene Ther. 3, 965-972. 8. Kumar-Singh, R., and Chamberlain, J. S. (1996). Encapsidated adenovirus minichromosomes allow delivery and expression of a 14 kb dystrophin cDNA to muscle cells. Hum. Mol. Genet. 5 ,913-921 . 9. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, M. A., and Graham F. L. (1996). A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 15. High-Capacity ^'Gutless'' Adenoviral Vectors 4 4 3 10. Hardy, S., Kitamura, M., Harris-Stansil, T., Dai, Y., and Phipps, M. L. (1997). Construction of adenovirus vectors through Cre-lox recombination./. Virol. 71, 1842-1849. 11. Alemany, R., Dai, Y., Lou, Y. C , Sethi, E., Prokopenko, E., Josephs, S. F., and Zhang, W. W. (1997). Complementation of helper-dependent adenoviral vectors: Size effects and titer fluctuations./. Virol. Methods 68, 147-159. 12. Deuring, R., Klotz, G., and Doerfler, W. (1981). An unusual symmetric recombinant betw^een adenovirus type 12 DNA and human cell DNA. Proc. Natl. Acad. Set. USA 78, 3142-3146. 13. Gluzman, Y., and van Doren, K. (1983). Palindromic adenovirus type 5-simian virus 40 hybrid./, y/ro/. 45, 91-103. 14. Haecker, S. E., Stedman, H. H., Balice-Gordon, R. -J., Smith, D. B. J, Greelish, J. P., Mitchell, M. A., Wells, A., Sweeney, H. L., and Wilson, J. M. (1996). In vivo expression of full-length human dystrophin from adenoviral vectors deleted of all viral genes. Hum. Gene Ther. 7, 1907-1914. 15. Zhang, W. -W., Josephs, S. F., Zhou, J., Fang, X., Alemany, R., Balague, C , Dai, Y., Ayares, D., Prokopenko, E., Lou, Y. - C , Sethi, E., Hubert-Leslie, D., Kennedy, M., Ruiz, L., and Rockov^-Magnone, S. (1999). Development and application of a minimal adenoviral system for gene therapy of hemophilia A. Thromb. Haemostasis 82, 562-571. 16. Hearing, P., Samulski, R. J., Wishart, W. L., and Shenk, T. (1987). Identification of a repeated sequence element required for efficient encapsidation of the adenovirus type 5 chromosome. / . Virol. 61, 2555-2558. 17. Graeble, M., and Hearing, P. (1990). Adenovirus type 5 packaging domain is composed of a repeated element that is functionally redundant. / . Virol. 64, 2047-2056. 18. Graeble, M., and Hearing, P. (1992). Cis and trans requirements for the selective packaging of adenovirus type 5 DNA. / . Virol. 66, 723-731. 19. Schmid, S. I., and Hearing, P. (1997). Bipartite structure and functional independence of adenovirus type 5 packaging elements./. Virol. 71, 3375-3384. 20. Schmid, S. I., and Hearing, P. (1998). Cellular components interact with adenovirus type 5 minimal DNA packaging domains. / . Virol. 72, 6339-6347. 21. Sauer, B. (1987). Functional expression of the Cre-lox site specific recombination system in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol. 7, 2087-2096. 22. Chen, L., Anton, M., and Graham, F. L. (1996). Production and characterization of human 293 cell lines expressing the site-specific recombinase Cre. Somat. Cell. MoL Genet. 22, 477-488. 23. Sandig, V., Youil, R., Bett, A. J., Franlin, L. L., Oshima, M., Maione, D., Wang, F., Metzker, M. L., Savino, R., and Caskey, C. T. (2000). Optimization of the helper-dependent adenovirus system for production and potency in vivo. Proc. Natl. Acad. Sci. USA 97, 1002-1007. 24. Amalfitano, A., and Chamberlain, J. S. (1997). Isolation and characterization of packaging cell lines that coexpress the adenovirus El , DNA polymerase, and preterminal proteins: Implications for gene therapy. Gene Ther. 4, 258-263. 25. Hartigan-O'Connor, D., Amalfitano, A., and Chamberlain, J. S. (1999). Improved production of gutted adenovirus in cells expressing adenovirus preterminal protein and DNA polymerase. / . Virol. 73, 7835-7841. 26. Fallaux, F. J., Bout, A., van der Velde, I., van den Wollenberg, D. J. M., Hehir, K. M, Keegan, J., Auger, C , Cramer, S. J., van Ormondt, H., van der Eb., A., Valerio, D., and Hoeben, R. C. (1998). New Helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 27. Schiedner, G., Hertel, S., and Kochanek, S. (2000). Efficient transformation of primary human amniocytes by El functions of Ad5: Generation of new cell lines for adenoviral vector production. Hum. Gene Ther. 11, 2105-2116. 28. Kumar-Singh, R., and Farber, D. B. (1998). Encapsidated adenovirus minichromosome- mediated delivery of genes to the retina: application to the rescue of photoreceptor degeneration. Hum. Mol. Genet. 7, 1893-1900. 4 4 4 Schiedner ef al. 29. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franklin, L., Parks, R. J., Graham, F. L., Kochanek, S., Bett, A. J., and Caskey, C. T, (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95y 7866-7871. 30. Parks, R. J., and Graham, F. L. (1997). A helper-dependent system for adenovirus production helps define a low^er limit for efficient DNA packaging. / . Virol. 71, 3293-3298. 31. Harui, A., Suzuki, S., Kochanek, S., and Mitani, K. (1999). Frequency and stability of chromosomal integration of adenovirus vectors. / . Virol. 73, 6141-6146. 32. Parks, R. J., Bramson, J. L., Wan, Y., Addison, C. L., and Graham, F. L. (1999). Effects of stuffer DNA on transgene expression from helper-dependent adenovirus vectors. / . Virol. 73, 8027-8034. 33. Chen, H. -H., Mack, L. M., Choi, S. Y., Ontell, M, Kochanek, S., and Clemens, P. R. (1997). DNA form both high-capacity and first-generation adenoviral vectors remains intact in skeletal muscle. Hum. Gene Ther. 10, 365-373. 34. Burcin, M. M., Schiedner, G., Kochanek, S., Tsai, S. Y., and O'Malley, B. W. (1999). Adenovirus-mediated regulable target gene expression in vivo. Proc. Natl. Acad. Sci. USA 96, 355-360. 35. Maione, D., Wiznerowicz, M., Delmastro, P., Cortese, R., Cifiberto, G., La Monica, N., and Savino, R. (2000). Prolonged
expression and effective readministration of erythropoietin delivered with a fully deleted adenoviral vector. Hum. Gene Ther. 11, 859-868. 36. Thomas, C. E., Schiedner, G., Kochanek, S., Castro, M. G., and Loewenstein, P. R. (2000). Peripheral infection with adenovirus causes unexpected long-term brain inflammation in animals injected intracranially with first-generation, but not with high-capacity, adenovirus vectors: towards realistic long-term neurological gene therapy for chronic diseases. Proc. Natl. Acad. Sci. USA 97, 7482-7487. 37. Gall, J. G. D., Crystal, R. G., and Falck-Pedersen, E. (1998). Construction and character ization of hexon-chimeric adenoviruses: Specification of adenovirus serotype. / . Virol. 72, 10,260-10,264. 38. Parks, R. J., Evelegh, C. M., and Graham, F. L. (1999). Use of helper-dependent adenovi ral vectors of alternative serotypes permits repeat vector administration. Gene Ther. 6, 1565-1573. 39. Morral, N., O'Neal, W., Rice, K., Leland, M., Kaplan, J., Piedra, P. A., Zhou, H., Parks, R. J., Velji, R., Aguilar-Cordova, E., Wadsworth, S., Graham, F, L., Kochanek, S., Carey, K. D., and Beaudet, A. L. (1999). Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons. Proc. Natl. Acad. Sci. USA 96, 12816-12821. 40. Kirby, L, Davison, E., Beavil, A. J., Soh, C. P. C , Wickham, T. J., Roelvink, P. W., Kovesdi, L, Sutton, B. J., and Santis, G. (1999). Mutations in the DG loop of adenovirus type 5 fiber knob protein abolish high-affinity binding to its cellular receptor CAR. / . Virol. 73, 9508-9514. 41. Kirby, I., Davison, E., Beavil, A. J., Soh, C. P. C , Wickham, T. J., Roelvink, P. W., Kovesdi, L, Sutton, B. J., and Santis, G. (2000). Identification of contact residues and definition of the CAR-binding site of adenovirus type 5 fiber protein. / . Virol. 74, 2804-2813. 42. van Beusechem, V. W., van Rijswijk, A. L. C. T., van Es, H. H. G., Haisma, H. J., Pinedo, H. M., and Gerritsen, W. R. (2000). Recombinant adenovirus vectors with knobless fibers for targeted gene transfer. Gene Ther. 7, 1940-1946. 43. von Seggern, D. J., Chiu, C. Y., Fleck, S. K., Stewart, P. L., and Nemerow, G. R. (1999). A helper-independent adenovirus vector with El , E3, and fiber deleted: Structure and infectivity of fiberless particles./. Virol. 73, 1601-1608. 44. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies./. Virol. 70, 6831-6838. 15. High-Capacity ^^Gutless'' Adenoviral Vectors 4 4 5 45. Dmitriev, I., Kashentseva, E., Rogers, B. E., Krasnykh, V., and Curiel, D. T. (2000). Ectodomain of coxsackievirus and adenovirus receptor genetically fused to epidermal grow^th factor mediates adenovirus targeting to epidermal grow^th factor receptor-positive cells. / . Virol. 74, 6875-6884. 46. Romanczuk, H., Galer, C, E., Zabner, J., Barsomian, G., Wadsv^^orth, S. C , and O'Riordan, C. R. (1999). Modification of an adenoviral vector v^ith biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hwm. Gene Ther. 10, 2615-2626. 47. Dmitriev, L, Krasnykh, V., Miller, C. R., Wang, M., Kashentseva, E., Mikheeva, G., Belousova, N., and Curiel, D. T. (1998). An adenovirus vector vŝ ith genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism. / . Virol. 72, 9706-9713. 48. Vigne, E., Mahfouz, I., Dedieu, J. -F., Brie, A., Perricaudet, M., and Yeh, P. (1999). RGD inclusion in the hexon monomer provides adenovirus type 5-based vectors with a fiber knob-independent pathv^ay for infection. / . Virol. 73, 5156-5161. 49. Biermann, V., Volpers, C., HuEmann, S., Stock, A., Kewes, H., Schiedner, G., Herrmann, A., and Kochanek, S. (2001). Targeting of high-capacity adenoviral vectors. Hum. Gene Ther. 12, 1757-1769. 50. Morral, N., Parks, R. J,, Zhou, H., Langston, C., Schiedner, G., Quinones, J., Graham, F. L., Kochanek, S., and Beaudet, A. L. (1998). High doses of a helper-dependent adenoviral vector yield supraphysiological levels of ?1-antitrypsin v\̂ ith negligible toxicity. Hum Gene Ther. 9, 2709-2716. 51. Chuah, M. K. L., Collen, D., and VandenDriessche, T. (2001). Gene therapy for hemophilia. / . G^w^M^^. 3, 3-20. 52. Balague, C., Zhou, J., Dai, Y., Alemany, R., Josephs, S. F., Andreason, G., Hariharan, M., Sethi, E., Prokopenko, E., Jan, H. -Y., Lou, Y. -C., Hubert-Leslie, D., Ruiz, L., and Zhang, W. -W. (2000). Sustained high-level expression of full-length human factor VIII and restoration of clotting activity in hemophilic mice using a minimal adenovirus vector. Blood 95, 820-828. 53. Gallo-Penn, A. M., Shirley, P. S., Andrev^s, J. L., Kayda, D. B., Pinkstaff, A. M., Kaloss, M., Tinlin, S., Cameron, C , Notley, C , Hough, C , Lillicrap, D., Kaleko, M., and Conelly, S. (1990). In vivo evaluation of an adenoviral vector encoding canine factor VIII: High-level, sustained expression in hemophilic mice. Hum. Gene Ther. 10, 1791-1802. 54. Chen, H. -H., Mack, L. M., Kelly, R., Ontell, M., Kochanek, S., and Clemens, P. R. (1997). Persistence in muscle of an adenoviral vector that lacks all viral genes, Proc.Natl.Acad.Sci. USA 94, 1645-1650. 55. Bennett, J., Wilson, J., Sun, D., Forbes, B., and Maguire, A. (1994). Adenovirus vector- mediated in vivo gene transfer into adult murine retina. Invest. Ophthalmol. Vis. Sci. 35, 2535-2542. 56. Li, T., Adamian, M., Roof, D. J., Berson, E. L., Dryja, T. P., Roessler, B. J., Davidson, B. L. (1994) In vivo transfer of a reporter gene to the retina mediated by an adenoviral vector. Invest. Ophthalmol. Vis. Sci. 35, 2543-2549. 57. Bennett, J., Tanabe, T., Sun, D., Zeng, Y., Kjeldbye, H., Gouras, P., and Maguire, A. M. (1996). Photoreceptor cell rescue in retinal degeneration (rd) mice by in vivo gene therapy. Nat. Med. 2, 649-654. 58. Anglade, E., and Csaky, K. G. (1998) Recombinant adenovirus-mediated gene transfer into the adult rat retina. Curr. Eye Res. 17, 316-321. 59. da Cruz, L., Robertson, T., Hall, M. O., Constable, I. J., and Rakoczy, P. E. (1998). Cell polarity, phagocytosis and viral gene transfer in cultured human retinal pigment epithelial cells. Curr. Eye Res. 17, 668-672. 60. Akimoto, M., Miyatake, S., Kogishi, J., Hangai, M., Okazaki, K., Takahashi, J. C , Saiki, M., Iw^aki, M., and Honda, Y. (1999). Adenovirally expressed basic fibroblast grov^th factor rescues photoreceptor cells in RCS rats. Invest. Ophthalmol. Vis. Sci. 40, 273-279. 4 4 6 Schiedner ef al. 61. Cayouette, M., and Gravel, C. (1997). Adenovirus-mediated gene transfer of ciliary neu rotrophic factor can prevent photoreceptor degeneration in the retinal degeneration (rd) mouse. Hum. Gene Ther. 8, 423-430. 62. Streilein, J. W. (1995). Unraveling immune privilege. Science 270^ 1158-1159. 63. Kumar-Singh, R., Yamashita, C. K., Tran, K., and Farber, D. B. (2000). Construction of encap- sidated (gutted) adenovirus minichromosomes and their application to rescue of photoreceptor degeneration. Methods Enzymol. 316, 724-743. 64. Lem, J., Flannery, J. G., Li, T., Applebury, M. L., Farber, D. B., and Simon, M. I. (1992). Reti nal degeneration is rescued in transgenic rd mice by expression of the cGMP phosphodiesterase beta subunit. Proc. Natl. Acad. Set. USA 89, 4422-4426. 65. Cregan, S. P., MacLaurin, J., Gendron, T. F., Callaghan, S. M., Park, D. S., Parks, R. J., Graham, F. L., Morley, P., and Slack, R. S. (2000). Helper-dependent adenovirus vectors: Their use as a gene delivery system to neurons. Gene Ther. 7, 1200-1209. 66. Hassell, J. A., Cukanidin, E., Fey, G., and Sambrook, J. (1978). The structure and expression of two defective adenovirus 2/simian virus 40 hybrids. / . Mol. Biol. 120, 209-247. C H A P T E R Xenogenic Adenoviral Vectors Gerald W. Both Molecular Science CSIRO North Ryde, New South Wales, Australia !• Impetus and Rationale Although human adenoviruses (HAdVs) have been extensively studied over the past four decades, it is only in the past 10 years or so that studies on animal adenoviruses have begun to approach the same level of molecular analysis. This w âs partly driven by the desire to characterize viruses that clearly had very different properties and host ranges compared with HAdV, but it was also recognized that natural infection of human populations would very likely induce a level of immunity that might curtail the effective use of HAdV vectors. Molecular studies of xenogenic AdVs have substantially expanded our knowledge. Understanding their biology will ultimately lead to an increased choice of gene delivery vectors, providing more options in therapeutic strategy and design. IL Classification of Adenoviruses Adenoviruses were classified originally on the basis of serological tests and hemagglutination ability (reviewed in [1, 2] but the availability of genetic data has enhanced the ability to assess viral relatedness. The great majority of AdVs are classified as members of the mastadenovirus genus. This group includes all known human and many AdVs of animal origin. Bovine, porcine, canine, murine, equine, simian, and ovine viruses are all represented, some as multiple serotypes [3]. The genus aviadenovirus has also been known for many years. This group consists exclusively of viruses of avian origin, as the name suggests. Again, multiple serotypes of fowl AdV occur, with the prototype virus being the FAdVl isolate known as CELO. A third group, ADENOVIRAL VECTORS FOR GENE THERAPY AA 7 Copyright 2002, Elsevier Science (USA). • • • * # All rights reserved. 4 4 8 Gerald W. Both proposed as a new genus called the atadenoviruses [4-7], comprises viruses from bovine, ovine, and avian species and, tentatively, viruses from goats, deer, and possum (B. Harrach and D. Thomson and H. Lehmkuhl, pers. commun.). The OAdV7 isolate 287 has been proposed as the prototype of this group [5, 8]. Turkey hemorrhagic enteritis virus (HEV) and frog virus (FrAdVl) may constitute a fourth genus [9]. To assist in defining the potential uses of each vector it is important to understand the host range and biology of each virus. Although some information has been gleaned from genetic data, for the nonmastadenoviruses especially, feŵ studies of the nonstructural viral gene products have been done. III. Factors Affecting Vector Design and Utility A. Host Range and Pathogenicity A driving force behind the development of HAdV vectors w âs the knowledge that they are not associated with significant disease in healthy individuals [1]. The production of defective vectors in complementing cell lines has provided an additional margin of safety [10]. Several of the xenogenic AdVs reviewed here are being adapted for use as vaccine vectors in the homologous host. Thus, it is important that wild-type BAdV3, PAdV3, CAdV2, FAdVl, and OAdV7 cause only mild or subclinical symptoms upon experimental infection of the species from which they were isolated [11-15]. When considering viral host range it is important to distinguish between host range defined by viral replication and host range defined by the ability to transduce cells. Transduction is influenced largely by the interaction between the fiber protein and a primary cellular receptor. Some avi- and mastaden- oviruses have a second fiber protein [16, 17]. The major primary receptor for HAdVs has been identified as Coxsaclcie and adenovirus receptor (CAR) [18, 19]. This is probably also used by SAdVs (Table I) because they grow well in human cells and were propagated in human embryonic kidney 293 cells [20]. For most other xenogenic AdVs no primary receptor has been characterized, nor is it clear whether secondary receptors such as integrins [21] are involved in virus uptake. Indeed, xenogenic AdVs lack identifiable or functionally con firmed integrin-binding sequences in their penton proteins [22-27]. For fiber, the coiled coil, trimeric structure of the stalk [28] is conserved, but the distinct sequences of the cell binding domains for the avi and atadenoviruses suggest that they utilize primary receptors that are distinct from CAR. Consistent with this, although HAdV5 and OAdV7 can both infect CSL503 ovine lung cells, they do not compete with each other for entry [29]. CAdV2 is the only xenogenic mastadenovirus that has been examined with respect to cell binding and uptake. Despite the differences between the HAdV5 and CAdV2 capsids 16. Xenogenic Adenoviral Vectors 449 Table 1 Complete Nucleotide Sequences of Xenogenic Adenovirus Vectors Virus type Isolate GenBank Accession No. Canine adenovirus RI261 NC_001734 CAdVl Canine adenovirus Toronto A26/61 U77082 CAdVl Bovine adenovirus WBR-1 AF030154 BAdV3 Porcine adenovirus 6618 AF083132 PAdV3 Murine adenovirus NC_000942 MAdVl Simian adenovirus US patent SAdV21 CI 6,083,176 SAdV25 C68 Fowl adenovirus CELO; Phelps U46933 FAdVl (ATCC VR-432) Fov^l adenovirus ATCC strain A-2A AF083975 FAdV8 Ovine
adenovirus 287 U40839 OAdV7 Duck adenovirus EDS strain 127 Y09598 DAdVl Frog adenovirus VR-896 AF224336 FrAdVl Turkey adenovirus Hemorrhagic AF074946 TAdV3 enteritis virus the kinetics of uptake and trafficking of the two viruses in dog kidney cells was surprisingly similar [30]. CAdV2 shares some features of AdV2/5 tropism but also exhibits distinct characteristics. For example, CAdV2-infected Chinese hamster ovary (CHO) cells that expressed human or mouse CAR but it did not bind to human dendritic cells that were efficiently infected by HAdV5. Uptake of CAdV2 in susceptible cells must be augmented principally by CAR because the Arg-Gly-Asp (RGD) motif that binds to a^^s integrin is absent from the CAdV2 penton. However, CAdV2 also appears capable of binding to other cell surface proteins [31]. Identifying the receptors for xenogenic adenoviruses and defining the mechanisms of virus uptake is important as it will allow target and nontarget cells to be identified, thus suggesting potential uses for each vector. 4 5 0 Gerald W. Both However, it is possible that amino acid variation between a natural viral recep tor and its counterpart on heterologous cells may alter virus binding affinity. B. Neutralization HAdVs are ubiquitous in the human population. As a result of natural infection most individuals develop immunity to adenoviruses by the time they reach maturity. Antibodies against multiple serotypes are common [32] and a substantial portion have neutralizing activity [33]. Nonneutralizing antibodies can also bind to virus particles, leading to their indirect inactivation via the com plement system [34]. In addition, individuals commonly develop a long-lived CD4+ T-cell response against multiple serotypes of human adenovirus [35] which may mitigate the strategy of using human adenoviruses from alternative serotypes as vectors [36, 37]. Apart from preexisting immunity, administra tion of a HAdV at high dose can elicit an inflammatory response [38]. The vector may also induce an immune response that can reduce the efficacy of subsequent doses, although the extent of this effect may vary with the route of administration [39, 40]. A variety of methods have been used to overcome these problems, including transient immunosuppression, blocking of antibod ies with agents such as polyethylene glycol and removal of antibodies from serum by immunoapheresis [41, and references therein]. The use of xenogenic adenovirus vectors is expected to avoid neutraliza tion due to preexisting immunity to HAdVs. To investigate this, random human sera were examined for the presence of antibodies that neutralized OAdV7 or CAdV2. Of a panel of 57 sera, most of which neutralized HAdV5 to high titer, only three also neutralized CAdV2 [42, 43]. Similarly, 13 individual and two pools of human sera that neutralized HAdV5 did not neutralize OAdV7 [44]. SAdVs were also not neutralized by antisera that neutralized HAdVs [45]. These data suggest that xenogenic adenoviruses will provide an advantage upon initial administration although it is not expected that the vector will be immuno logically silent. However, whether vector is given locally or systemically may determine whether it is possible to administer more than a single dose [39, 40]. C. Genome Structure and Function Of the xenogenic mastadenoviruses, complete nucleotide sequences have been determined for bovine (BAdV2 and 3) [24], porcine (PAdV3) [46], murine (MAdVl) [27], canine viruses (CAdVl and 2) [26], and simian viruses [20] (Table I). For the aviadenoviruses, FAdVl [23] was the first genome sequenced but FAdV8 [47] is now also completed. Among the atadenoviruses, ovine (OAdV7) [22], bovine (BAdV4) (B. Harrach, pers. commun.), and duck (DAdVl) [48] genomes are sequenced. The turkey (TAdVl) [49] and frog (FrAdVl) genomes [9] have also been characterized. All of these viruses 1 6 . Xenogenic A d e n o v i r a l Vectors 451 are potential vectors for gene delivery because they can nov^ be rationally engineered, but not all are being developed as vectors at this stage. The viruses described above represent the extreme ranges of genome size, the largest being ^43.8 and 45 kb for FAdVl and FAdV8, respectively, and the smallest being -26 .3 kb for TAdVl and -29 .5 kb for OAdV7. The Mas- tadenovirus genomes range in size from —30.9 (MAdVl) to 34.4 kb (BAdV3). 1. Central Core In comparing the nucleotide sequence for prototype viruses in each genus it is apparent that there is a central core in each genome bounded by the pVIII and IVai genes (Fig. 1). This codes for the DNA replication, structural proteins, and accessory polypeptides required for their assembly. Most capsid proteins have homologs in each genus but proteins V and IX are unique to mastadenoviruses. Instead, OAdV7 has a gene for the structural Rep Gam ,4- dUTPase CU D PVIII fib 1 fib2 P I =11 I a FAdVI D O d Z I pol ca c=3 cz IVa2 22 a I I AVIADENO 2kb I- — - - I E1A E1B IX PVIII E3 fib •=3 PI 31 HAdV5 MASTADENO IVa2 pol E4 Site I I Sites ill II E1B pVlll k• fib DPI I P ii 0AdV7 a D„ 0 D„ ATADENO p32K IVa2 pol ' 1 0 D =3 0 3-1 E4 6-1RH Figure 1 Comparison of the genome structures of prototype viruses from the ovi-, most-, and atadenoviruses. The central core of each genome (filled rectangle) flanked by the IVa2 and pVIII genes is essentially conserved in arrangement and is truncated for simplicity. Other major open reading frames are indicated by open rectangles. Arrows indicate sites for insertion of foreign gene cassettes. The solid and broken lines indicate regions that can be provided in trans and regions that can be deleted, respectively. Note that E4 and E2 sequences have also been deleted in HAdV5 and SAdV vectors but this has not been demonstrated for other xenogenic mastadenoviruses. 4 5 2 Gerald W. Both protein, p32 K, that lies at the extreme left end of the genome (Fig. 1). This capsid protein complement correlates with the observation that FAdVl and OAdV7 are more heat-stable than the mastadenoviruses [50, 51]. It will be of interest to determine whether a functionally equivalent protein exists for the aviadenoviruses. Also in the central core of HAdVs are one or two copies of VA RNA genes [52]. Except for PAdV3 [46] and SAdVs [53], these are not present in xenogenic mastadenoviruses or OAdV7 [54], but a single copy is present near the right-hand end of FAdVl [55] and DAdVl (Fig. 1) [23, 48]. 2. Right-End Sequences To the right of the central core the genomes vary greatly in structure and gene complement. In the mastadenoviruses the E3 region varies in size and complexity but is located between the pVIII and fiber genes (Fig. 1). HAdV2 and —5 have an E3 region of ^2.5 kb that codes for numerous polypeptides, many of which interact with components of the immune system [56]. For the xenogenic mastadenoviruses the least complex E3 region from MAdVl appears to encode a single reading frame that may be variably spliced [57., 58]. BAdVl, —2, and —3, CAdV2, and PAdV3 and —5 have E3 regions of intermediate complexity, ranging in size from ^^1.2 to 2.3 kb. These code for a variable number of putative proteins that show some homology within a species and occasionally across species [59-63]. The BAdV3 E3 codes for a 284-residue glycoprotein and a 14.7-kDa polypeptide that appears to be the homolog of the HAdV5 14.7-kDa protein. The BAdV3 gene can functionally substitute for the human gene to protect cells against tumor necrosis factor (TNF)-induced lysis [62, 64]. E3 sequences are nonessential for replication in vitro [65] and were some of the first sequences deliberately deleted in the construction of recombinant HAdVs [66]. However, it was shown that retention of E3 sequences in a HAdV5 vector dampened the immune response in a rat model, thus extending the time of transgene expression [67]. Consistent with this, a HAdV5 virus in which E3 sequences were deleted showed an enhanced inflammatory response in a Cotton rat model [68]. It remains to be determined whether these results will translate to xenogenic vectors with less complex E3 regions. However, the timing and duration of gene expression that is required is a factor to be considered in vector design. In contrast to the mastadenoviruses, the avi- and atadenoviruses lack E3 regions between pVIII and fiber and instead have small intergenic regions of ^200 and ~400 bp, respectively, that contain signals for transcription termination and splicing of fiber RNA [69]. To the right of the fiber gene in mastadenoviruses lies the E4 region. Like HAdV2/5, a single promoter in BAdV3 and MAdVl produces seven transcripts that encode multiple polypeptides, some of which are homologous to HAdV proteins [70, 71]. In particular, homologs of HAdV5 E4 ORF6 carry a short 16. Xenogenic Adenoviral Vectors 4 5 3 amino acid motif that is highly conserved in many adenoviruses. Based on the conservation of this motif in OAdV7, v^here it w âs first recognized [22], the proposed E4 region in the atadenoviruses is penuhimate to the right end of the genome (Fig. 1). Tw ô promoters apparently control the expression of three open reading frames (ORFs), tv^o of w^hich contain the motif [48, 72]. No E4 region has been identified in the right-hand portion of aviadenoviruses. Indeed, the function of most reading frames in the right hand ~ 2 5 % of the genome remains to be determined. In FAdVl, the products of GAM-1 and ORF22 (Fig. 1) have been identified as proteins that interact w îth pRb [73]. However, in comparing the related FAdVl and FAdV8 genomes, 5 of 13 unassigned ORFs are unique to FAdV8 [74]. At the extreme right hand end of FAdVl are 3 ORFs that can be deleted and replaced v^ith a luciferase reporter gene cassette w^ithout affecting virus viability [51]. The extreme right ends of the avi- and atadenovirus genomes carry genes that are species specific. For example, DAdVl has numerous ORFs of unknov^n function that have no counterpart in OAdV7 [22, 23, 48, 75]. Within the right-hand-end region of OAdV7 lies a series of six short reading frames (RHl to RH6) (Fig. 1), four of which (RHl, - 2 , - 4 , and - 6 ) are closely related to each other. This is surprising in a compact genome of only ^29.6 kb. In DAdVl there are two ORFs that are related to each other and to those in OAdV7 [72, 76]. For OAdV7 only two transcripts from the region were detected by RT-PCR and these were spliced such that RHl and RH6 were the only ORFs that could be translated. The apparent redundancy of these ORFs was confirmed by the fact that the reading frames RH2 to RH5 could be deleted without seriously affecting virus viability [75]. The function of these ORFs remains to be determined. 3. Left End Sequences Left of the central core the genome structures also differ significantly (Fig. 1). For the xenogenic mastadenoviruses there are three ORFs at the left end that show homology with HAdVs [77-80]. The genome packaging signal is also present within the first ^500 nucleotides of the HAdV5 genome [81], but until recently this had not been defined for any xenogenic virus. For CAdV2, however, it was shown that the packaging region consists of a ^200- bp region that contains redundant, but not functionally equivalent sequences. The consensus sequence for HAdVs [81] is present only once and is of minor importance [82]. For the avi and atadenoviruses, some ORFs at the left end are unique to individual viruses or have homologs only within the genus. Two ORFs from the atadenoviruses show some homology with the HAdV5 ElB 19- and 55-kDa genes, suggesting that these functions are conserved. However, no homolog of the El A gene was identified [22,48]. An additional ORE that could encode a ^9.6-kDa protein is present in OAdV7 and BAdV4 (B. Harrach, pers. 4 5 4 Gerald W. Both commun.) but is missing from DAdVl [48]. The gene for the p32 K structural protein is also present near the left end. The promoter for ORFs LHl and LH2 is also on the opposite strand within this gene [72]. The packaging signal for atadenoviruses has not been defined but it may incorporate the ~160-bp region between the C-terminus of p32 K and the ITR. For the aviadenoviruses, ORFs with homologies to dUTPase and the REP protein of adeno-associated virus have
been found [23] but there are distinct differences between FAdVl and FAdV8 with three of eight ORFs in the left end being unique to FAdVS [74]. It was also reported recently [83] that the cysteines and several other residues in the conserved sequence motif of E4 ORF6 are conserved in FAdVl ORF14, which lies near the left end of the genome [23]. 4. Transcription Maps The determination of transcription maps for some xenogenic viruses has assisted vector design by complementing the data on genome structure. The major transcription units have been described for BAdV3 and PAdV3 [24, 46, 71], FAdVl [84] and OAdV7 [72]. No transcription map has been reported for CAdV2. More detailed data is available for the El , E3, and E4 regions of MAdVl [58, 70, 85] and for the BAdV3 El \13, 86] and E3 regions [60]. For BAdV3 and PAdV3, there are minor differences in the splicing pattern within some transcription units but on a broader scale the basic units described for AdV2/5 are completely conserved. Studies of FAdVl identified many transcripts for ORFs in the genome and a major transcription unit that is controlled by the MLP. However, at the left and right ends of the genome there are 5 and 15 kb, respectively, for which the promoters and transcriptional organization is undefined [84]. In the OAdV7 genome, the left (LHl to LH3)- and right-hand ends (RHl to RH6), E2 and the proposed E4 region (E4.1 to E4.3), as well as the structural protein genes constitute individual transcription units. The IVa2 and p32 K ORFs also appear to be transcribed from their own promoters. The LH and E4 regions each appear to be regulated by two promoters [72]. The identification of promoter regions and transcription termination sites has identified possible sites for gene insertion that are less likely to interfere with viral functions. D. Transforming Ability Many AdVs are known to carry oncogenes. Members of the mastaden- oviruses readily transform cells in culture [11, 87-89], although these viruses differ in their ability to induce tumor formation in animals. Among HAdVs, the group A viruses such as AdV12 are highly oncogenic, while group C (including HAdV5) and E viruses are not known to be tumourigenic (reviewed in [2, GS^ 90]). BAdV3 can induce tumor formation in hamsters [91] but there are no reports of tumor induction by other animal mastadenoviruses. FAdVl 16. Xenogenic Adenoviral Vectors 4 5 5 also transforms cell in vitro [92, 93] and rapidly induces tumors in newborn rodents [94, 95], For the atadenoviruses there are conflicting reports of tumor induction in hamsters. In one study, tumor formation was reported in ham sters inoculated with BAdV8 [96]. In a second study, none of BAdV4 to -10 produced tumors [97]. More recent studies showed that OAdV7 was unable to transform cells that were transformed by HAdV5 [98]. Primary rat embryo cells were infected with HAdV5 or OAdV7 but only the former produced colonies with a transformed phenotype. Similarly, baby rat kidney cells were transformed by HAdV5 El A/B sequences but not by the nonstructural genes of OAdV7. The apparent absence of oncogenes in the OAdV7 genome suggests that the virus interacts with the cell cycle machinery in a way that differs from the mast and aviadenoviruses, although this is yet to be defined. The presence of oncogenes in vector genomes has important implications for vector design in that it is customary to delete these sequences for safety reasons. Continuous cell lines that express the deleted genes in trans are established to permit virus propagation. The transforming properties of the mastadenoviruses reside primarily in the ElA and ElB genes at the left end of the genome (reviewed in [2, GS^ 90]). The ElA products bind to proteins of the cellular retinoblastoma (pRb) protein family [99], thereby releasing E2F transcription factors that regulate cell cycle progression into S phase [100]. The ElB 55-kDa protein binds to the tumor suppressor protein, p53, and blocks p53-mediated apoptosis [101]. The ElB 19-kDa protein is also anti-apoptotic [102]. Thus, animal adenoviruses typified by BAdV3, PAdV3, CAdV2, SAdV, and MAdVl have ElA and ElB homologs that have similar transforming and oncogenic potential. The E4 ORF3 and ORF6 products of HAdV5 can also augment the transforming activity of the ElA and ElB genes [103-106]. However, the E4 regions of human and animal mastadenoviruses vary in sequence and complexity. Homology with HAdV5 ORF6 is always evident, especially in a cysteine-rich motif [22] that is thought to mediate ORF6/p53 interaction [83]. Furthermore, a complex between the E4 ORF6 and ElB 55-kDa proteins promotes the selective nuclear export of late viral transcripts [107] and references therein). This ORE may be therefore be conserved as it provides a core function for replication in all adenoviruses. However, other E4 ORFs in the xenogenic viruses are unique [22,26,108-110] and their function/transforming potential is not clear. In FAdVl there are no identifiable ElA/B or E4 regions in the genome [23], but recently two proteins, GAM-1 and ORF22, that interact with pRb were identified [73]. In addition, GAM-1 has been identified as an anti- apoptotic protein [111] and one that can activate the cellular heat-shock response, the latter being required for viral replication. The Hsp40 gene is a primary target [112]. GAM-1 may also functionally substitute for the ElB 19 kDa [111]. FAdVl therefore appears to share with the mastadenoviruses an ability to disrupt complexes between pRb and the E2F transcription 4 5 6 Gerald W. Both factors to modulate the cell cycle, albeit via different effector proteins [99, 113]. In contrast, OAdV7, the prototype atadenovirus, lacks an identifiable ElA homolog, although it appears to carry ElB 19- and 55-kDa genes. Penultimate to the right end is a transcription unit that contains a unique ORF (E4.1) of unknown function and two ORFs (E4.2 and E4.3) which contain the conserved ORF6 cysteine-rich motif mentioned above [22, 72, 98]. These ORFs otherwise appear unrelated. Similar features are found in the DAdVl and BAdV4 genomes [48 and B. Harrach, pers. commun.]. However, OAdV7 so far lacks oncogenic activity as the complete OAdV7 genome did not transform primary rodent cells under conditions where transformation was achieved with control HAdV5 sequences [98]. These findings invite the hypothesis that OAdV7 lacks the ability to activate the cell cycle in quiescent cells, instead taking advantage of the cycle as it progresses. The presence or absence of transforming sequences strongly influences the design of xenogenic adenovirus vectors for gene delivery. Based on HAdV2 and —5, vectors derived from BAdV3, PAdV3, SAdV, and CAdV2 were designed such that the potentially oncogenic ElA/B homologs were deleted [20, 42, 43, 114, 115]. A similar approach could be applied to MAdVl [116]. Such vectors are replication-defective in cells lines that do not express the deleted genes [42, 43], but in some cases, homologs from HAdV5 can substitute [114, 115]. Some vectors derived from OAdV7, avian, and PAdV3 viruses retain potential transforming genes and carry foreign DNA inserts in nonessential regions of the genome [51, 75^ 117-120]. This strategy may be acceptable for vectors that are intended for gene delivery in the homologous animal or avian host but is unlikely to be acceptable for gene therapy purposes, except perhaps in the case of OAdV7, where the vector apparently lacks transforming genes. E. Cell Lines Successful rescue of a virus requires a cell line that can be transfected with high efficiency to initiate infection. The cells should also have abundant copies of the primary and secondary receptors to facilitate spread and the production of high titers of virus. Depending on the recombinant, the cells may or may not carry viral sequences to complement a deletion in the viral genome. 1. Primary Cell Lines The general strategy has been to identify a cell line that is permissive for the wild-type virus and then adapt it for more specialized purposes. For prop agation of BAdV3, MDBK, buffalo lung, primary kidney, and bovine cornea endothelial cells have all been tried, with MDBK cells being preferred [114, 121]. CAdV2 was grown in MDCK, dog kidney (ATCC CRL6247) or grey hound kidney [43, 121], MAdVl in mouse 3T6 [116] and PAdV3 in swine testis cells [115]. FAdVl recombinants were rescued in leghorn male hep atoma (LMH) cells [51]. FAdVl can be grown in embryonic chicken kidney 16. Xenogenic Adenoviral Vectors 4 5 7 cells but, for reasons of cost, is often grown in embryonated chicken eggs [23]. OAdV7 has a narrow host range and failed to grow in several ovine cell types [15]. However, it grew to high titre in CSL503 cells, a primary ovine fetal lung cell line [122] and a fetal ovine skin fibroblast line HVO-156 (C. Hofmann and P. Loser, pers. commun.). 2. Transformed Cell Lines Primary cells are adequate for growing replication-competent recombi nants. However, there was a need to produce cell lines that would complement genomic deletions and an expectation that transformed cell lines would ensure a continuous supply of cells. This encouraged attempts to develop lines equiv alent to 293 cells [123]. Note that SAdVs grow in 293 cells [20]. Based on this and similar precedents [124], the ElA/B sequences of BAdV3 were used to stably transfect MDBK cells [114, 125, 126]. These grew poorly and expressed undetectable amounts of the BAdV3 El proteins [114] but nevertheless com plemented the growth of an ElA-deleted HAdV5/lacZ recombinant [114, 125]. Attempts were also made, unsuccessfully, to transfect foetal bovine retinal cells (FBRCs) with BAdV3 ElA/B sequences. Because BAdV3 comple mented HAdV5/ElA-defective replication [125], it was expected that HAdV5 ElA/B sequences would complement BAdV3/El deleted vectors. Transfection of FBRCs with HAdV5 ElA/B sequences in which El A and ElB were controlled by the mouse PGK and ElB promoters, respectively, produced morphologically distinct clones, one of which was single-cell cloned and characterized as the VIDO R2 line. These cells expressed detectable levels of El A and ElB 19-kDa, but not ElB 55-kDa protein, supported plaque formation by BAdV3 and HAdV5, and were transfected more efficiently than MDBK cells. Transfection of El-deleted recombinant genomes into VIDO R2 cells resulted in the rescue of several viruses that carried expression cassettes [114]. For propagation of PAdV3 vectors a transformed fetal porcine retinal cell line (VIDO Rl) was also produced by transfection of swine testis cells with HAdV5 El sequences [115]. These cells were also morphologically distinct from the parental cells. ElA and ElB 19-kDa proteins were produced, as shown by Western blots, but ElB 55-kDa protein was not detected. While PAdV3 grew well in these cells, for reasons that are not understood, an E1/E3-deleted vector and a similar virus that carried a GFP cassette in El grew two logs less efficiently [115]. Similarly, the ElA/B region of CAdV2 was used to transform MDBK and DK cells [42]. Again, low levels of ElA transcripts were produced and ElB transcripts were not reliably detected. Nevertheless, the cells were morphologi cally and phenotypically distinct from parental MDCK cells. A second series of clones was produced by transfecting DK cells with CAdV2 sequences in which ElA and ElB were controlled by the HCMV and ElB promoters, respectively. Cells produced in this way expressed detectable ElA and ElB transcripts and ElB 19-kDa protein [42] and allowed the rescue and propagation of ElA/B-deleted CAdV2 vectors [43]. 4 5 8 Gerald W. Both Attempts were also made to produce a transformed derivative of CSL503 cells, which are permissive for OAdV7, using the left end (~4 kb) of the OAdV7 genome [9S], The sequences used incorporated the proposed ElB homologs of OAdV7 and a 9.6-kDa ORF of unknown function. No ElA homolog was identified [72, 98]. Only two clones that grew well enough to prepare frozen stocks were obtained and these were morphologically similar to the parental cells. In contrast, transfection of CSL503 cells with HAdV5 ElA/B sequences produced morphologically distinct clones. Growth of OAdV7 in these cell lines appeared to be retarded compared with its growth in wild type CSL503 cells (Xu and Both, unpublished results). F. Strategies for Vector Construction and Rescue A huge amount of work carried out over some 30 years on HAdV2 and —5 has defined viral promoters, transcripts and their splice sites and genes that could be deleted or that would function in trans (reviewed in [2, 65]). The packaging capacity of the viral capsid was also shown to
be ^^105% of the viral genome [127]. The strategic design of bovine, canine, porcine, simian, and murine adenovirus vectors, although based on new genetic information, has drawn extensively on historic precedents. As precedents did not exist for the avi- and atadenoviruses it was necessary to identify intergenic regions within genomic sequences and to use mutagenesis to identify nonessential reading frames for the insertion of gene cassettes. Vector design and virus rescue was also confounded initially by the absence of transcription maps and the lack of knowledge concerning the packaging capacity of these viruses. Construction of xenogenic adenovirus vectors first required the identifi cation of an insertion site(s) that could stably accommodate a gene cassette without affecting virus growth. For the mastadenoviruses, vector construction strategies followed those for human Ad vectors. Genes were inserted into the nonessential E3 region of BAdV3 [126, 128] or PAdV3 [118] or between the E4 promoter and the right ITR of PAdV3 [118, 120] to generate viruses that were replication competent in noncomplementing cells. More recently, ElA/B region replacements that generated replication-deficient viruses were produced for BAdV3 [114, 121], PAdV3 [115], SAdV [20], and CAdV2 [42, 43]. It is likely that a similar strategy would be successful for MAdVl where an infec tious clone is now available [116]. For the aviadenoviruses, a mutation strategy was used to identify nonessential regions of the genome or regions that could be complemented in trans [51]. Deletions between nucleotides 938 and 2900 were complemented by cotransfection of a plasmid that carried the left hand ^5.5 kb of the genome. Deletion of three ORFs adjacent to the right end of the FAdVl genome did not require transcomplementation, identifying these genes as nonessential for replication in vitro. Similarly, replication-competent FAdV8 16. Xenogenic Adenoviral Vectors 4 5 9 vectors were constructed by inserting a gene cassette into sites near the right end of the genome (Fig. 1) [119]. For the atadenovirus, OAdV7, genes were initially inserted at site I (Fig. 1) in the pVIII and fiber intergenic region [44, 50, IS^ 117, 129], but additional sites were subsequently identified by a mutation strategy. It was found that foreign DNA could be inserted into a unique ?ial\ site (Site II) within ORF RH2, ^\ kb from the right end, and that ORFs in the vicinity could be deleted \1S\. In addition, unique cloning sites were tolerated between the right-hand end and E4 transcription units (Site III) [72, 117]. The identification of permissible insertion sites in the genome required the construction of plasmids that enabled the rescue of infectious viruses. The first BAdV3 recombinant was constructed by recombination between a plasmid that carried BAdV3 sequences flanking the luciferase gene inserted into E3 and BAdV3 genomic DNA that had been cut with fvu\ to reduce background. DNAs were transfected into MDBK cells that also expressed BAdV3 El sequences. However, this method was inefficient and produced relatively few plaques [126]. Similarly, a CAdV2 recombinant that expressed the lacZ gene was produced by recombination between the CAdV2 (Manhattan strain) genome and a plasmid that carried the expression cassette. However, this recombinant was contaminated by wild-type CAdV2 that could not be eliminated [42]. A more favorable approach was to construct a plasmid in which sequences required for the propagation of plasmid DNA in Escherichia coli were cloned into a unique restriction enzyme site that linked the ITRs of the viral genome [117]. There was one precedent for this approach [130], although others had reported that perfect palindromes longer than 30 bp were often unstable in E. coli [131] and plasmids with large palindromes based on HAdV5 were subject to rearrangement [132]. Unique restriction sites were also introduced into appropriate locations in the OAdV7 genome to allow cloning of gene cassettes. This plasmid design allowed the genome to be released intact by restriction enzyme digestion prior to its transfection into susceptible cells for virus rescue [75, 117]. Subsequently, it was discovered that such plasmids could be constructed using recombination in £. coli [133]. Infectious recombinant clones have now been constructed for BAdV3 [71, 114, 134], PAdV3 [118], CAdV2 (Toronto strain) [43], MAdVl [116], FAdVl [51], and OAdV7 [44]. The specific infectivity of these naked DNAs in the permissive cell line is usually low (often only a few plaques per microgram) and depends on the transfection efficiency of the cells. However, a significant advantage of this approach is that transfection of purified plasmid DNA almost invariably yields the corresponding virus without the need for extensive plaque purification that may accompany other approaches where background viruses can be generated. Many xenogenic recombinant viruses have now been rescued. New viruses that first appeared with the formation of plaques or a cytopathic effect in the appropriate transfected cell line were amplified on fresh permissive cells to produce an infectious stock. Viruses were then characterized by restriction 4 6 0 Gerald W. Both enzyme, Southern blot [75,115,118,126], or PCR analysis [43, 51] to confirm the integrity of the genome and expression cassette. For the vectors where an insertion strategy was pursued, it was particularly important to check the genome integrity because the packaging capacity of the new vectors was undefined. Mastadenoviruses can package 105 to ^107% of the wild-type genome [43, 120, 127], OAdV7 has a capacity of 114%, presumably because of its smaller genome and similar capsid volume [75], while the capacity of aviadenoviruses is undefined. Despite the increased packaging capacity of OAdV7, some viral genomes in which expression cassettes (ranging from 1.8 to 3.1 kb) were inserted into site I of the genome proved to be unstable upon passaging. By passage three, the genomic BamHl profile of viruses that combined the HCMV promoter with a reporter gene sometimes displayed smaller fragments [50]. In contrast, a virus that carried 4.3 kb of "stuffer" DNA was successfully rescued [75] and with the RSV promoter, two viruses with site I cassettes in opposite orientations were stable to at least passage four [44; unpublished results]. Site I instability appears to vary with sequence and possibly orientation and may reflect the need to produce adequate amounts of fiber transcript and protein. Events that lead to transgene deletion with improved fiber production may generate viruses that have a growth advantage. The stability after passage of genomes for other xenogenic recombinant vectors has not been adequately reported. The propagation of a mixed population of CAdV2 wild-type and deleted vector [42] illustrated the potential for producing gutless vectors based on xenogenic AdVs. The principles established with HAdV5 [135, 136] will further assist this process. It will be necessary to define the packaging signal [82] and a minimum permissible genome size for a particular virus, provide a suitable a helper virus for propagation, and devise a means to purify defective particles. The benefits may be greater safety and more efficient gene delivery in a naive host and prolonged transgene gene expression. IV. Utility of Xenogenic Vectors Xenogenic AdV vectors can potentially be used as gene delivery vectors for a range of purposes. However, it is necessary to understand the advan tages and disadvantages of vectors in particular situations so as to identify their most appropriate uses. The next section discusses the first attempts to determine the safety and utility of xenogenic vectors for vaccination or gene delivery. The following section reviews the properties and behavior of vectors in heterologous situations. A. Veterinary Studies Within the limits of the testing done so far, the viruses discussed in this review are of low pathogenicity in the host from which they were iso lated [11-15]. Vectors designed for use in those hosts are often replication 16. Xenogenic Adenoviral Vectors 4 6 1 competent to facilitate vaccination by a live viral vector. In the first studies, carried out v^ith BAdV3, the luciferase reporter v^as inserted directly into the E3 region where a small deletion had been introduced. Expression did not require an exogenous promoter and the vector remained replication competent in bovine cells, although its titer was reduced 10-fold [126]. In contrast to HAdV5 vectors that lacked part of the E3 region [6S]^ this BAdV3 recombi nant did not show increased pathogenicity in a Cotton rat model compared with the wild-type virus [137]. Similar replication-competent viruses that car ried various forms of the bovine herpesvirus gD gene were shown to express the antigen [71] in an immunogenic form [128]. Intranasal vaccination of calves with these viruses induced gD-specific neutralizing antibodies, primed a cellular immune response and protected against viral challenge, despite the presence of preexisting serum antibodies to BAdV3 [138,139]. El/E3-deleted replication-defective BAdV3 vectors that carried gD in the El region were also constructed [114]. These viruses allowed the parameters for vaccination of cattle by replicating and nonreplicating vectors to be compared. Adminis tration of each vector at the same dose twice via the intra tracheal route and once subcutaneously showed that the replication-competent vector induced superior levels of serum IgG antibodies against gD. Partial protection against challenge was obtained with the replication-competent vector. However, with the replication-defective vector challenge with BHVl dramatically boosted the levels of serum IgG and IgA antibodies, suggesting that animals had been primed for gD-specific antibody responses [140]. Similar BAdV3 recombinants were constructed in which the bovine diarrhea virus E2 glycoprotein linked to the BHVl gD signal peptide was expressed from the BAdV3 E3/MLP [141]. The 53-kDa protein that was expressed formed dimers and was recognized by E2 specific monoclonal antibodies. Intranasal immunization of Cotton rats with the recombinant induced E2-specific IgA and IgG responses at mucosal surfaces and in the serum. In contrast, attempts to construct vectors that expressed the bovine coronavirus hemagglutinin esterase gene from the E3 region using the strategy for the BHVl gD gene were unsuccessful. The addi tion of exogenous control elements comprising an intron and the HCMV or SV40 promoter increased the level of expression but altered the kinetics. The recombinant virus also replicated less efficiently than wild-type BAdV3 [142]. Replication-competent PAdV3 vectors that express the pseudorabies gD protein or the classical swine fever virus (CSFV) gp55 protein were also constructed. The gD gene was inserted into a partially deleted E3 region without flanking sequences. In contrast to similar BAdV3 vectors, expression of gD was observed at early but not late times pi [118]. The gp55 gene linked to the PAdV3 MLP and tripartite leader sequence (TLS) was inserted at the right end between the ITR and E4 promoter. Vaccination of outbred pigs with a single dose of recombinant virus induced complete protection from lethal challenge with CSFV [120]. 4 6 2 Gerald W. Both A FAdV8 recombinant that expressed chicken gamma interferon from the viral MLP/TLS sequences was also constructed by inserting the cassette at sites near the right end [119]. Depending on the insertion site, the recombinants displayed differing growth characteristics in chicken kidney monolayers. Inser tion of the cassette adjacent to FAdV8 ORF7, about 7.2 kb from the right end, produced a recombinant with wild-type growth characteristics. In contrast to the FAdVl viruses discussed below, deletion of the FAdVl 36-kDa homolog in FAdV8 caused a significant reduction in growth. Interferon was produced in supernatants as early as 24 h pi in proportion to the growth characteristics of each virus in vitro. Interferon levels peaked at 48 h and were maintained for at least 10 days. Chickens treated with the recombinant showed increased weight gains compared to controls and suffered reduced weight loss when challenged with a coccidial parasite [119]. An OAdV7 vector was constructed in which the 45 W antigen of Taenia ovis was expressed from the viral MLP/TLS elements [143], the cassette being inserted at site I (Fig. 1) [75]. This vector was used alone, or in tandem with DNA or purified 45W protein to vaccinate sheep. Prime/boost strategies where vaccination was initiated with protein or DNA and boosted with the OAdV7 vector were effective in stimulating an immune response that protected animals against challenge with the parasite [144]. The above examples illustrate that with further refinement, xenogenic vec tors may have utility for vaccination and gene delivery in their respective hosts. B. Vector Biology Ideally, vectors for gene transfer into human cells should be capable of transgene expression without replication or detrimental expression of viral genes. Infection of human cell lines with intact xenogenic adenoviruses estab lished the principle that these viruses are replication defective at the inputs
tested [42, 51, 76^ 116, 118, 121, 126], although the molecular basis for defective replication is not understood. Studies in animal models have also allowed biodistribution profiles to be determined for some viruses. 1. Transduction of Cells Selected cell lines have been used to examine viral transduction. However, it is sometimes difficult to compare data from different laboratories because, especially in early studies, the input virus was not characterized with respect to both particle number and infectivity. BAdV3 recombinants in which a HCMV/lacZ or HCMV/GFP gene cassette was expressed from the El or E3 region, respectively [114, 121], were used to infect human and other cell types. The GFP recombinant replicated in cells of bovine origin and in Cotton rat lung fibroblasts, but not in cells from other species. When cells were infected with more than 5 pfu/cell of BAdV3/GFP, some GFP expression was observed at 16. Xenogenic Adenoviral Vectors 4 6 3 3 days pi in 293 and HeLa but not in A549 or HepG2 cells [114]. In contrast, others found that at an m.o.i of 10 pfu/cell, at 65 h pi A549 and MRC5 cells were efficiently transduced by a BAdV3/lacZ recombinant while HeLa and 293 and primary human muscle cells were transduced with lower efficiency [121]. Since both studies used the HCMV promoter and a similar multiplicity of infection, the reason for the difference with A549 cells is unclear. The host range of CAdV2 vectors was also investigated. Human 293, HeLa, primary myocyte, and HIB cells were infected with 10^ transduction units of CAdV2/RSVlacZ in the presence of wild-type CAdV2. All cell types showed P-gal expression when examined at 1 to 2 days pi [42]. In addition, replication-deficient CAdV2 vectors expressing GFP or lacZ from the HCMV and RSV promoters, respectively, were tested for their ability to transduce a range of human cell types in comparison with HAdV5/HCMV/GFP [43]. At 2 days pi HeLa, A172, and HT 1080 cells were transduced with similar efficiency by both viruses. In vivo^ the CAdV2 vectors also transduced mouse airway epithelia cells with similar efficiency to a comparable HAdV5 vector. Similarly, a replication-deficient PAdV3 recombinant carrying a HCMV/GFP cassette in El was used to determine the ability of this vector to infect human and animal cells in vitro. At a m.o.i. of 1 pfu/cell PAdV3 apparently entered, but did not replicate in canine kidney, ovine skin fibroblasts, bovine (MDBK), and human (293, A549) cells [115]. Although an infectious clone of MAdVl now exists, recombinant viruses have not yet been made. However, it was demonstrated by RT PCR that human 293 and primary umbilical endothelial cells were infected, the latter at low efficiency [116]. Replication-competent aviadenovirus vectors that express luciferase from the HCMV promoter [51] were constructed by inserting cassettes at the right end of FAdVl to replace nonessential ORFs. Vectors replicated in LMH cells with kinetics similar to wild-type FAdVl. When compared to a HAdV5/luciferase recombinant for its ability to transduce human cell types, the FAdVl recombinant showed a similar ability to express luciferase in HepG2, A549 and primary human fibroblasts [51]. Several recombinants that carried reporter genes at site I of the genome (Fig. 1) were used to investigate the host range of OAdV7 [29, 44, 50, 76,129]. These studies showed that OAdV7 can infect, but not replicate in a variety of human cell types, including breast (MCF7, T47D2) and prostate cancer (PC3), liver carcinoma (HepG2), and retinal (911), foreskin (HFF), and lung (MRC5) fibroblasts [76], Reporter gene expression increased proportionally with the m.o.i. Monkey (COS) and mouse prostate (RMl) cells were also infected efficiently in vitro [50 and unpublished results]. Considering the quite broad host range of OAdV7, it will be of consider able interest to identify the receptor(s) that mediates infection. In principle it is also possible to redirect the vector via an alternative receptor as was done for 4 6 4 Gerald W. Both HAdVs [36, 37]. It was shown [29] ttiat ttie cell-binding domain of OAdV7 fiber protein could be replaced with the equivalent binding domain from HAdV5. This was the only change in the viral capsid but it profoundly altered the cell tropism of OAdV7, apparently independent of any integrin/penton RGD interaction, since this motif is absent from OAdV7 [22]. Although the hybrid virus grew less well, this result confirmed that the two viruses use distinct receptors and demonstrated that targeting of xenogenic viruses may be possible. 2. Abortive Replication in Vitro Abortive replication of xenogenic adenoviruses probably reflects viral promoter function in human cell types. The function of early and late BAdV3 promoters in human cells was examined by RT PCR and Southern blot ting [121]. In A549 and 293 cells ElA transcripts were detectable for at least 5 days. At very high m.o.i. hexon mRNA was detectable at day 3 in primary human muscle, MRC5 human lung fibroblasts, and nasal septum epithelial cells. It was also shown that CAdV2 replicated to a limited extent in some human cells, as judged by higher virus output compared with input and some expression of capsid proteins. However, this was observed only at the first passage [121]. For human cells infected with OAdV7 at m.o.i. 20 pfu/cell the situation was polarized, depending on the cell type. On the one hand, in MRC5 cells, all early promoters in the genome that were examined were active, as monitored by RT PCR amplification of selected transcripts. On the other hand, in HepG2 liver carcinoma cells, none of the early promoters had detectable activity. In most other cell types, e.g., MCF7 and T47D2 breast cancer and PC3 prostate cells, some promoters, typically E2, were active. Interestingly, in all human cell types tested, and even when the early promoters were active, transcripts from the OAdV7 major late promoter (MLP) could not be detected [72, 76]. This may be related to key events that occur in the transition from early to late protein synthesis. For HAdV2, accumulation of early gene products is not sufficient for MLP activity. DNA replication is also required for late gene expression. High-level transcription from the MLP is further dependent on a c/s-acting change in the viral chromatin [145]. In addition, HAdV2 MLP activity is stimulated by ^mws-activating factors DBP and IVa2 [146-148]. At a gross level there is little or no DNA replication in OAdV7 infected human, compared with permissive ovine cells. However, the OAdV7 E2 promoter was active in several human cell types and large amounts of DBP transcript (and presumably, transcripts for DNA polymerase and Terminal protein) were produced [7G\, Cellular factors also cooperate with viral proteins during genome replication (reviewed in [2]). The apparent absence of DNA replication may be due to the incompatibility of one or more human cell factors with binding sites on the OAdV7 ITR sequences or with other viral proteins involved in the process. There are significant differences 16. Xenogenic Adenoviral Vectors 4 6 5 in putative binding sites for transcription factors between the ITRs of human and xenogenic viruses [149]. The inactivity of the OAdV7 MLP could further be due to a missing trans-actWsiting factor, such as IVa2, whose expression in human cells has not been investigated. Such abortive replication makes it unlikely that conditionally replication-competent vectors [150, 151] based on xenogenic vectors will be developed in the near future. 3. Biodistribution and Persistence in Vivo Few studies on the biodistribution and persistence of xenogenic AdVs in vivo have been reported, but some have been carried out with MAdVl and OAdV7. In the homologous situation, mice were injected intraperitoneally (ip) or intranasally with 10^ pfu of MAdVl and the localization of virus was monitored histologically during acute infection [152]. Endothelial cells of the brain and spinal cord showed extensive evidence of infection. Endothelial cells in lungs, kidneys, and other organs gave a positive signal, indicating a widespread involvement of the systemic circulation. Some lymphoid tissues were also positive. In experiments that examined persistence of OAdV7 it was found that 5 x 1 0 ^ pfu of a recombinant OAdV7 vector injected intravenously (iv) into SCID mice produced hAAT expression that persisted for at least 60 days. However, the same vector dose in BALB/c mice was cleared by 20 days. Thus, the vector did not persist in the normal host and a substantial dose of virus (2 X 10^^ particles) did not cause significant toxicity in normal or immunocompromised animals. The distinct nature of the OAdV7 receptor was reflected in the biodis tribution of OAdV7 following iv or ip administration of the vector to mice. OAdV7 was evenly distributed between liver, heart, spleen, and kidney [44], whereas HAdV5 vectors given iv concentrated predominantly in the liver [153]. OAdV7 given via the intraportal vein led to a greater accumulation of vector in the liver, but the vector was still found in all tissues examined [50]. In addition, when virus was injected directly into mouse skeletal muscle, cells were trans duced and high levels of hAAT reporter protein were secreted in vivo [129]. By judicious adjustment of the first dose of vector it was shown that a second dose that resulted in substantial reporter gene expression could be given, raising the prospect that the vector may be suitable for prime/boost vaccination strategies. The vector was not detected in liver and spleen, indicating that it did not spread via the circulation. Expression, however, was transient and the vector DNA had essentially disappeared by day 14. Clearance occurred in the absence of detectable OAdV7 gene expression as assayed by RT PCR. As proposed for HAdV5 vectors [154] clearance may occur via presentation of antigen using an MHC class I independent mechanism. Experiments utilizing HAdV5 and OAdV7 recombinants demonstrated a perceived advantage of xenogenic AdV, showing that OAdV7 could deliver a reporter gene in vivo in the face of preexisting antibodies against human 4 6 6 Gerald W. Both HAdV5 [44]. This result was encouraging from a clinical viewpoint and should be mimicked by other xenogenic AdV. It may be possible eventually to use different vectors in tandem to deliver multiple doses of the same gene [155]. C. Gene Therapy Studies To date no gene therapy applications have been reported for xenogenic Adv. However, work is in progress in this laboratory to assess OAdV7 as a gene delivery vector for prostate cancer. The strategy is based on gene- directed enzyme prodrug therapy (GDEPT). This is a two-component cell killing system: a gene that encodes an enzyme not present in mammalian cells and a nontoxic prodrug that is converted to a toxic product by cells that produce the enzyme. Although there are several GDEPT systems [156], in this case purine nucleoside phosphorylase (PNP), an E. colt enzyme, and the prodrug fludarabine are being used [157]. OAdV7 vectors that express the PNP gene under the control of the constitutive RSV, or a tissue-specific prostate promoter, were constructed and tested for cell killing in vitro and in mouse models of prostate cancer. Viruses were injected directly into human PC3 or LN3 tumors grown subcutaneously in nude mice or into mouse RMl tumors grown subcutaneously (sc) in immunocompetent animals. Prodrug was given systemically [158 and Voeks et al (in preparation)]. Evidence of tumor shrinkage and prolongation of mouse survival indicate that this vector and GDEPT system has potential for prostate cancer therapy. This work has also highlighted other important issues that must be addressed for OAdV7, and for xenogenic vectors in general, if they are to be developed for clinical application. These especially include biosafety and vector growth, purification, and scaleup. V. Biosafety Most work with xenogenic vectors is still firmly based in the laboratory and while this is appropriate to demonstrate the utility of a vector the amount of work required for eventual exploitation of a vector in the clinic should not be underestimated. A. Complementation and Recombination Although the xenogenic AdV undergo abortive replication in human cells, one hypothetical situation concerning the clinical application of these vectors is their potential for interaction with opportunistic, replication-competent human adenoviruses in a patient. This may involve complementation of a replication- deficient virus or recombination between genomes to create a hybrid with 16. Xenogenic Adenoviral Vectors 4 6 7 undesirable properties. A priori^ such events seem more likely to occur between viruses that are closely related, particularly if they share a common receptor to facilitate coinfection. Evidence v^as sought for
interaction between HAdV5 and CAdV2. However, coinfection of HeLa or A549 cells with CAdV2 (m.o.i. 10) and HAdV5 (m.o.i. 2) had no effect on the production of CAdV2 over five passages, compared with CAdV2 infection alone. DNA extracted from the cells was also digested and analyzed by Southern hybridization using a whole genome CAdV2 probe to track the DNA and look for the appearance of hybrid genomes. In coinfected HeLa and A549 cells CAdV2 DNA disappeared after one to three passages. HAdV5 DNA became visible by passage four and its restriction enzyme profile was identical to HAdV5 alone. No CAdV2 sequences were detected in these samples by hybridization [121]. Similar experiments have been done to determine whether any pro ductive interaction occurred between OAdV7 and HAdV5, a typical human adenovirus. No complementation of OAdV7 replication was detected in the presence of wild-type HAdV5 in MCF 7 cells, although both viruses infect these cells [76] and HAdV5 replicated with high efficiency. Similarly, when DNA from several passages of cells that were coinfected by OAdV7 and HAdV5 was analyzed by Southern blot using whole genome OAdV7 or HAdV5 probes, no hybrid genomes were detected [158a]. Considering the differences in genome structure between the two viruses (Fig. 2), the apparent lack of viable hybrid LHE LHIEIB III pVIII Fiber ixR xp̂ ^ > ^ ^ - • - • 46bp OAdV7 a::::::::::::>-----:-:-:-:-:-:':':-:-;-:v 33.6% ir 4-4- G/C P32 E4? RHE EIAEIBIX III V pVIIIE3 Fiber j^ j^ - • • • > > - • > — • > 103bp HAdV5 Ê 55.2% " E4 G/C Figure 2 Difference map between HAdV2/5 and OAdV7. The stippled rectangles indicate the genomes with distinct G / C content, striped boxes at each end show the ITRs of different length, and sequence and ORFs with bold type are unique. The packaging signal is shown in (^) . 4 6 8 Gerald W. Both virus formation and the absence of complementation was not surprising. First, the G/C content of the two genomes is vastly different, indicating low nucleotide sequence homology. Next, the ITRs of each genome differ in length and sequence, suggesting that neither would be compatible with the DNA replication machinery of the other. Third, each virus has a distinct complement of capsid proteins, including unique proteins and distinct fibers as well as non structural genes (Fig. 1). In addition, the packaging signals for each genome are likely to be incompatible. Thus, vectors such as OAdV7 may offer a greater margin of safety over those that are more closely related to HAdVs, such as SAdVs, with respect to potential for unwanted interactions. It is significant, therefore, that no human atadenoviruses have yet been described. B. Oncogenes in Viral and Cellular DNA As discussed above, replication-deficient El-deleted vectors are rescued and propagated in continuous cell lines that were derived from primary cell lines by transformation with adenovirus ElA/B genes [42, 43,114,115]. While this is an advantage for cell growth and virus production it is a disadvantage for downstream processing and purification. Regulatory agencies impose strict limits on the permissible levels of contaminating DNA (10 ng/dose) in purified vector preparations [159]. A rigorous purification process is therefore required to remove potentially oncogenic DNA. Thus, an advantage of OAdV7 vectors is that they grow in a primary fetal ovine lung cell line. The trade-off is that the cells grow more slowly and have a life span of 50 to 70 doublings [122]. Oncogenes must also be removed from the vector genome. This may be more straightforward for the mastadenoviruses, where precedents exist from HAdV2/5 studies, but within this genus some viruses are more oncogenic than others [2, 65] and some ORFs exhibit unexpected transforming proper ties [160-162]. Progress toward oncogene identification in FAdVl has also been made [73, 111], but others may exist. Ultimately, the regulatory authori ties will require tests to be conducted on the residual oncogenicity of xenogenic vectors prior to clinical application. The apparent lack of transforming ability of OAdV7 in systems that have been used as a benchmark for such assays was therefore encouraging [98]. C. Virus/Cell Interactions Adenoviruses undergo a lytic infection cycle in permissive cells. The mechanism behind cell lysis is not well defined in all cases but for FlAdV5 it is due to the production of a "death protein" late in the infectious cycle [163]. Other mechanisms that may be involved in selective killing of tumor cells are being investigated [164]. These observations highlight the potential for interactions between a virus and a cell that may be undesirable in the context of extended gene expression or from a biosafety perspective. 16. Xenogenic Adenoviral Vectors 4 6 9 Despite the inactivity of its MLP, in some cell types, typified by MRC5 lung fibroblasts, OAdV7 produced an apparent cytopathic effect (CPE) that was limited by the m.o.i. CPE was not due to viral replication because virus passaged twice on MRC5 cells failed to produce CPE in permissive CSL503 cells [76]. Thus, the effect is likely to involve an early gene product. This is currently under investigation. In this regard it is intriguing that the induction of rapid cell death following infection by certain HAdVs appears to be due to an interaction between p53 and the ElB 55-kDa product [164]. The response was abrogated by the absence of either protein due to mutation or lack of expression. Given the many genes of unknown function that exist in the expanding range of xenogenic AdVs the potential to discover other unwanted interactions exists. It may prove necessary to engineer vectors to remove deleterious genes and to grow them in complementing cell lines, but that raises complementation risks. D. Replication Competent Viruses A significant problem with the production of HAdV5 vectors has been the emergence of replication-competent viruses from cells that were designed to prevent their formation. Sequence overlap between the viral vector and integrated genes and subsequent recombination between them has generally been the cause [165]. Thus, PERC6 cells and matching vectors in which sequence overlaps were eliminated were specifically designed to overcome the problem [166]. An advantage offered by the xenogenic vectors is that all of them are replication-deficient in all human cell lines that have been tested. Additional work with particular vectors and cell types to understand the molecular basis for abortive replication would be very helpful in assessing the safety of new vectors. VI . Vector Production and Purification For vector production at the laboratory level the availability of a cell line or egg system [23, 48] for virus rescue and propagation is sufficient. Virus can be purified using methods based on cell lysis and CsCl centrifugation similar to those described for HAdV5 [10, 15, 43, 49, 137]. However, increasing success with a vector brings increasingly stringent requirements as work proceeds toward production for veterinary applications or a clinical trial. Strategic decisions taken early to facilitate subsequent steps in vector development and exploitation could save substantial time and effort later on. A key requirement for vector production is the availability of a cell line that, having been expanded and laid down as master and working cell banks (MCBA)C^CB), is tested and shown to be free of adventitious agents. Attention to detail in the creation and 4 7 0 Gerald W. Both documentation of such a cell line would pay dividends in the long term. A master virus seed stock also needs to be established. This dictates that the viral genome, including the transgene, must be stable upon serial passage such that biological activity and potency are maintained. This stock must also be free of other agents. The issue of vector yield from the WCB should also be considered. For veterinary applications w^here the vector may be replication competent in the host, low^ yields may be less important. Hov^ever, if gene therapy is being considered as an application a purified virus yield of >10'^ particles per cell is probably required for cost effective production of a vector. For clinical applications in particular, a robust scheme for vector purifi cation is required. While this might involve CsCl gradient centrifugation to produce quantities of vector for preclinical and perhaps phase I studies, such methodology is unlikely to be appropriate for producing larger amounts of vector. Methods involving chromatography may be more advantageous [167]. It is recognized that the above provides a very brief summary of issues that might be substantial for particular vector systems. How^ever, the intention is to alert the reader contemplating the use of a new^ vector system to the many chal lenges that lie ahead in the process of chaperoning it through production and regulatory processes. The correct strategic decisions taken early can facilitate subsequent steps in vector development and exploitation. Acknov^ledgments The author extends his appreciation to the colleagues who provided preprints and infor mation that helped to ensure the timeliness and relevance of this chapter and to Pamela Russell and Keith Smith for comments on the manuscript. References 1. Horwitz, M. S. (1996). Adenoviruses. Third ed. In "Fields Virology" (B. N. Fields, D. M. Knipe, and P. M. Howley, Eds.), Vol. 2, pp. 2149-2171. Lippincott-Raven, Philadelphia. 2. Shenk, T. (1996). Adenoviridae: The viruses and their replication. In "Fields Virology" (B. N. Fields, D. M. Knipe, and P. M. Howley, Eds.), 3rd ed.. Vol. 2, pp. 2111-2148. Lippincott-Raven, Philadelphia. 3. Benko, M., Harrach, B., and Russell, W. C. (1999). Family adenoviridae. In "Virus Taxonomy. Seventh Report of the International Committee on Taxonomy of Viruses" (M. H. V. Van Regenmortel, C. M. Fauquet, D. H. L. Bishop, E. B. Carstens, M. K. Estes, S. M. Lemon, J. Maniloff, M. A. Mayo, D. J. McGeoch, C. R. Pringle, and R. B. Wickner, Eds.), pp. 227-238. Academic Press, New York, San Diego. 4. Harrach, B., Meehan, B. M., Benko, M., Adair, B. M., and Todd, D. (1997). Close phylogenetic relationship between egg drop syndrome virus, bovine adenovirus serotype 7, and ovine adenovirus strain 287. Virology 229, 302-308. 16. Xenogenic Adenoviral Vectors 4 7 1 5. Benko, M., and Harrach, B. (1998). A proposal for a new (third) genus within the family Adenoviridae. Arch. Virol. 143, 829-837. 6. Dan, A., Ruzsics, Z., Russell, W. C , Benko, M., and Harrach, B. (1998). Analysis of the hexon gene sequence of bovine adenovirus type 4 provides further support for a new adenovirus genus (Atadenovirus)./. Gen. Virol. 79, 1453-1460. 7. Harrach, B., and Benko, M. (1999). Phylogenetic analysis of adenovirus sequences — Proof of the necessity of establishing a third genus in the Adenoviridae family. In "Adenovirus Methods And Protocols" (W. S. M. Wold, Ed.), Vol. 21 , pp. 309-339. Humana Press, Totowa, NJ. 8. Both, G. (2001). Atadenoviruses. In "The Springer Index of Viruses" (C. Tidona, and G. Darai, Eds.), pp. 11-17. Springer-Verlag, Berlin. 9. Davison, A. J., Wright, K. M., and Harrach, B. (2000). DNA sequence of frog adenovirus. / . Gen. Virol. 81,2431-2439. 10. Graham, F. L., and Prevec, L. (1992). Adenovirus based expression vectors and recombinant vaccines. In "Vaccines: New Approaches to Immunological Problems" (R. W. ElHs, Ed.), pp. 363-390. Butterworth-Heinemann, Stoneham, MA. 11. Darbyshire, J. H., Jennings, A. R., Dawson, P. S., Lamont, P. H., and Omar, A. R. (1966). The pathogenesis and pathology of infection in calves with a strain of bovine adenovirus type 3. Res. Vet. Sci. 7, 81-93. 12. Derbyshire, J. B., Clarke, M. C., and Collins, A. P. (1975). Serological and pathogenicity studies with some unclassified porcine adenoviruses./. Comp. Pathol. 85, 437-443. 13. Koptopoulos, G., and Cornwell, H. (1981). Canine adenoviruses: A review. Vet. Bull. 51, 135-142. 14. Cowen, B., Calnek, B. W., Menendez, N. A., and Ball, R. F. (1978). Avian adenoviruses: Effect on egg production, shell quality, and feed consumption. Avian Dis. 22, 459-470. 15. Boyle, D. B., Pye, A. D., Kocherhans, R., Adair, B. M., Vrati, S., and Both, G. W. (1994). Characterisation of AustraUan ovine adenovirus isolates. Vet. Microbiol. 41, 281-291. 16. Kidd, A. H., Chroboczek, J., Cusack, S., and Ruigrok, R. W. H. (1993). Adenovirus Type-40 Virions Contain 2 Distinct Fibers. Virology 192, 73-84. 17. Hess, M., Cuzange, A., Ruigrok, R. W., Chroboczek, J., and Jacrot, B. (1995). The avian adenovirus penton: Two fibres and one base. / . Mol. Biol. 252, 379-385. 18. Tomko, R. P., Xu, R. L., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup
C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA 94, 3352-3356. 19. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 20. Farina, S. F., Fisher, K. J., and Wilson, J. M. (2000). Chimpanzee adenovirus vector useful in gene therapy and genetic engineering in general. US patent 6,083,716. 21. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrin-alpha- v-beta-3 and integrin-alpha-v-beta-5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 22. Vrati, S., Brookes, D. E., Strike, P., Khatri, A., Boyle, D. B., and Both, G. W. (1996). Unique genome arrangement of an ovine adenovirus: Identification of new proteins and proteinase cleavage sites. Virology 220, 186-199. 23. Chiocca, S., Kurzbauer, R., Schaffner, G., Baker, A., Mautner, V., and Gotten, M. (1996). The complete DNA sequence and genomic organization of the avian adenovirus CELO. / . Virol. 70, 2939-2949. 24. Reddy, P. S., Idamakanti, N., Zakhartchouk, A. N., Baxi, M. K., Lee, J. B., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1998). Nucleotide sequence, genome organization, and transcription map of bovine adenovirus type 3. / . Virol. 72, 1394-1402. 4 7 2 Gerald W. Both 25. Reddy, P. S., Idamakanti, N., Song, J. Y., Lee, J. B., Hyun, B. H., Park, J. H., Cha, S. H., Tikoo, S. K., and Babiuk, L. A. (1998). Sequence and transcription map analysis of early region-1 of porcine adenovirus type-3. Virus Res. 58, 97-106. 26. Morrison, M. D., Onions, D. E., and Nicolson, L. (1997). Complete DNA sequence of canine adenovirus type 1 . / . Gen. Virol. 78, 873-878. 27. Meissner, J. D., Hirsch, G. N., La Rue, E. A., Fulcher, R. A., and Spindler, K. R. (1997). Completion of the DNA sequence of mouse adenovirus type 1: Sequence of E2B, LI, and L2 (18-51 map units). Virus Res. 51, 53-64. 28. Stouten, P. F. W., Sander, C , Ruigrok, R. W. H., and Cusack, S. (1992). New Triple-Helical Model for the Shaft of the Adenovirus Fibre. / . Mol. Biol. 226, 1073-1084. 29. Xu, Z. Z., and Both, G. W. (1998). Altered tropism of an ovine adenovirus carrying the fiber protein cell binding domain of human adenovirus type 5. Virology 248, 156-163. 30. Chillon, M., and Kremer, E. (2001). Trafficking and propagation of canine adenovirus vectors lacking a known integrin-interacting motif. Hum. Gene Ther. 12, 1815-1823. 31. Soudais, C , Boutin, S., Hong, S., Chillon, M., Danos, O., Bergelson, J., Boulanger, P., and Kremer, E. (2000). Canine adenovirus type 2 attachment and internalization: CAR, alternative receptors and an RGD-independent pathway. / . Virol. 74, 10,639-10,649. 32. D'Ambrosio, E., Del Grosso, N., Chicca, A., and MiduUa, M. (1982). Neutralizing antibodies against 33 human adenoviruses in normal children in Rome. / . Hyg. (London) 89, 155-161. 33. Schulick, A. H., Vassalli, G., Dunn, P. F., Dong, G., Rade, J. J., Zamarron, C , and Dichek, D. A. (1997). Established immunity precludes adenovirus-mediated gene transfer in rat carotid arteries. Potential for immunosuppression and vector engineering to overcome barriers of immunity./. Clin. Invest. 99, 209-219. 34. Cooper, N. (1998). Complement dependent virus neutrafisation. In "The Complement System" (K. Rother, G. Till, and G. Hansch, Eds.), pp. 302-309. Springer Verlag, Berlin-Heidelberg-New York. 35. Flomenberg, P., Piaskowski, V., Truitt, R. L., and Casper, J. T. (1995). Characterization of human proliferative T cell responses to adenovirus. / . Infect. Dis. 171, 1090-1096. [see comments! 36. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck-Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: Cir cumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 37. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, L, Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangefi, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 38. Russi, T. J., Hirschowitz, E. A., and Crystal, R. G. (1997). Delayed-type hypersensitivity response to high doses of adenoviral vectors. Hum. Gene Ther. 8, 323-330. 39. Bramson, J. L., Hitt, M., Gauldie, J., and Graham, F. L. (1997). Pre-existing immunity to adenovirus does not prevent tumor regression following intratumoral administration of a vector expressing IL-12 but inhibits virus dissemination. Gene Ther. 4, 1069-1076. 40. Harvey, B. G., Hackett, N. R., El Sawy, T., Rosengart, T. K., Hirschowitz, E. A., Lieber- man, M. D., Lesser, M. L., and Crystal, R. G. (1999). Variability of human systemic humoral immune responses to adenovirus gene transfer vectors administered to different organs./. Virol. 73, 6729-6742. 41. Chen, Y., Yu, D. C , Charlton, D., and Henderson, D. R. (2000). Pre-existent adenovirus antibody inhibits systemic toxicity and antitumor activity of CN706 in the nude mouse LNCaP xenograft model: ImpUcations and proposals for human therapy. Hum. Gene Ther. 11,1553-1567. 16. Xenogenic Adenoviral Vectors 4 7 3 42. Klonjkowski, B., Gilardi-Hebenstreit, P., Hadchouel, J., Randrianarison, V., Boutin, S., Yeh, P., Perricaudet, M., and Kremer, E.J. (1997). A recombinant El-deleted canine adenoviral vector capable of transduction and expression of a transgene in human-derived cells and in vivo. Hum. Gene Ther. 8, 2103-2115. [see comments] 43. Kremer, E. J., Boutin, S., Chillon, M., and Danos, O. (2000). Canine adenovirus vectors: An alternative for adenovirus-mediated gene transfer./. Virol. 74, 505-512. 44. Hofmann, C , Loser, P., Cichon, G., Arnold, W., Both, G. W., and Strauss, M. (1999). Ovine adenovirus vectors overcome preexisting humoral immunity against human adenoviruses in vivo. / . Virol. 73, 6930-6936. 45. Wigand, R., Mauss, M., and Adrian, T. (1989). Chimpanzee adenoviruses are related to four subgenera of human adenoviruses. Intervirology 30, 1-9. 46. Reddy, P. S., Idamakanti, N., Song, J. Y., Lee, J. B., Hyun, B. H., Park, J. H., Cha, S. H., Bae, Y. T., Tikoo, S. K., and Babiuk, L. A. (1998). Nucleotide sequence and transcription map of porcine adenovirus type 3. Virology 251, 414-426. 47. Ojkic, D., and Nagy, E. (2000). The complete nucleotide sequence of fowl adenovirus type 8. / . Gen. Virol 81, 1833-1837. 48. Hess, M., Blocker, H., and Brandt, P. (1997). The complete nucleotide sequence of the egg drop syndrome virus: An intermediate between mastadenoviruses and aviadenoviruses. y/ro/og}/238, 145-156. 49. Pitcovski, J., Mualem, M., Rei-Koren, Z., Krispel, S., Shmueli, E., Peretz, Y., Gutter, B., Gallih, G. E., Michael, A., and Goldberg, D. (1998). The complete DNA sequence and genome organization of the avian adenovirus, hemorrhagic enteritis virus. Virology 249, 307-315. 50. Loser, P., Cichon, G., Jennings, G., Both, G., and Hofmann, C. (1999). Ovine adenovirus vectors promote efficient gene delivery in vivo. Gene Ther. Mol. Biol. 4, 33-43 . 51. Michou, A. I., Lehrmann, H., Saltik, M., and Gotten, M. (1999). Mutational analysis of the avian adenovirus CELO, which provides a basis for gene delivery vectors. / . Virol. 73, 1399-1410. 52. Ma, Y., and Mathews, M. B. (1993). Comparative analysis of the structure and function of adenovirus virus-associated RNAs./. Virol. 67, 6605-6617. 53. Kidd, A. H., Garwicz, D., and Oberg, M. (1995). Human and simian adenoviruses: Phylogenetic inferences from analysis of VA RNA genes. Virology 207, 32-45 . 54. Venktesh, A., Watt, F., Xu, Z. Z., and Both, G. W. (1998). Ovine adenovirus (OAV287) lacks a virus-associated RNA gene./. Gen. Virol. 79, 509-516. 55. Larsson, S., Bellett, A., and Akusjarvi, G. (1986). VA RNAs from avian and human adenoviruses: Dramatic differences in length, sequence, and gene location. / . Virol. 58, 600-609. 56. Wold, W. S. M., and Gooding, L. R. (1991). Region E3 of adenovirus: A cassette of genes involved in host immunosurveillance and virus-cell interactions. Virology 184, 1-8. 57. Raviprakash, K. S., Grunhaus, A., el Kholy, M. A., and Horwitz, M. S. (1989). The mouse adenovirus type 1 contains an unusual E3 region./. Virol. 63, 5455-5458. 58. Beard, C. W., Ball, A. O., Wooley,E. H., and Spindler, K. R. (1990). Transcription mapping of mouse adenovirus type 1 early region 3. Virology 175, 81-90. 59. Esford, L. E., and Haj-Ahmad, Y. (1994). Sequence analysis of the putative E3 region of bovine adenovirus type 2. Intervirology 37, 277-286. 60. Evans, P. S., Benko, M., Harrach, B., and Letchworth, G.J. (1998). Sequence, transcriptional analysis, and deletion of the bovine adenovirus type 1 E3 region. Virology 244, 173-185. 61. Reddy, P. S., Idamakanti, N., Derbyshire, J. B., and Nagy, E. (1996). Porcine adenoviruses types 1, 2 and 3 have short and simple early E-3 regions. Virus Res. 43, 99-109. 62. Idamakanti, N., Reddy, P. S., Babiuk, L. A., and Tikoo, S. K. (1999). Transcription mapping and characterization of 284R and 12IR proteins produced from early region 3 of bovine adenovirus type 3. Virology 256, 351-359. 4 7 4 Gerald W. Both 63. Tuboly, T., and Nagy, E. (2000). Sequence analysis and deletion of porcine adenovirus serotype 5 E3 region. Virus Res. 68, 109-117. 64. Zakhartchouk, A., Godson, D., Babiuk, L., and Tikoo, S. (2001). 121R protein from the E3 region of bovine adenovirus-3 inhibits cytolysis of mouse cells by human TNF. Intervirol. 44 ,29 -35 . 65. Horwitz, M. S. (1990). Adenoviridae and their replication. In "Virology" (B. N. Fields, and D. M. Knipe, Eds.), 2nd ed., pp. 1679-1721. Raven Press, New York. 66. Morin, J. E., Lubeck, M. D., Barton, J. E., Conley, A. J., Davis, A. R., and Hung, P. P. (1987). Recombinant adenovirus induces antibody responses to hepatitis B virus surface antigen in hamsters. Proc. Natl. Acad. Sci. USA 84, 4626-4630. 67. Ilan, Y., Droguett, G., Chowdhury, N. R., Li, Y. A., Sengupta, K., Thummala, N. R., Davidson, A., Chov^dhury, J. R., and Horwitz, M. S. (1997). Insertion of the adenovi ral E3 region into a recombinant viral vector prevents antiviral humoral and cellular immune responses and permits long-term gene expression. Proc. Natl. Acad. Sci. USA 94, 2587-2592. 68. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., Pernis, B., Wold, W. S. M., Chanock, R. M., and Prince, G. A. (1989). Role of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. Sci. USA 86, 3823-3827. 69. Vrati, S., Boyle, D., Kocherhans, R., and Both, G. W. (1995). Sequence of ovine adenovirus homologs for 100 K hexon assembly, 33 K, pVIII, and fiber genes: Early region E3 is not in the expected location. Virology 209, 400-408. 70. Kring, S. C., Ball, A. O., and Spindler, K. R. (1992). Transcription mapping of mouse adenovirus Type-1 early region-4. Virology 190, 248-255. 71. Baxi, M. K., Babiuk, L. A., MehtaU, M., and Tikoo, S. K. (1999). Transcription map and expression of bovine herpesvirus-1 glycoprotein D in early region 4 of bovine adenovirus-3. V/ro/og); 261, 143-152. 72. Khatri, A., and Both, G. W. (1998). Identification of transcripts and promoter regions of ovine adenovirus OAV287. Virology 245, 128-141. 73. Lehrmann, H., and Gotten, M. (1999). Characterization of CELO virus proteins that modulate the pRb/E2F pathway./. Virol. 73, 6517-6525. 74. Cao, J. X., Krell, P. J., and Nagy, E. (1998). Sequence and transcriptional analysis of terminal regions of the fowl adenovirus type 8 genome./. Gen. Virol. 79, 2507-2516. 75. Xu, Z. Z., Hyatt, A., Boyle, D. B., and Both, G. W. (1997). Construction of ovine ade novirus recombinants by gene insertion or deletion of related terminal region sequences. V/ro/og}; 230, 62 -71 . 76. Khatri, A., Xu, Z. Z., and Both, G. W. (1997). Gene expression by atypical recombinant ovine adenovirus vectors during abortive infection of human and animal cells in vitro. Virology 239, 226-237. 77. Kleiboeker, S. B. (1995). Identification and sequence analysis of the El genomic region of a porcine adenovirus. Virus Res. 36, 259-268. 78. Elgadi, M., Rghei, N., and Haj-Ahmad, Y. (1993). Sequence and sequence analysis of El and pIX regions of the BAV3 genome. Intervirology 36, 113-120. 79. Reddy, P. S., Chen, Y., Idamakanti, N., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1999). Characterization of early region 1 and pIX of bovine adenovirus-3. Virology 253,299-308. 80. Aggarwal, N., and Mittal, S. K. (2000). Sequence analysis of porcine adenovirus type 3 El region, pIX and pIVa2 genes,
and two novel open reading frames (Vol 43, pg 6, 2000). Intervirology 43, 128. 81. Schmid, S. I., and Hearing, P. (1998). Cellular components interact with adenovirus type 5 minimal DNA packaging domains./. Virol. 72, 6339-6347. 82. Soudais, C , Boutin, S., and Kremer, E. (2001). Characterisation of cis-acting sequences involved in the canine adenovirus packaging domain. Mol. Ther. 3, 631-640. 16. Xenogenic Adenoviral Vectors 4 7 5 83. Nevels, M., Rubenwolf, S., Spruss, T., Wolf, H., and Dobner, T. (2000). Two distinct activities contribute to the oncogenic potential of the adenovirus type 5 E4orf6 protein. / . V/Vo/. 74,5168-5181. 84. Payet, V., Arnauld, C , Picault, J. P., Jestin, A., and Langlois, P. (1998). Transcriptional organization of the avian adenovirus CELO./. Virol. 72, 9278-9285. 85. Ball, A. O., Beard, C. W., Redick, S. D., and Spindler, K. R. (1989). Genome organization of mouse adenovirus type 1 early region 1: A novel transcription map. Virology 170, 523-536. 86. Zheng, B. J., Graham, F. L., and Prevec, L. (1999). Transcription units of Ela, Elb and pIX regions of bovine adenovirus type 3. / . Gen. Virol. 80, 1735-1742. 87. McAllister, R., Nicolson, M., Levels AM, J., Macpherson, I., and Huebner, R. (1969). Transformation of rat embryo cells by adenovirus type 1. / . Gen. Virol. 4, 29-36. 88. Trentin, J. J., Yabe, Y., and Taylor, G. (1962). The quest for human cancer viruses. Science 137, 835. 89. Kinjo, T., Nishi, T., and Yanagawa, R. (1969). In vitro transformation of hamster cells by infectious canine hepatitis virus. Jpn. J. Vet. Res. 17, 128-135. 90. Flint, S. (1980). Cell transformation induced by adenoviruses. In "DNA Tumor Viruses" (J. Tooze, Ed.), 2nd ed.. Part 2, pp. 574-576. Cold Spring Harbor Press, Cold Spring Harbor, NY. 91. Darbyshire, J. (1966). Oncogenicity of bovine adenovirus type 3 in hamsters. Nature 211, 102. 92. Anderson, J., Yates, V. J., Jasty, V., and Mancini, L. O. (1969). In vitro transformation by an avian adenovirus (CELO). I. Hamster-embryo fibroblastic cultures./. Natl. Cancer Inst. 42, 1-7. 93. Anderson, J., Yates, V. J., Jasty, V., and Mancini, L. O. (1969). In vitro transformation by an avian adenovirus (CELO). 11. Hamster kidney cell cultures. / . Natl. Cancer Inst. 43, 65-70. 94. Sarma, P. S., Huebner, R. J., and Lane, W. T. (1965). Induction of tumors in hamsters with an avian adenovirus (CELO), Science 149, 1108. 95. Mancini, L. O., and Yates, V. J. (1973). Attempts to produce tumors in mice with CELO virus. Arch. Gesamte Virusforsch. 40, 174-175. 96. Rondhuis, P. R. (1973). Induction of tumors in hamsters with a bovine adenovirus strain (serotype 8). Arch. Gesamte Virusforsch. 41, 147-149. 97. Mohanty, S. B. (1971). Comparative study of bovine adenoviruses. Am. J. Vet. Res. 32, 1899-1905. 98. Xu, Z. Z., Nevels, M., MacAvoy, E. S., Lockett, L. J., Curiel, D., Dobner, T., and Both, G. W. (2000). An ovine adenovirus vector lacks transforming ability in cells that are transformed by AD5 ElA/B sequences. Virology 270, 162-172. 99. Whyte, P., Buchkovich, K. J., Horowitz, J. M., Friend, S. H., Raybuck, M., Weinberg, R. A., and Harlow, E. (1988). Association between an oncogene and an anti-oncogene: The adenovirus El A proteins bind to the retinoblastoma gene product. Nature 334, 124-129. 100. Nevins, J. R. (1992). E2F: A link between the Rb tumor suppressor protein and viral oncoproteins. Science 258, 424-429. 101. White, E. (1998). Regulation of apoptosis by adenovirus ElA and ElB oncogenes, Sem. Virol. 8, 505-513, 102. Rao, L., Debbas, M,, Sabbatini, P., Hockenbery, D., Korsmeyer, S., and White, E. (1992). The adenovirus ElA proteins induce apoptosis, which is inhibited by the ElB 19-kDa and Bcl-2 proteins. Proc. Natl. Acad. Sci. USA 89, 7742-7746. 103. Moore, M., Horikoshi, N., and Shenk, T. (1996). Oncogenic potential of the adenovirus E4orf6 protein, Proc. Natl. Acad. Sci. USA 93, 11,295-11,301. 4 7 6 Gerald W. Both 104. Nevels, M., Rubenwolf, S., Spruss, T., Wolf, H., and Dobner, T. (1997). The adenovirus E4orf6 protein can promote ElA/ElB-induced focus formation by interfering with p53 tumor suppressor function. Proc. Natl. Acad. Set. USA 94, 1206-1211. 105. Nevels, M., Spruss, T., Wolf, H., and Dobner, T. (1999). The adenovirus E4orf6 protein contributes to malignant transformation by antagonizing ElA-induced accumulation of the tumor suppressor protein p53. Oncogene 18, 9-17. 106. Nevels, M., Tauber, B., Kremmer, E., Spruss, T., Wolf, H., and Dobner, T. (1999). Transforming potential of the adenovirus type 5 E4orf3 protein. / . Virol. 73, 1591-1600. 107. Dobbelstein, M., Roth, J., Kimberly, W. T., Levine, A. J., and Shenk, T. (1997). Nuclear export of the ElB 55-kDa and E4 34-kDa adenoviral oncoproteins mediated by a rev-like signal sequence. EMBO J. 16, 4276-4284. 108. Ball, A. O., Beard, C. W., Villegas, P., and Spindler, K. R. (1991). Early region 4 sequence and biological comparison of two isolates of mouse adenovirus type 1. Virology 180, 257-265. 109. Reddy, P. S., Idamakanti, N., Derbyshire, J. B., and Nagy, E. (1997). Characterization of the early region 4 of porcine adenovirus type 3. Virus Genes 15, 87-90. 110. Lee, J. B., Baxi, M. K., Idamakanti, N., Reddy, P. S., Zakhartchouk, A. N., Pyne, C , Babiuk, L. A., and Tikoo, S. K. (1998). Genetic organization and DNA sequence of early region 4 of bovine adenovirus type 3. Virus Genes 17, 99-100. 111. Chiocca, S., Baker, A., and Gotten, M. (1997). Identification of a novel antiapoptotic protein, GAM-1, encoded by the GELO adenovirus./. Virol. 71, 3168-3177. 112. Glotzer, J. B., Saltik, M., Ghiocca, S., Michou, A. I., Moseley, P., and Gotten, M. (2000). Activation of heat-shock response by an adenovirus is essential for virus replication. Nature 407,207-211 . 113. Kovesdi, I., Reichel, R., and Nevins, J. R. (1987). Role of an adenovirus E2 promoter binding factor in ElA-mediated coordinate gene control. Proc. Natl. Acad. Sci. USA 84, 2180-2184. 114. Reddy, P. S., Idamakanti, N., Ghen, Y., Whale, T., Babiuk, L. A., Mehtah, M., and Tikoo, S. K. (1999). Replication-defective bovine adenovirus type 3 as an expression vector. / . Virol. 73, 9137-9144. 115. Reddy, P. S., Idamakanti, N., Babiuk, L. A., Mehtali, M., and Tikoo, S. K. (1999). Porcine adenovirus-3 as a helper-dependent expression vector. / . Gen. Virol. 80, 2909-2916. 116. Nguyen, T. T., Nery, J. P., Joseph, S., Rocha, G. E., Garney, G. E., Spindler, K. R., and Vil- larreal, L. P. (1999). Mouse adenovirus (MAV-1) expression in primary human endotheHal cells and generation of a full-length infectious plasmid. Gene Ther. 6, 1191-1197. 117. Vrati, S., Macavoy, E. S., Xu, Z. Z., Smole, G., Boyle, D. B., and Both, G. W. (1996). Gonstruction and transfection of ovine adenovirus genomic clones to rescue modified viruses. Virology 110, 200 -3 . 118. Reddy, P. S., Idamakanti, N., Hyun, B. H., Tikoo, S. K., and Babiuk, L. A. (1999). Devel opment of porcine adenovirus-3 as an expression vector. / . Gen. Virol. 80, 563-570. 119. Johnson, M. A., Pooley, G., and Lowenthal, J. W. (2000). Delivery of avian cytokines by adenovirus vectors. Dev. Comp. Immunol. 24, 343-354. 120. Hammond, J. M., McGoy, R. J., Jansen, E. S., Morrissy, G. J., Hodgson, A. L., and John son, M. A. (2000). Vaccination with a single dose of a recombinant porcine adenovirus expressing the classical swine fever virus gp55 (E2) gene protects pigs against classical swine fever. Vaccine 18, 1040-1050. 121. Rasmussen, U. B., Benchaibi, M., Meyer, V., Schlesinger, Y., and Schughart, K. (1999). Novel human gene transfer vectors: Evaluation of wild-type and recombinant animal adenoviruses in human-derived cells. Hum. Gene Ther. 10, 2587-2599. 122. Pye, D. (1989). Gell lines for growth of sheep viruses. Aust. Vet. J. 66, 231-232. 123. Graham, F. L., Smiley, J., Russell, W. G., and Nairn, R. (1977). Gharacteristics of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-72. 16. Xenogenic Adenoviral Vectors 4 7 7 124. Fallaux, F. J., Kranenburg, O., Cramer, S. J., Houweling, A., van Ormondt, H., Hoeben, R. C , and van der Eb, A. J. (1996). Characterization of 911: A nev^ helper cell line for the titration and propagation of early region 1-deleted adenoviral vectors. Hum. Gene Ther. 7, 215-222. 125. Zheng, B., Mittal, S. K., Graham, F. L., and Prevec, L. (1994). The El sequence of bovine adenovirus type 3 and complementation of human adenovirus type 5 ElA function in bovine cells. Virus Res. 31, 163-186. 126. Mittal, S. K., Prevec, L., Graham, F. L., and Babiuk, L. A. (1995). Development of a bovine adenovirus type 3-based expression vector./. Gen. Virol. 76, 93-102. 127. Bett, A. J., Prevec, L., and Graham, F. L. (1993). Packaging capacity and stability of human adenovirus type- 5 vectors./. Virol. 67, 5911-5921. 128. Zakhartchouk, A. N., Reddy, P. S., Baxi, M., Baca-Estrada, M. E., Mehtali, M., Babiuk, L. A., and Tikoo, S. K. (1998). Construction and characterization of E3-deleted bovine adenovirus type 3 expressing full-length and truncated form of bovine herpesvirus type 1 glycoprotein gD. Virology 250, 220-229. 129. Loser, P., Hillgenberg, M., Arnold, W., Both, G. W., and Hofmann, C. (2000). Ovine aden ovirus vectors mediate efficient gene transfer to skeletal muscle. Gene Ther. 7, 1491-1498. 130. Hanahan, D., and Gluzman, Y. (1984). Rescue of functional replication origins from embedded configurations in a plasmid carrying the adenovirus genome. Mol. Cell. Biol. 4, 302-309. 131. Leach, D. R., and Stahl, F. W. (1983). Viability of lambda phages carrying a perfect palindrome in the absence of recombination nucleases. Nature 305, 448-451. 132. Graham, F. L. (1984). Covalently closed circles of human adenovirus DNA are infectious. £ M B O / . 3,2917-2922. 133. Chartier, C , Degryse, E., Gantzer, M., Dieterle, A., Pavirani, A., and Mehtali, M. (1996). Efficient generation of recombinant adenovirus vectors by homologous recombination in Escherichia coH. / . Virol. 70, 4805-4810. 134. van Olphen, A. L., and Mittal, S. K. (1999). Generation of infectious genome of bovine adenovirus type 3 by homologous recombination in bacteria. / . Virol. Methods 77, 125-129. 135. Morsy, M. A., Gu, M. C , Motzel, S., Zhao, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F. L,, Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 136. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proc. Natl. Acad. Sci. USA 93, 5731-5736. 137. Mittal, S. K., Middleton, D. M., Tikoo, S. K., Prevec, L., Graham, F. L., and Babiuk, L. A. (1996). Pathology and immunogenicity in the cotton rat (Sigmodon hispidus) model after infection with a bovine adenovirus type 3 recombinant virus expressing the firefly luciferase gene./. Gen. Virol. 77, 1-9. 138. Zakhartchouk, A. N., Pyne, C , Mutwiri, G. K., Papp, Z., Baca-Estrada, M. E., Griebel, P., Babiuk, L. A., and Tikoo, S. K. (1999). Mucosal immunization of calves with recombinant bovine adenovirus-3: Induction of protective immunity to bovine herpesvirus-1. / . Gen. Virol. 80, 1263-1269. 139. Babiuk, L. A., and Tikoo, S. K. (2000). Adenoviruses as vectors for delivering vaccines to mucosal surfaces./. Biotechnol. 83, 105-113. 140. Reddy, P., Idamakanti, N., Pyne, C , Zakhartchouk, A., Godson, D., Papp, Z., Baca- Estrada, M., Babiuk, L., Mutwiri, G., and Tikoo, S. (2000). The immunogenicity and efficacy of replication-defective and replication-competent bovine adenovirus-3 expressing bovine herpes-1 glycoprotein gD in cattle. Vet. Immunol. Immunopathol. 76, 267-268. 4 7 8 Gerald W. Both 141. Baxi, M., Deregt, D., Robertson, J., Babiuk, L., Schlapp, T., and Tikoo, S. (2000). Recombinant bovine adenovirus type 3 expressing bovine diarrhea virus glycoprotein E2 induces an immune response in cotton rats. Virology 278, 234-243. 142. Reddy, P., Idamakanti, N., Zakhartchouk, A., Babiuk, L., Mehtali, M., and Tikoo, S. (2001). Optimization of bovine coronavirus hemagglutinin-esterase glycoprotein expression in E3 deleted bovine adenovirus 3. Virus Res. 70, 65-73 . 143. Vrati, S., Brookes, D. E., Boyle, D. B., and Both, G. W. (1996). Nucleotide sequence of ovine adenovirus tripartite leader sequence and homologues of the IVa2, DNA polymerase and terminal proteins. Gene 177, 35 -41 . 144. Rothel, J. S., Boyle, D. B., Both, G. W., Pye, A. D., Waterkeyn,
J. G., Wood, P. R., and Lightow^lers, M. W. (1997). Sequential nucleic acid and recombinant adenovirus vaccination induces host-protective immune responses against Taenia ovis infection in sheep. Parasite Immunol \9,111-117. 145. Thomas, G., and Mathews, M. (1980). DNA replication and the early to late transition in adenovirus infection. Cell 22, 523-533. 146. Tribouley, C., Lutz, P., Staub, A., and Kedinger, C. (1994). Product of the adenovirus intermediate gene IVa2 is a transcriptional activator of the major late promoter. / . Virol. 68, 4450-4457. 147. Zijderveld, D. C., Difagagna, F. D., Giacca, M., Timmers, H. T. M., and van der Vhet, P. C. (1994). Stimulation of the adenovirus major late promoter in vitro by transcription factor USE is enhanced by the adenovirus DNA binding protein. / . Virol. 68, 8288-8295. 148. Chang, L.-S., and Shenk, T. (1990). The adenovirus DNA-binding protein stimulates the rate of transcription directed by adenovirus and adeno-associated virus promoters. / . Virol. 64,2103-2109. 149. Dan, A., Elo, P., Harrach, B., Zadori, Z., and Benko, M. (2001). Four new inverted terminal repeat sequences from bovine adenoviruses reveal striking differences in the length and content of ITRs. Virus Genes 22, 175-179. 150. Bischoff, J. R., Kim, D. H., Williams, A., Heise, C., Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick, F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 373-376. 151. Rodriguez, R., Schuur, E. R., Lim, H. Y., Flenderson, G. A., Simons, J. W., and Henderson, D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559-2563. 152. Kajon, A. E., Brown, C. C., and Spindler, K. R. (1998). Distribution of mouse adenovirus type 1 in intraperitoneally and intranasally infected adult outbred mice. / . Virol. 71, 1219-1223. 153. Smith, T. A. G., Mehaffey, M. G., Kayda, D. B., Saunders, J. M., Yei, S., Trapnell, B. C., McClelland, A., and Kaleko, M. (1993). Adenovirus mediated expression of therapeutic plasma levels of human factor IX in mice. Nat. Genet. 5, 397-402. 154. Kafri, T., Morgan, D., Krahl, T., Sarvetnick, N., Sherman, L., and Verma, I. (1998). Cellular immune response to adenoviral vector infected cells does not require de novo viral gene expression: Implications for gene therapy. Proc. Natl. Acad. Sci. USA 95, 11,377-11,382. 155. Moffatt, S., Hays, J., HogenEsch, H., and Mittal, S. K. (2000). Circumvention of vector- specific neutralizing antibody response by alternating use of human and non-human adenoviruses: Implications in gene therapy. Virology 171, 159-167. 156. Aghi, M., Hochberg, F., and Breakefield, X. O. (2000). Prodrug activation enzymes in cancer gene therapy. / . Gene Med. 2, 148-164. 157. Sorscher, E. J., Peng, S., Bebok, Z., Allan, P. W., Bennett, L. L., Jr., and Parker, W. B. (1994). Tumor cell bystander killing in colonic carcinoma utilizing the Escherichia coli DeoD gene to generate toxic purines. Gene Ther. 1, 233-238. 16. Xenogenic Adenoviral Vectors 4 7 9 158. Martiniello-Wilks, R., Garcia-Aragon, J., Daja, M. M., Russell, P., Both, G. W., MoUoy, P. L., Lockett, L. J., and Russell, P.J. (1998). In vivo gene therapy for prostate cancer: Preclinical evaluation of two different enzyme-directed prodrug therapy systems delivered by identical adenovirus vectors. Hum. Gene Ther. 9, 1617-1626. 158a. Lockett, L. J., and Both, G. W. (2002). Complementation of a defective human adenovirus by an otherwise incompatible ovine adenovirus recombinant carrying a functional El A gene. Virology, in press. 159. Brown, F., et al. (Eds.) (1998). "WHO Requirements for the Use of Animal Cells as in Vitro Substrates for the Production of Biologicals. Safety of Biological Products Prepared from Mammalian Cell Culture," Vol. 93. Basel, Karger. 160. Yamashita, T., Ren, C. S., Yoshida, K., Shinagawa, M., Masuda, K., and Fujinaga, K. (1985). Two distinctive transforming DNA regions on the canine adenovirus type 1 genome. Jpn. J. Cancer Res. 76, 436-440. 161. Weiss, R. S., Lee, S. S., Prasad, B. V., and Javier, R. T. (1997). Human adenovirus early region 4 open reading frame 1 genes encode growth-transforming proteins that may be distantly related to dUTP pyrophosphatase enzymes./. Virol. 71, 1857-1870. 162. Thomas, D. L., Shin, S., Jiang, B. H., Vogel, H., Ross, M. A., Kaplitt, M., Shenk, T. E., and Javier, R. T. (1999). Early region 1 transforming functions are dispensable for mammary tumorigenesis by human adenovirus type 9 . / . Virol. 73, 3071-3079. 163. Tollefson, A. E., Ryerse, J. S., Scaria, A., Hermiston, T. W., and Wold, W. S. M. (1996). The E3-11.6-kDa adenovirus death protein (ADP) is required for efficient cell death: Characterization of cells infected with adp mutants. Virology 220, 152-162. 164. Dix, B. R., O'CarroU, S. J., Myers, C. J., Edwards, S. J., and Braithwaite, A. W. (2000). Efficient induction of cell death by adenoviruses requires binding of Elb55 k and p53. Cancer Res. 60, 2666-2672. 165. Zhu, J. D., Grace, M., Casale, J., Chang, A. T. L, Musco, M. L., Bordens, R., Greenberg, R., Schaefer, E., and Indelicato, S. R. (1999). Characterization of replication-competent adenovirus isolates from large-scale production of a recombinant adenoviral vector. Hum. Gene Ther. 10 ,113-121 . 166. Fallaux, F. J., Bout, A., van der velde, L, van den Wollenberg, D. J. M., Hehir, K. M., Keegan, J., Auger, C , Cramer, S. J., van Ormondt, H., van der Eb, A. J., Valerio, D., and Hoeben, R, C. (1998). New helper cells and matched early region 1-deleted adenovirus vectors prevent generation of replication-competent adenoviruses. Hum. Gene Ther. 9, 1909-1917. 167. Blanche, F., Cameron, B., Barbot, A., Ferrero, L., Guillemin, T., Guyot, S., Somarriba, S., and Bisch, D. (2000). An improved anion-exchange HPLC method for the detection and purification of adenoviral particles. Gene. Ther. 7, 1055-1062. C H A P T E R Hybrid Adenoviral Vectors Stephen J. Murphy and Richard G. Vile Molecular Medicine Program Mayo Clinic and Foundation Rochester, Minnesota I. Introduction The characterization of disease at the genetic level facilitates potential genotypic and/or phenotypic correction by gene therapy. Although the concept of gene therapy has been extensively established over the past tv^o decades, the development of effective clinical protocols to facilitate efficacious reversal of disease has proven highly problematic. The development of an effective gene delivery system to the site of therapeutic significance has proven to be the major hurdle to the advancement of gene therapies. Many questions currently remain unanswered and these raise major debates over the best vector systems to treat a specific clinical disorder, and, at a more fundamental level, the choice of gene to be applied. The ultimate goal of a gene therapy protocol is efficient targeted delivery of a therapeutic transgene, whose expression can be sufficiently regulated, in a defective tissue. Vector delivery would ideally involve a single, lifetime treatment by a simple, noninvasive, and safe protocol, which can be incorporated into clinical practice. The vast array of diseases, for which gene therapy presents clinical promise, demands a multitude of different requirements for a vector system to meet. Ideologies for gene therapy vectors will differ considerably among dif ferent disorders. The treatment of severely disabling genetic disorders such as Duchenne muscular dystrophy would require lifelong genetic complemen tation of the defective gene in an immense amount of both skeletal and smooth muscular tissues, as well as brain tissues to correct cognitive functions. Whereas somatic gene therapy for hemophilia B holds out greater potential for treatment; only a few percent of normal, reversed-phenotype cells would be sufficient to provide a constant level of factor IX in plasma, offering patients significant clinical improvements. In contrast to the aim of preservation of host ADENOVIRAL VECTORS FOR GENE THERAPY ^ g \| Copyright 2002, Elsevier Science (USA). All rights reserved. 4 8 2 Murphy and Vile Table I Comparison of the Ideologies of a Gene Therapy Vector for Genetic Disorders and Cancer Genetic disorder Aim: Cell preservation Targeting diseased tissues Efficient transduction of affected cells Therapeutic levels of transgene expression Adequate maintenance of gene expression levels Long term stable transgene expression Minimal vector toxicity Cancer Aim: Cell eradication Targeting diseased tissues Efficient transduction of tumor cells Therapeutic levels of transgene expression Transient vector expression for tumor clearance Vector toxicity — danger signals attack tumor cells physiology for inherited disorders, gene therapy for cancer focuses on efficient cell killing (Table I). Hence, genetic cancer therapies require different vector functions, requiring initial high local transduction of primary tumor masses to effect clinical removal, follow^ed by subsequent systemic vector surveillance to eliminate metastatic disease. In essence, ideological concepts are rarely fully achieved and the current minimal aim of gene therapy is reversal of clinical phenotypes to the extent of easy maintenance, facilitating improvements in standards of life for patients. Despite the development of increasingly complex nonviral gene delivery systems, it is virally derived vector systems which still offer most promise to the clinic. Viruses have throughout evolution developed highly skilled methods of entering cells, evading the host immune defense, and delivering their viral payloads. Hence, phenomenal amounts of research have been directed at harnessing the finely tuned transduction functions and obligate parasite lifestyles of viruses. A plethora of genetically modified viral vector systems has now been reported, all ingeniously subverting the parasitic viral life cycles for the presentation of therapeutic transgenes aimed at reversal of disease phenotype. The development of viruses as cHnical vectors will revolutionize the medical world, providing an invaluable new tool for the treatment of disease. Our present understanding of the molecular genetics of many viruses renders possible their manipulation as cloning vectors for gene transfer both in cell culture and directly in patients. As the major objective is usually long-lasting 17. Hybrid Adenoviral Vectors 4 8 3 gene transfer, deletion of the key regulatory viral genes was deemed essential to manipulate the genetic program of the virus and to ensure that infection of the target cell does not lead to cell death. Conversely, for the treatment of cancer, more recent strategies have reversed this thinking and selectively retain the replicative functions of the virus to enhance tumor cell killing. Viruses have thus been designed with predictable biological properties, retaining the beneficial targeting/infectivity properties, while dissociating them from the major virulent determinants of pathology in normal tissues. Currently, four classes of viral vector have presented most promise as gene delivery vehicles: retroviruses (RVs), adenoviruses (Ads), adeno-associated viruses (AAVs) and herpes-simplex-based viruses (HSVs). Although retro viruses embodied the pioneering vector when the concept of gene therapy began to emerge as a reality in the early 1980s, adenoviruses have since become the major vector choice in the chnic. More recent advances in the pro duction technologies of HSV- and AAV-based vectors have greatly increased their clinical potentials. Additionally, the lentiviral (LV) subclass of retroviral vectors, with distinct biological properties, has emerged with great potential and has gained individual acclaim from the rest of the group. The major properties of each viral vector are presented in Table II, as well as being briefly discussed below. A. Retroviral Vectors Retroviruses are enveloped RNA viruses, whose genomes consist of three core genetic units termed gag^ pol^ and env (Fig. lA) [1]. Retroviruses stably transduce cells by integrating their genomes into the host-cell chromosomes and subsequently release progeny virus by continuously budding viral particles from the cell membrane. The gag gene encodes proteins which form the viral core, while the pol gene encodes reverse transcriptase (RT), the viral integrase (INT), and a viral protease which acts on the gag gene products. The env gene encodes the glycosylated envelope proteins that determine the tropism of the virus. These genetic elements are flanked by the long-terminal repeat (LTR) sequences and a packaging signal (\\|;) which directs the assembly of the genome into the viral particles (Fig. lA) [1]. The LTR sequences contain the ds-acting elements required to regulate viral genome replication and transcription and mediate stable integration into the host genome [1]. Retroviral vectors have been principally based on the well-studied Moloney murine leukaemia virus (MoMuLV). Recombinant MoMuLV vectors are engineered by replacing the gag^ pol^ and ^/^t'-coding units with a transgene of interest, while retaining the LTRs and packaging ds-acting sequences. Producer cell lines stably trans formed with independent gag/pol and env expression cassettes are used to fully complement the viral polypeptides for packaging of the vector proviruses [2, 3]. Hence by transfecting these packaging cell lines with plasmid-based
LTR- flanked retroviral cassettes, retroviral particles efficiently bud from the host >̂ > bJD -a ^ - O H-1 s < ^-T^ -Q (U Z G ^> P^ w o Q a> C/5 < o a. o 2 OJ aus C/3 > c -a w ^ ' >H ^ c > 1 OS >s Q. P <L> I—H JT^ -D J^ V3 I PL] \|\ ^ "o '̂ >̂ I > O ^ S ^ } 0^ 2 I I ON III! ^ 1 c ro ^ _o 1 3 -O 3 oo ĉ s bJD i> 1 1 ^ £ K-1 bf 6̂ bJD a o c p 2 c3 O 2 484 ^ > -^3 O C/3 c3 tJD o S 2 g S ^ i r3 :3 OJ c^ OJ cj ^ (U 'U-i O^ -j-H q i ! o i r !̂ s tr 'S j : ^ -^ •—I "H ^ .ti ^ c ^ • • • 2 § ^ H ^ y .§ O (u IEJII (U .§ 3 ^ ci Ŝ '7^ s g s i ^ I 11o (u <î ^ . 5 5̂ rH O ^ § 8 bJD >- r v ^2 «:§" B O C3 <7i l l l ^ l . ^1 ^1 1CI ^ 2 S I j \| g StjD .ĝS S. f̂5t̂ 1s S^ J^ ^ .̂ •D ^ -g i s fS :i: 8 u If > CI . 2 ci ?5 c &J0 CD o .. (U <U S.^ ^P si o '~̂ bt, C Y <u 2 B s ••̂ ^ n O H ^ K g ^ ^ o hS OS O ^i O i"̂t li p̂ i -̂ 2 H-l cj > ::3 U i H § ^ .S W 2 o O ^ bJD g 7u ^ S S . ^ IT) en u* C ^r '̂ 3 -^ 5 - 1 2H OS O '3 X W) O . > - o ix -rU C • 2 K cl (U _^ "+3 -O CH JJ • ' - ' ^3 ^ •̂ e ^ij r;" 5-1 s-i j - j ^ ^ 3 JC as t j o bJO O S ^ c o ^ O H pti o o U 485 486 Murphy and Vile 5'LTR »F iMPS^BlittKftBill SWIBI 3'LTR /:,-l^^ltftiildfie €5^^'=} v; ii'v:;:;;; •' 1111111 t Late Genes ^ E 3 5'rTR * 3'ITR t *• E2 E4 ' f iraiag^-.iD^^:, B Ori,b acterial Transgene Ampicilin' D Cassette (s) Figure 1 Vector genome structures. The wild-type viral genomes and the strategy of transgene substitution are presented for (A) retrovirus, (B) adenovirus, and (C) adeno-associated virus. (D) The minimal structure of the HSV-1 -based amplicon vector. 17. Hybrid Adenoviral Vectors 4 8 7 cells containing the recombinant retroviral genome. These retroviral particles are capable of infecting cells and directing the expression of the transgene of interest, but cannot replicate or generate progeny virus. B. Adenoviral Vectors Adenoviral particles consist of lipid-free "spiked" regular icosahedra of 60-90 nm in diameter, consisting of three main structural proteins, termed hexon, penton base, and fiber [4]. The genome consists of a double-stranded linear DNA molecule of approximately 36 kb in length, functionally divided into two major noncontiguous overlapping regions, early and late, defined by the onset of transcription after infection (Fig. IB) [5]. There are five distinct early regions (ElA, ElB, E2, E3, and E4) and one major late region (MLR) with five principal coding units (LI to L5), plus several minor intermediate and/or late regions. At the extremities of the viral chromosome are the inverted terminal repeats (ITRs) and the encapsidation signal (\\|;), encompassing the cis elements necessary for viral DNA replication and packaging [5]. Recombinant Ad vectors are constructed by deleting the essential early genes ElA and ElB, whose expression enables transformation of the host cell and trans-actiyatQS expression of the other early viral genes, as well as some host factors [6]. Transgenes are inserted into this deleted region (Fig. IB) and can be assembled into infectious adenoviral particles in cell lines which trans- complement the ElA/B functions [7]. Additional deletions in the nonessential E3 region are also often performed to increase cloning capacities [8], Thus infection of cells with the Ad vector enables expression of the transgene in the absence of expression of viral proteins. Further incapacitation of the Ad vector genomes, limiting leaky expression of viral proteins by further deletions in the E2 or E4, has also proved advantageous, further enhancing the cloning capacities, but requiring further complementation functions in packaging cell lines [9-12]. The development of so-called "gutless" or helper-dependent (HD) adenoviral vectors has also greatly expanded the potential of Ad vectors. These vectors retain just the terminal ITRs and ijf required for replication and packaging of adenoviral genomes, greatly increasing the cloning capacity [13]. C. Adeno-associated Viruses Adeno-associated viruses have recently become attractive candidates for gene transfer. AAVs belong to the family parvoviridae and consist of nonenveloped icosahedral virions of 18-26 nm diameter, with linear single- stranded DNA genomes of 4680 nucleotides for the most characterized AAV2 strain [14, 15]. The genome consists of two coding regions, cap and rep, which are flanked by ITRs and encapsidation signals (\\|/) at either end of the genome (Fig. IC). The cap gene encodes the capsid (coat) proteins and rep encodes proteins involved in replication and integration functions [15]. 4 8 8 Murphy and Vile After infection, AAV genomes can persist extrachromosomally in an episomal form [16, 17] or integrate into the cellular genome [18, 19]. AAV has been demonstrated to preferentially integrate into human chromosome 19 at site ^13.4 (AAVSl), directed by the rep genes, facilitating latent infection for the life of the cell [20]. AAV is, however, naturally replication-incompetent and requires additional genes from a helper virus infection, v^hich in nature is generally complemented by Ad or HSV coinfection [21]. AAV-based vectors generally involve replacement of the rep and cap genes v\̂ ith a transgene of interest (Fig. IC), retaining the terminal repeats and packaging sequences essential to direct replication and packaging of the genome [15]. These AAV vectors can be packaged into infectious AAV particles upon complementation of the rep/cap genes and Ad/HSV helper functions in trans. Deletion of the rep genes, however, eliminates targeted integration of the AAV cassettes at AAVSl. The nonpathogenic nature of AAV, having not been associated with any disease or tumor in humans, makes it a potentially powerful clinical vector. D. Herpes Simplex Viruses Herpes simplex virus belongs to the herpesvirus family, a diverse family of large DNA viruses, all of which have the potential to establish lifelong latent infection [22, 23]. HSV consists of 110-nm-diameter particles comprising an icosahedral nucleocapsid, surrounded by a protein matrix, the tegument, which in turn is surrounded by a glycolipid-containing envelope [24]. The HSV-1 genome consists of a giant linear double-stranded DNA molecule of 152 kb encoding 81 known genes, 38 of which are essential for virus pro duction in vitro [24]. First-generation HSV-based vectors involve replacement of one or more of the seven immediate-early (IE) genes whose functions are ^raws-complemented by packaging cell lines [24]. Second-generation HSV- amplicon vectors consist of plasmids containing just the HSV-1 origin of replication (Oris) for replication in packaging cell lines by the roUing circle mechanism, and the cleavage/packaging signal (pac) (Fig. ID). These amplicon vectors can accommodate inserts of up to 15 kb, enabling the assembly of concatemer structures of up to 10 genomes, reconstituting the packaging size of 150 kb [25]. The future construction of "full-size" gutless HSV vectors could accommodate up to 150 kb of insert DNA [26]. E. Lentiviral Vectors Lentiviruses are a subclass of retroviral vectors which have become infamous in world affairs by the HIV family members. LV vectors are charac terized by the presence of additional accessory genes to the gag/pol/env-hased genomes [27]. These accessory genes extend the functions of the viruses, with 17. Hybrid Adenoviral Vectors 4 8 9 the major gene therapy focus being on their abiUty to infect nondividing as well dividing cells, in distinct contrast to other retroviral family members such as MoMuLV. These karyotropic properties of lentiviruses provide a promising tool to direct retro virus-mediated gene therapies to nondividing cells [28]. LV vectors are constructed by an analogous mechanism to conventional MoMuLV vectors. F. The Choice of Gene Therapy Vector No single vector system can presently provide the necessary flexibility for all the possible clinical applications of gene therapy. Vast variabilities exist in vector host range and uptake potentials for the many tissues of the human body, which together with the many biological barriers to reaching the target tissues make a universal vector unlikely. Thus disease-specific gene targeting strategies are likely to be required, involving the development of multiple gene delivery systems. Hence the technology of gene therapy stands to benefit from the vast range of clinical vectors being designed, each system having distinct properties which can complement each other in the clinic. Extensive research has focused on the potential of adenoviruses as transducing viruses for use in gene therapy. The translation of laboratory- derived viral vectors as practical pharmaceutical tools is a major determinant of gene therapy interest in the clinic. In essence, the ease of generating Ad vectors, the efficiency of purification, and the superior titers which can be obtained (>10^^ pfu/mL) have made Ad the vector of choice for many applications of in vivo gene therapy [4]. The rapid technical advances in the construction and purification of alternative viral vector systems has, however, expanded clinical interests. The vastly improved techniques of helper-free AAV production have significantly increased the potential of these vectors. Titers of AAV vectors equivalent to those of Ad vectors are now routinely achievable, which are free of the once problematic helper virus contamination [29]. The production procedures, however, are still relatively laborious and problematic. The comparatively low titers of the MoMuLV-, HSV-, and LV-based vectors, generally greater than 2 logs lower stable titers, limit the effectiveness of these vector systems especially upon translation to the clinic. However, current immune system barriers preclude the beneficial attributes of administration of Ad vectors at their maximal titers, with significant safety concerns apparent with the maximal doses of Ad vectors in the clinic [30]. The generation of large-scale, high-titer vector preparations with stable shelf lives is essential for clinical applications. The stable pharmaceutical prop erties of Ad virions, as well as the similarly encapsidated AAV and HSV virions, present significant advantages over the much less stable enveloped retrovirus- based vectors. The integrative functions of retroviral vectors, however, confer on them the potential of long-term stable expression, fulfilling an additional 4 9 0 Murphy and Vile highly desirable vector property. These integrative functions, together with rapidly advancing methods of enhancing viral titers using concentration proce dures [31], maintain major clinical interest in retroviral vectors. The integrative functions of AAV vectors are also highly desirable, specifically the chromoso mal targeting mechanism in the presence of the Rep protein [32]. The absence of any cellular retention mechanisms for Ad and HSV vectors presents a distinct disadvantage to many gene therapy applications. In the context of tumor erad ication, however, high-titer vector transduction is unlikely to require long-term maintenance of vectors. In deciding the most appropriate vector for treatment of a clinical disorder, the main selection criterion for vector choice comes in the ability of a specific vector to efficiently transduce the target tissue. Ad vectors have a wide distribution of their target receptors dispersed throughout the body tissues. AAV and HSV have similar diverse tropism to most cells in the human body, with HSV-1 vectors having a major selective tropism for neuronal tissues. MoMuLV viruses are, however, severely limited by their dependence on host cell mitosis to enable stable transduction of a cell, limiting their efficacy in quiescent cell populations [33]. These cell cycle restrictions are not apparent with the LV subclass of retroviral vectors, which possess the additional nuclear targeting functions [34], The additional nuclear targeting property of LV vectors, together with the integration functions, has significantly raised the clinical interest in respect of gene therapy. Additionally, the ability of MoMuLV vectors to infect only dividing cells can be deemed an advantage in targeting actively dividing tumor cells which are surrounded by nondividing
normal tissues. The ideal vector system is thus very much dependent on the diseased tissue to be treated. The extent of genetic material that is required to be delivered to a specific tissue is also a major influence on the vector system. Ad vectors offer a wide range of insert potentials from 7 to 8-kb insert capacities for first-generation vectors and up to 36-kb inserts in the "gutless" HD vector system [6, 35]. Whereas the relatively small packageable genome sizes of retroviral vectors (-^8 kb), but more significantly of AAV vectors (~4.5 kb), severely limit their applications to some gene therapy protocols [15], specifically where the delivery of multiple genes or the insertion of large regulatory elements is deemed essential. It is, however, the HSV-1-based vectors that offer the superior transgene delivery potentials with inserts of up to 150 kb feasible in a gutless vector [36]. Additionally, in the alternative HSV-1 amplicon vector system, as well as providing an insert capacity of up to 15 kb, the assembly of concatemers vastly increases the copy number of transgene cassettes being delivered to target cells [25]. The immune system is a perpetual barrier to viral transduction. The compromised state of many diseases would be severely stressed by fur ther immunological effects/inflammation induced by a "therapeutic" vector 17. Hybrid Adenoviral Vectors 4 9 1 challenge. The exception again is cancer gene therapy where activation of local immune responses can be advantageous in tumor recognition and possibly aid in breaking immune tolerance [37]. Viral vectors are designed to exploit specific biological properties of viruses, such as recognition of cell receptors for entry and mechanisms of host genome integration, that have evolved over time in relationship w îth the host. The natural response of the host has, hov^ever, also developed to eliminate disease-inducing viral pathogens. Current strate gies of viral vector design are working to engineer viruses with predictable biological properties, maintaining the biological advantages of the virus that have been selected by nature while reducing the immunogenicity of the viral components. The majority of Ad vector-derived immunogenicity was deemed to be due to the leaky expression of retained viral transcripts in the vector genome [30, 38]. For AAV and HSV amplicon vectors, contaminating helper virus was also deemed highly immunogenic. The more recent improvements in Ad vector design [9-12] and generation of "helper-free" packaging systems for AAV and HSV amplicon vectors [29, 39] has stunted this immunogenicity to some extent. However, the immune system still stands as a major barrier to gene-therapy efficacy. The mere physical presence of the virus can induce significant cytopathology. The current requirement of repeated administration to boost expression levels further augments the immune memory responses to the presence of the virus until eventual complete immunity is developed to the applied vector [40]. The power of the immune system is emphasized by practically 95% of Ad virions being eliminated by the natural nonspecific innate immune response on each administration [41]. G. How to Maintain Stable Transgene Expression The transient natures of Ad and HSV-1 vectors, as well as the rapid loss of transgene expression upon stable integration of AAV and RV vectors due to nuclear effects on the transgene cassettes, have dramatically limited the efficacy of each vector system. Hence the question remains: how do we maintain stable transgene expression following recombinant viral vector transduction.^ One solution may come from looking closer at the wild-type mechanisms of preservation evolved by the parental viruses. Viruses have developed diverse mechanisms of self-preservation and maintenance to enable them to infect cells and direct self-replication and propagation. Mechanisms of maintenance vary according to the life cycle of the virus. Viruses such as retroviruses have developed life cycles that live in harmony with the host cell. They utilize the host cellular machinery to enable continuous shedding of the virus and thus require stable preservation of the viral genetic material. Retroviruses facilitate this function by stable integration into the host genome, permitting continuous replication/maintenance of the viral genome in the context of host cell replication [1]. Conversely, lytic viruses 4 9 2 Murphy and Vile such as adenoviruses subvert the host's cellular functions solely for their ow n̂ preservation. Infected cells become short-term factories of virus production, amassing viral particles until host cell saturation is achieved and cell lysis occurs in less than 36 h [5]. The short-term association of virus and host does not therefore necessitate mechanisms for long-term persistence of the viral genome. The Ad genome is thus maintained extrachromosomally w îth a very efficient mechanism of replication to enable large-scale genome packaging into the vast numbers of viral particles generated. Herpes viruses, such as HSV, Epstein-Barr virus (EBV), and cytomegalovirus (CMV), have developed more complex mechanisms of self-preservation [42]. Upon infection, a lysogenic life cycle enables the virus to live in harmony with the cell, maintaining the genome in an extrachromosomal state, w^here methylation and histone binding to the viral genome keep viral gene expression essentially quiescent [22]. The sv^itch of the life cycle from the quiescent latent state to the major virulent lytic phase, upon signals of cell stress, rapidly reveals the viral presence. This terminal lytic stage of rapid viral genome reproduction and mass assembly of virions enables the virus to rapidly multiply and abandon the host. The AAV life cycle is a further intriguing evolutionary mechanism, being naturally dependent on helper Ad or HSV coinfection to effect lytic AAV virion assembly and viral progeny release. In the absence of such helper functions, AAV remains lysogenic by either stable integration into the host genome or independent episomal replication in the infected cell [14]. II. Hybrid Viral Vectors The inadequacies of each viral vector system are illustrated in Table II. The negative attributes of one vector, however, generally emphasize the positive attributes of another. Thus most of the criteria defined for a hypothetical perfect gene therapy might actually be met by considering defined properties of the currently available vectors defined in Table II. Hence, although at present no individual virus system alone can meet all the criteria, current research is focusing on combining individual viral properties into single vector constructs, termed "hybrid" or "chimeric" vectors. Adenoviral vectors are currently the major vector choice for a variety of clinical disorders, despite the limited efficacy due to the transient nature of the vector. Mechanisms of enhancing the pharmaceutical properties of Ad vectors are thus highly desirable. The incorporation of other viral vector functions that could enhance the duration of Ad-directed transgene expression and/or target the vectors to a specific disease tissue would be extremely beneficial. In essence, whether the aim is to kill or cure the target cell, a vector encompassing the advantageous properties of high titer, broad host range, and infectivity of an Ad vector, together with the low immunogenicity and potential for long-term 17. Hybrid Adenoviral Vectors 4 9 3 stable expression of a retrovirus, AAV, or EBV vector v^ould be extremely useful for gene therapy for a wide range of genetic and acquired disorders. Hence the main focus of this chapter is to review the properties of other viral vectors which have been utilized to generate hybrid adenoviral vectors in the aim of enhancing vector efficacy in the clinic. A. Are Hybrid Vectors Truly New Technology? The formation of hybrid adenoviruses is not a new technology and has been extensively reported to occur naturally in nature. Adenoviral/simian virus 40 (SV40) hybrids have been documented to occur in nature [43, 44]. Although human adenoviruses do not normally replicate in primate cells, upon coinfection with SV40, Ad genomes acquired sequences from the SV40 genomes (large T antigen) which permitted replication and assembly of hybrid genomes into wild-type Ad capsid particles [43]. Additionally it may be that the helper-dependent AAV genome represents a segment of an extinct or undiscovered virus that was selected upon coinfection with an Ad or an HSV. Perhaps the parental virus was too virulent to coexist in a human host, thereby explaining the nonpathogenic nature of the dependovirus. The development of hybrid viral vectors is fundamentally not a new technology in gene therapy. Since the dawn of gene therapy, scientists have utilized alternative as-acting sequences from other viruses, specifically pro moters and enhancers, to drive transgene expression. Most significantly, the cytomegalovirus (CMV) immediate-early promoter and enhancer has been utilized in almost every viral vector reported to date and is well characterized as an extremely strong constitutive promoter in most tissues [45, 46]. Other well utilized viral promoters have included the Rous sarcoma virus (RSV) LTR promoter, the SV40 early promoter, hepatitis B virus (HBV), and the EBV promoter [45, 46]. Additionally, application of the picornaviral func tions of "cap-independent" initiation of translation has also been extensively exploited in viral vectors. These translational regulatory elements, termed internal ribosomal entry site (IRES) sequences, enable bicistronic expression from a single mRNA transcript [47]. The application of these elements greatly complemented the limited insert capacities of viral vectors, thereby negating the need for separate promoters to drive two transgene cassettes. Retroviral vectors have been studied in hybrid vector systems since the early 1980s, "pseudotyping" them with functions from other retroviral vectors. Specifically heterotropic viral glycoproteins from other retroviral env genes have been stably incorporated into MoMuLV vector particles. The incorporation of vesicular somatic virus G (VSV-G) glycoprotein [48], gibbon ape leukemia virus (GALV) and HIV-1 glycoproteins [49] into murine leukemia virus particles has been reported. These hybrid MoMuLV virions attain the tropism of the pseudotyped env proteins, retargeting or broadening the host 4 9 4 Murphy and Vile range of the MoMuLV vector. Additionally, incorporation of VSV-G env has been demonstrated to increase the stability of the virions, enabling higher titer-yielding purification techniques to be applied [50, 51]. Hybrid retroviral vectors have also been constructed, incorporating different c/s-acting elements contained in the U3 region of the LTR, w^hich direct the transcriptional activity of the virus. Replacement of these U3 regulatory elements can impart tissue- specific transcriptional activity on the RV vector [52, 53]. Hence the concept of hybrid vectors is not a new^ technology, but the nev^ strategies proposed could vastly expand the repertoire of viral vectors available to the clinic. III. Hybrid Adenoviral Vector Systems A number of hybrid adenoviral vector systems have been reported in the literature, combining the properties of RV, AAV, and EBV vectors, as w êll as elements of other Ad serotypes, to enhance the therapeutic efficacy of Ad vectors in vivo. The principal aim of these new^ hybrid vectors is to overcome the limitations of transient Ad vector retention in infected cells. In addition to the w^ell-documented limitations of Ad vectors (Table II), some initially perceived advantageous properties of Ad vectors do actually limit their effectiveness toward therapy for some diseases. The broad host range of Ad vectors induces significant disadvantages v^hen tissue targeting is required and compromises systemic administration. Additionally, the \ow pathogenicity of adenoviruses in humans has resulted in many serotypes, including the conventional vector strains of Ad2 and Ad5, being endemic. Hence a potent natural anti-adenoviral immunity is fashioned generally at a very early age. The highly immunogenic nature of the proteinous Ad virion further confounds the system, v^ith a rapid and highly effective host humoral response being developed to the Ad vector. Research is thus being channelled into both retargeting Ad vectors to specific tissues and silencing the structural immune stimuli to facilitate enhanced Ad vector transduction. A. Pseudotyping and Retargeting Adenoviral Vectors As targeting and humoral immunity are connected in essence to the same surface moieties of the Ad particles, both disciplines are fundamentally interlinked. Methods applied to limit the humoral responses have focused on two main strategies: application of alternative "immune silent" Ad serotypes or display of alternative ligands on the surface of the virions, which is also the major strategy for retargeting the vector. The use of alternative serotypes enables the consecutive application of immunologically distinct Ad particles, enabling avoidance of specific humoral responses to previously applied vectors [54, 55]. This system has presented some success in vivo [56]., although the presence of cross-reacting antibodies 17. Hybrid Adenoviral Vectors 4 9 5 is problematic due to the evolutionary similarities of Ad serotypes. The application of alternative Ad serotypes w îth different surface markers also provides a mechanism of alternative targeting, as different serotypes possess tropism for different tissues in
the human body. For instance, the conventional gene therapy subtypes Ad2 and Ad5 have natural tropism for the gut epithelial layer. Hence, in terms of gene therapy for cystic fibrosis, initial vectors proved disappointing due to their low infectivity of the airv^ay epithelia. To overcome this restriction, Zabner and colleagues investigated other Ad serotypes for airway epithelia tropism [57]. A number of other Ad serotypes, specifically Ad 17, were found to infect the airway epithelia with increased efficiency to wtAd2 [57], They therefore proceeded to generate Ad2 hybrid vectors pseudotyped with the Adl7 fiber, where the endogenous Ad2 fiber gene was replaced with the Ad 17 fiber gene. The resultant chimeric vector displayed increased efficiency of binding and gene transfer to well differentiated human epithelial cells. A similar study by Croyle and colleagues demonstrated that wild-type Ad41 had enhanced transduction properties in intestines compared to Ad5 [58]. These studies emphasize the potential of alternative Ad serotypes with tropism for different tissues in the human body. Pseudotyping also provides an invaluable mechanism of integrating alternative serotype fiber (and/or penton base) genes from other Ad serotypes into the currently well- researched Ad vectors, without having to reconstruct the vector backbones. The use of nonhuman adenoviruses as vectors for gene therapy is also under investigation, with bovine, ovine, canine, feline, and avian adenoviruses being researched [59-62]. As well as being potentially unexposed to the immune system, they may also have specific tropism for selective tissues in humans. The potential of pseudotyping nonhuman Ad vector components with conventional human Ad vectors is therefore of interest. The use of targeted viral vectors to localize gene therapy to specific cell types introduces significant advances over vectors with conventional natural tropism. As well as the safety aspects of reduced immunogenicity and toxicity, the reduced uptake by nontargeted cell types may enable application of systemic delivery with feasible viral titers and loads. In order to retarget Ad vectors, first the natural tropism of the virus must be removed and, second, novel, tissue-specific ligands introduced [63]. Two main mechanisms have been used to retarget Ad vectors. First, the use of external molecules with affinities for both the Ad surface structural moieties as well as a cell-type-specific surface ligand. These bispecific molecules act as bridges between the virions and the cell. A neutralizing antibody or high-affinity peptide for the fiber or penton base can act as the Ad-binding moiety, which can be covalently linked to a high-affinity ligand for a tissue-specific receptor [63]. A drawback of the bridging molecule approach is that native receptor binding is never 100% blocked. To truly block native Ad binding to its cognitive receptor, removal of the intrinsic receptor binding domains is required. 4 9 6 Murphy and Vile A second approach involves creation of hybrid Ad vectors, pseudotyped w îth novel receptor recognition functions. Genetic modification of the Ad genome by incorporating targeting ligands inside the genome, while deleting or ablating sequences of the penton and fiber involved in receptor recogni tion, has been reported. High-affinity peptide motifs have been subsequently demonstrated to be functionally incorporated into Ad particles. These "proof- of-concept" studies focused on the incorporation of ligands w^ithout ablating natural receptor interactions and resulted in expanding the vector tropism, which has proved beneficial in vivo in transducing both vascular smooth mus cle and some tumor types [64-66]. Future studies will focus on honing the targeting functions to specific cell types. High-affinity ligands have been stably inserted into the HI loop or on the C-terminus of the fiber or into the integrin- binding RGD domain of the penton base [63]. However, the size, location, and type of ligand to be inserted are currently under debate and remain to be deter mined. Wickham and colleagues demonstrated 10- to 1000-fold reductions in transduction of cells expressing the coxsackievirus and adenovirus receptor (CAR) with CAR-ablated vectors [63], the residual transduction being penton- base-mediated, emphasizing the requirement for additional ablation of penton base binding [63]. The further requirement of novel packaging cell lines to facil itate infection and propagation of the CAR/integrin-binding ablated particles also remains an issue. B. Adenoviral/Retroviral Hybrid Vector Technologies A hybrid vector system incorporating the advantageous long-term stable integrative functions of retroviral vectors into adenoviral vectors could provide a major clinical advancement to gene therapy. Hybrid vector systems are thus being investigated, incorporating retroviral components into the backbones of adenoviral vectors. Initial studies have focused on utilizing adenoviral vectors as directors of retroviral vector production, delivering the gag^ pol, and env genes as well as retroviral LTR cassettes to cell populations both in vitro and in vivo. Conventional retroviral packaging cell lines are stably transformed with gag^ pol, and env functions and release retroviral particles upon plasmid transfection of a retroviral LTR transgene cassette [2]. High-titer retroviral stocks of greater than 10^ infectious units (iu)/mL can now be obtained from conventional stable producer cell lines [3]. To achieve the highest vector titer, it is necessary to select clones of vector-transduced cells individually due to the varying titers of producer cell clones [67]. Direct injection of retroviral vectors in vivo has, however, yielded limited efficiencies due to the limited transducing titers and poor infectivity. Application of retroviral vectors in the clinic has thus focused on ex vivo protocols. This involves the removal of patient tissues, which can be cultured for a brief period in the laboratory, transduction with the RV vector, and reimplantation back into the patient. The ex vivo approach has 17. Hybrid Adenoviral Vectors 4 9 7 yielded some success, although the procedure is cumbersome and costly, and in most cases, it can only transduce a small fraction of the target cells [68, 69]. The establishment of retroviral producer cells in situ provides a further mechanism of enhancing the efficacy of retroviral gene therapy. Transient transfection of target cells in vivo v^ith the retroviral vector and packaging plasmids, previously used to generate producer cell lines in vitro^ by direct DNA injection has been reported [70]. Although stable integration of subsequently generated retroviral particle genomes could be detected, the efficiency w âs very lov^. The implan tation of retroviral producer cell lines into patients has presented a far greater potential for the in situ production of retroviral vectors. Gene therapy using MoMuLV-based producer cells to treat brain tumors [71] has been carried out in a clinical trial, but no clear clinical benefit has been reported to date. The infectivity of Ad vectors both in vitro and in vivo provides great potential in increasing the efficiencies of retroviral production technology. The group of David Curiel pioneered the development of hybrid retrovi ral/adenoviral vectors by using the infectivity of adenoviral vectors to efficiently deliver the requisite retroviral packaging and vector functions to target cells in vivo^ thereby rendering them retroviral producer cells in situ (Fig. 2). The sub sequent release of high local concentrations of retroviral particles in situ v^ould enable stable transduction of neighboring tissues, for the transient period of adenovirus transduction. The Ad/RV hybrid system reported by Feng and col leagues utilized a tvs^o-adenovirus delivery strategy [72]. The first adenovirus contained an LTR-flanked retroviral vector cassette encompassing the GFP marker and neomycin resistance genes: Ad/RV-vector. The second adenovirus contained the replication-defective retroviral helper machinery, carrying the gag^ pol, and env genes of MoMuLV: Ad-gag/pol/env. High-titer adenoviral vectors could be generated containing the RV cassettes, w^hich could efficiently direct the in vitro packaging of RV particles at titers similar to conventional packaging cell lines [72, 67]. These studies clearly demonstrate the compati bility of both the adenoviral and the retroviral life cycles in the context of a hybrid vector configuration. Upon infection of cells in vitro w îth the Ad/RV vector alone, high initial levels of GFP expression v^ere observed but gradual loss of expression w âs documented over a period of 60 days as the nonintegrated adenovirus v^as lost from dividing target cells. Conversely, upon application of both adenoviruses to cells in vitro, GFP expression was persistent for extended periods of time. How^ever, the persistent level of gene expression w âs reduced beyond the time at v^hich expression could be solely attributed to the Ad/RV vector. The stable integration of the retroviral cassette in surrounding cells was believed to be responsible for this extended expression. The longer term GFP-expressing cells in cultures transduced with both Ad vectors, were present in clustered outgrowths, suggesting local retroviral spreading and/or clonal origin. Subsequent demonstration of proviral integration was confirmed by the 498 Murphy and Vile \| l T R \| ¥ i ^ ^ ; J }.'• Adbetmm '': • ' \|ITR\| 1ITR1 'P \;\ 'MI0^X • M Genome ITR\| 1 ITR\| W lIlTraasi^aeli.i, .3 •:7:liM!(^^t<m-L^.. MITR] Ad Gag/Pol Ad LTR-Transgene AdEnv Ad Infection and Nuclear Delivery Producer Cell RV Particles Figure 2 Hybrid-Ad/RV vector-mediated production of RV particles. Hybrid adenoviral vectors expressing the gag/pol and env RV genes either together or on split adenoviral constructs (as shown) are coinfected with the Ad-LTR transgene vector into cells in vitro or in vivo. Subsequent expression of the gog/pol and env genes in the cells establishes in situ retroviral producer cells which direct the packaging of the expressed retroviral genonnes. RV particles expressing the transgene cassettes subsequently bud from the cells and are released into the surrounding environment. presence of retroviral transgene sequences in high-molecular-weight cellular DNA [72]. No replication-competenet retroviruses (RCRs) were detected v^ith the Ad/RV chimera, despite the large genome copy numbers associated w îth adenovirus production in vitro [72]. 17. Hybrid Adenoviral Vectors 4 9 9 The ex vivo efficacy of the Ad/RV hybrid vector system was investigated by transducing the ovarian carcinoma cell line SKOV3 in vitro with the Ad/RV vector alone or in combination with the kd-gaglpollenv vector at an m.o.i. of 50 pfu/cell. The infected cells were then mixed at a ratio of 3:1 with uninfected SKOV3 cells and subcutaneously implanted in athymic nude mice to allow tumor formation. Tumors were assessed 20 days posttransplantation for GFP expression. Large expansive clusters of GFP-expressing cells were observed only in tumors treated with both vectors. Further in vivo studies involved direct intraperitoneal injection of 5-day-old established SKOV3 tumors in nude mice (1 x 10^ cells) with the single- or two-adenoviral strategy (1 x 10^ pfu/mouse). Sixteen days post-Ad infection, the two-virus-treated tumors were observed to have islands of GFP-positive cells (10-15% transduction), consistent with secondary retroviral transduction. In contrast, single virus- treated tumors revealed very limited (<1%) GFP-positive cells. This pioneering study thus established the great potential of hybrid Ad/RV vectors, whose pros and cons are presented in Table III and discussed further in the concluding remarks of this chapter. Following the initial proof of concept, a number of other laborato ries have further investigated the concept of Ad-mediated establishment of retroviral producer cell lines in situ, Duisit and colleagues in collaboration Table III Pros and Cons of Hybrid Adeno-/Retroviral Vectors for Gene Therapy Pros • Exploit high-efficiency adenoviral infection to deliver retroviral assembly machinery • Utilize stable high titer adenoviral vectors • Increase the duration of biological activity of delivered transgene • Avoid initial limitations of retroviral infectivity to nondividing tissues • Utilize adenoviral vector tropism • Therapeutic gene expressed by retroviral cassette will still be expressed in context of sole delivery of the Ad-RV cassette vector • Initial burst of transgene expression can be converted to a stable low^er level expression • Delivery deep into cell layers Cons • Progeny retroviral vector can still only infect dividing cells • In situ released retroviral vector limited according to RV infectivity and tropism • Requires codelivery of two or more adenoviral vectors • Risk of RCR • Safety? • Rescue of endogenous retroviral elements • Interactions with host cell functions? • Diffusion may still be very limited around the initial needle tract • In situ titers of retroviral particles may be limited • Different cells have different intrinsic potentials for retrovirus production 5 0 0 Murphy and Vile with Fran^ois-Loic Cosset, reported on an extension of the hybrid vector system [67]. These studies further restricted the potential for RCR by sep arating the gag/pol core particle-expressing elements from the env surface glycoprotein gene, which they supply on a separate Ad vector (Ad-gag/pol and Ad~env; Fig. 2), to minimize retroviral sequence overlaps. Additionally, in the context of pseudotyping retroviral vectors, they replaced the
natural MoMuLV env gene with the gibbon ape leukemia virus (GALV) env gene. In small-scale pilot experiments, TE671 cells simultaneously infected with the three Ad vectors efficiently released helper-free retroviral particles at titers of up to 5 X 10^ iu/mL for at least 3 days following infection [67], The further separation of the key retroviral elements facilitated the indi vidual characterization of each retroviral function in terms of variable copy load on complementing retroviral cell lines. The results helped to shed light on the factors currently limiting retroviral vector production and allowed an investigation of particular cell type-specific features of the producer cells. The availability of packageable RNAs of the retroviral genome itself was not found to be rate limiting, with Ad-mediated overexpression resulting in increasing, nonsaturatable retroviral titers [67]. The results indicated that high expression of Gag-Pol and Env proteins through the introduction of high copy numbers of their genes was not required to achieve an efficient retroviral production and that there is probably a limit to the number of particles that a given cell may release. Increased GALV env copy number resulted in augmented glycoprotein synthesis, with RV particle production plateauing between m.o.i.s of 10 and 50. At higher m.o.i.s titers decreased, possibly by a break of tolerance by the cell to efficient RV particle assembly or budding. It was observed that Pr65 gag precursor expression saturated with Ad-gag/pol m.o.i.s of greater than 5 [67]. At higher titers, premature maturation of Pr65 transcripts became apparent, which normally occurs at maturation of the retroviral particles [73]. However, despite these observations, reported titers were equivalent to those generated on high titer-generating stable packaging cells [67]. A detailed analysis of the release of noninfectious/incorrectly processed budding particles may be of interest. Additionally, despite the expression of similar levels of Gag precur sors and premature forms, a wide variability was observed in the capacity of different cell types examined to assemble and release retroviral particles [67]. In the context of the hybrid adenoviral/retroviral vector system, when applied at optimal m.o.i.s, a critical limiting factor for the production of retrovirus is the ability to avoid premature activation and convert the bulk of Gag and Gag-Pol precursors in nascent viral infectious particles [67]. Despite the high copy number of all three retroviral units introduced into cells, no RCR could be detected. These Ad/RV hybrid vector studies go some way in aiding the elu cidation of the limiting factors involved in retroviral production in packaging cell lines and they indicate that the careful selection of packaging cell type is crucial. This observation is highly significant to therapeutic applications of the 17. Hybrid Adenoviral Vectors 5 0 1 hybrid vector system where different tissues of the body will be more suited to RV complementation than others. The hybrid Ad/RV system can also facilitate the rapid screening of various primate cells for their retroviral production potentials and allows simple substitution/pseudotyping of components in the system. 1. Tetracycline-Inducible Env Pseudotyping of Ad/RV Hybrid Vectors Pseudotyping the VSV-G retroviral envelope in the MoMuLV back bone, as discussed earlier, enhances the stability and tropism of the native virus [31]. This enhanced stability enables higher titer preparation to be prepared by centrifugation. Generating Ad vectors expressing the VSV-G envelope glycoprotein has, however, proven technically difficult due to the cytotoxic nature of the protein product. Yang and colleagues demonstrated that the VSV-G gene could be effectively controlled under the tetracycline inducible system [74] in packaging cell lines obtaining unconcentrated titers of 10^ to 10^ iu/mL [75], Yoshida and colleagues extended these studies by applying the tetracycline-inducible system in the context of an Ad vector [76]. Ad vectors were generated carrying VSV-G and MoMuLV gag/pol genes, both under the control of the tetracycline-controllable promoter. Hence, only upon the supply of doxycycline (a tetracycline homolog) efficient expression would proceed from the gag, pol, and env genes. Minimum "leaky" expression of cytotoxic VSV-G under the control of the inducible promoter remained low enough to allow Ad propagation to titers of 4 x 10^ pfu/mL. The drawback of this system is the necessity to provide a further Ad construct containing the tetracycline transcriptional regulator (Ad-rtTA), expanding the system to a four-adenovirus transduction strategy, together with Ad-TetGag/Pol, Ad- TetEnv, and the Ad/RV vector expressing neomycin resistance. Application of the four viruses in vitro generated retroviral transgene titers of up to 5 X 10^ iu/mL, which were further purified to titers of >10^ iu/mL following simple centrifuge concentration of the virus from culture fluids at 50-80% recovery efficiency [76]. Caplen and colleagues extended these studies in two tumor model systems in vivo by subcutaneous injection of 9L glioma tumors in rat or human A735 melanoma xenografts in nude mice [77]. Only upon application of all four viruses in the 9L rat model were neomycin-resistant cell cultures established from harvested tumor tissues. Molecular analysis of genomic DNA extracted from neomycin expressing 9L rat cultures, derived both in vitro and in vivo, showed the appropriate integration of the retroviral transgene cassette [77]. The human-xenograft nude mouse model system meant that Ad was not cleared in the time frame examined (4 weeks); hence efficacy was assessed as increases in G418R cells compared to single-hybrid Ad/RV-vector transgene transduction [77]. In the human-xenograft mouse model system, tumors har vested at 1, 3, and 4 weeks posttransduction displayed increased numbers 5 0 2 Murphy and Vile of neomycin-resistant colonies with time only upon transduction of the full complement of adeno-retroviral constructs. At 4 weeks, up to 7.2% of xenografted cells were retrovirally transduced. Transduction of tumors with Ad/RV vector alone yielded no increase in the number of neomycin-resistant clones. DNA extracted from the xenograft tumors, as for the rat model, only showed the presence of integrated proviral sequences when transduced with the full complement of adeno-retroviruses. Titers of retrovirus particles generated from the 9L rat glioma cells in vitro were dependent on the input m.o.i. of the adenoviruses, with maximum titers of up to 1 X 10^ iu/mL generated at m.o.i.s in the range of 200-300 for each virus [77]. Under these optimal conditions the presence of doxycycline (1 \|JiM) enhanced the titers by a factor of 2000-fold [77]. Interestingly, in vivo similar numbers of clones were observed after the four-adenovirus transduction strat egy in the presence or absence of doxycycline: 30 and 20 colonies per 10^ cells plated. Less than one colony per 10^ plated cells was observed with the Ad/RV vector alone. These low transduction titers do, however, indicate the current inefficiencies of the system, which are reduced compared to other reports [72]. But the inefficiencies can to some extent be explained by the application of four separate Ad vectors for the system to function, significantly increasing the kinetic complexity of the generation of retroviral vector producer cells in vivo. Additionally, the poor efficiency of transduction of the rodent cells by Ad is emphasized by the required m.oi.s applied (>200) to generate optimum titers [77]. 2. Cooperative Adenoviral/Retroviral Vector Delivery Other mechanisms of combining the advantageous properties of ade noviral and retroviral vectors have involved combinatory application of the separate vectors. Delivery of the retroviral genome in the context of a retroviral particle (RV vector) coinfected with an adenovirus expressing the gag, pol, and env genes (Ad-gag/pol/env) has been reported [78]. Coinfection of the vectors into NIH 3T3 cells generated retroviral titers >10^ iu/mL. The advantages of this system over the hybrid Ad/RV-vector delivery of the transgene cassette are questionable, specifically from a cell-targeting aspect. Several groups have also recently demonstrated stable ecotropic retrovirus-mediated gene transduction of human cells using preinfection of Ad or AAV vectors expressing an ecotropic receptor [79-81]. In order to target retroviruses specifically to malignant hepatic tissues, an adenovirus expressing the ecotropic receptor under the control of a hepatoma-specific promoter [82, 83] was constructed. Although tissue-specific expression of the retroviral ecotropic receptor and subsequent tissue-specific targeting of ecotropic enveloped retroviral vectors was demonstrated in vitro [84], the clinical benefits of this system are limited. In essence, direct application of the tissue-specific promoter to expression of a therapeutic transgene in the adenoviral vector would be more beneficial. 17. Hybrid Adenoviral Vectors 5 0 3 3. Nonspecific Integration of RV LTR Cassettes in the Context of Ad Vectors? The studies presented above all emphasize the requirement of all the gag/pol and env components to derive stable integration of a RV LTR- flanked transgene cassette. However, a controversial report printed in Nature Biotechnology challenged that doctrine. Zheng and colleagues reported that an RV LTR-flanked cassette contained in an Ad vector (Ad/RV-vector) could integrate efficiently in the absence of the retroviral enzymatic proteins [85]. The group studied a conventional MoMuLV LTR-flanked luciferase reporter gene cloned in the El-deleted region of a first-generation Ad vector (AdLTR-Luc), analogous to previous hybrid Ad/RV-vectors. A variety of cells and tissues permissive to Ad infection (epithelial cells, macrophages, and hippocampal cells) were transduced in vitro and in vivo by the hybrid AdLTR-Luc, and compared with transduction by AdCMV-Luc, a vector containing the CMV promoter in place of the LTRs. The AdLTR-Luc vector was demonstrated to direct sustained luciferase expression compared to the CMV promoter-driven vector. Despite probable well-documented CMV promoter inactivation events, the authors present evidence for stable integration of the LTR-Luc cassette at sites within the LTR elements by a mechanism independent of classical retroviral integration. Fluorescence in situ hybridization (FISH) analysis using probes for the 5' LTR and the luciferase gene revealed integration of the AdLTR-Luc vector with an apparent frequency of 10-15% in vitro and 5% in vivo. Southern blot analysis also implied integration of the 5' LTR of the hybrid vector, which was subsequently supported by sequencing of the region adjacent to the 5' LTR integration site. No integration of the AdCMV-Luc was reported. The frequency of spontaneous Ad integration has previously been reported at much lower frequencies (10~^ to 10~^) [86], suggesting the presence of the retroviral LTR elements in the AdLTR-Luc somehow potentiates integration. The major question is whether an endogenous retrovirus is present in these cells; however, the authors reported negative results for reverse transcriptase activity. Additionally, the integration events reported are not classic retroviral integration as integration does not proceed at a conserved terminal position and results in the random loss of substantial terminal LTR sequence. In vivo studies involved injection of rat submandibular glands by retrograde ductal instillation of 1 x 10^ pfu/gland. After initial high luciferase expression, the levels plunged to near zero for AdCMV-Luc after 9 weeks but stabilized with AdLTR-Luc after 2 weeks, although at significantly reduced levels. Although these findings are consistent with low-level integration of the LTR cassette, no specific mechanism of integration has been proposed and alternative inter pretations of nonspecific LTR-independent mechanisms are probable. As no drug selection gene was present in the vectors, clonal populations were derived on the basis of sustained luciferase expression. Hence, considering first the 5 0 4 Murphy and Vile well-documented in situ inactivation of CMV promoters, specifically in the context of integration, luciferase expression would be absent in long-term cul tures transduced with AdCMV-Luc. Therefore, the studies with AdLTR-Luc may have inadvertently selected for random integration events within the 5' LTR that maintained luciferase expression. The probability of such an event is fairly significant considering the limited extent of genetic material upstream of the LTR cassette in the Ad vector (ITR and \\|;). Additionally, with the high m.o.i.s applied, selection of high copy number-transduced cells is highly prob able, under which conditions spontaneous integration of the Ad vector is more probable. The sequencing data presented also demonstrate integration occur ring at sites within the U3 region of the 5' LTR for several clones that would ablate LTR promoter activity. The selection of these luciferase-expressing cells would more probably be due to multiple integration events, which were clearly demonstrated by FISH analysis [85], rather than integration site promoter effects. Integrated proviral sequences were not reported in animals that received the Ad/RV vectors alone in other similar studies [72, 77]. However these reports were looking specifically for retrovirus-mediated integration events and not the proposed alternative mechanisms reported by Zheng and colleagues [85]. The report by Caplen and colleagues [77] investigated the integration event based on the retroviral mechanism of reproducing the 3' LTR sequences to the 5' LTR structures [1]. The specific duplication of a
nucleotide restriction site upon retroviral replication was used as a marker of integration in Southern blot analyses. Analysis of a pooled population of neomycin-resistant colonies revealed efficient band size switching, indicative of the duplication event, and thus retroviral replication. However, consistent with the observation of Zheng [85], randomly integrated Ad-RV transgene cassette fragments could be seen in context of generalized hybridization of the probe to high-molecular- weight DNA from single-vector-transduced animals [77]. These bands were, however, weak and consistent with random integration. Further studies are therefore merited to evaluate the efficacy of integration of LTR-flanked cassettes in the context of an Ad vector to determine whether a specific mechanism does exist and whether it could be further refined for vector use. 4. Integration of Closed Circle Retroviral Cassettes Delivered by Adenoviral Vectors Following retroviral infection, reverse transcribed proviral DNA serves as a substrate for an integration reaction catalyzed by the retroviral integrase (Int) protein, which, along with viral Gag proteins, forms the preintegration complex [87]. This complex brings the 5' end of the 5' LTR (the U3 region) into close juxtaposition with the 3' end of the 3' LTR (the U5 region) [87]. The direct substrate for Int is most likely a linear, double-stranded molecule with blunt ends [88]. Int-mediated integration then occurs by a very precise mechanism 1 7 . H y b r i d A d e n o v i r a l Vectors 505 in which the terminal two base pairs of each LTR are lost prior to integration into the target cell genome [87, 89]. However, closed circular molecules have also been detected in the nuclei of retrovirally infected cells, which contain 2 LTRs joined covalently together at the so-called circle junction [87,90, 91]. Although there is considerable evidence that MoMuLV probably does not use a 2-LTR circle as the principal integration intermediate [S7^ 89, 92], it was hypothesized that it may still be possible for Int to use such a molecule as a template for integration if it were the only, or predominant, species delivered into the nucleus [87]. This hypothesis is supported by the existence of the 2-LTR circles in MoMuLV-infected cells [90] and evidence from the spleen necrosis virus (SNV) system that the LTR junction fragment can be an effective substrate for integration [91]. We investigated whether a 5' LTR-3 ' LTR junction fragment, in a closed circular DNA molecule excised from an incoming plasmid by Cre recombinase and in the absence of the preferred, linear viral DNA molecules, could be recognized by the retroviral integration machinery (Fig. 3). A fused LTR LTR Junction ITR 4 ^ ! ITR LoxP LoxP \ / Cre \ / Recombinase. \ / Genomic DNA Figure 3 Genomic integration of on adenovirolly delivered retroviral circular provirus cassette. A LoxP-flanked cassette containing a fused terminal LTR junction and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. The fused LTR junction contained in this circular proviral molecule is subsequently recognized by retroviral Integrase, directing integration into the host chromosome. 5 0 6 Murphy and Vile junction fragment was thus cloned, containing the entire 3' LTR and just 28 bp of the U3 region of the 5' LTR (Fig. 4A). This LTR junction together with the puromycin resistance gene was flanked by LoxP sites and was demonstrated to efficiently excise a circular proviral intermediate in vitro upon supply of Cre recombinase in trans [93]. Further studies in cell lines ^m^s-complementing gag/pol gene functions, together with Cre recombinase, generated long-term neomycin-resistant clones. Genomic DNA extracted from stable clones was used to investigate the proviral integration structures by utilizing a panel of diagnostic PCR primers. The PCR demonstrated that integration following plasmid transfection, Cre excision, and puromycin selection for >1 month can produce a very specific molecular structure which is distinct from that produced by random plasmid integration. PCR results demonstrated that the 5' and 3' LTRs, which are adjoining in the plasmid backbone, become separated by the intervening sequences of the retroviral vector genome (between the loxP sites). A molecule is thus generated in which the proviral genome is now bounded by the LTRs in a manner typical of Int-mediated integration (Fig. 3). Critically, the terminal two base pairs of both the 5' LTR (U3 region) and the 3' LTR (US region) were lost (Fig. 4B). Hence these studies confirm that a circular retroviral genome with terminally fused LTR structures can indeed serve as a substrate for the retroviral machinery. From this initial proof of concept, the LoxP cassette was subsequently assembled into an El-deleted Ad vector. The Ad virus is used to deliver the LTR junction fragment into the nuclei of cells; the proviral-like intermediate can then be excised from the Ad genome by the Cre/lox system and forms a template for Int-mediated integration. This hybrid Ad/RV system thus has the high transient titer of Ad vectors, does not depend upon cell division for infection, and leads to long-term gene expression via integration of a proviral transgene cassette. Delivery of the Lox-Puro-Junc.-Lox cassette in an Ad vector, in the presence of Cre and Gag and Pol allowed cloning of cells which are resistant to puromycin for long periods in culture. Without Cre, such clones were impossible to obtain. Moreover, these clones contain a molecular structure consistent with proviral integration by PCR and contain integration sites which, for the majority of the clones (seven of nine), are typical of Int- mediated, rather than random, integration processes (Fig. 4B). Codelivery of three separate Ad vectors, Ad-Gag/Pol, Ad-Cre, and Ad.LTR.Junc, was also able to produce long-term integrants. Therefore, we are currently optimizing the design and use of this novel hybrid vector system into a single, or double. Ad delivery system. Recent experiments have shown that Pol-expressed Int alone is sufficient to drive the integration of the Cre-excised proviral form in vitro without the need for additional Pol or Gag proteins. An Ad vector was thus cloned incorporating the Int gene in the same cassette as the transgene cassette to enable a two-vector transduction strategy, which is currently under investigation in our laboratory. This novel hybrid vector system presents great 17. Hybrid Adenoviral Vectors 507 3'LTR fi;'l.TR ^ U3»R»U5 1 1 U3-R»U5 TTCATT AATGAA " " - • > < — CCCGTCAGCGGGGGTCTTTCATTAATGAAAGACCCCACCTGTAGGTT 3'LTM 5'LTR 1 •U3"R>»U5 1 dlJi " • " " t 28bp ^ LTR FUSION JUNCTION Clone 1 CCi:ACAGGTGGGGTCriTCA GmCTTCM£mG Clone 2 CCTACAGGTGGGGTCTTFCACMiCZGfiMffilMIOTMIM^ Clone 3 CCTACAGGTGGGGTCTTTCA (MMMMMMMMMMMIG. CCTACA(XJTGGGGTCTTTCA2IXXMMXiCCM,III^^ Clone 4 C(jrACAGGTGGG(ITCrrrCA(KJGC(MIG€m€a Clone 5 CCTACAGGTGGGGTCTTTCA MJmTfCMIGTMMM^IlIIiMC Clone 6 CCTACAGilTGGGGTCITTCA CTA(E1I:MICCCAT(^ Clone 7 CCTACAGGTGGGGTCTTTCATTAATGAAAGACCCCCGCTGACGGGTAGT licit sec\|iieiicecl Into genomic segment Clones TCATTAATGAAAGACCCCCGCTGACGGGTAGT/ICTGrGCCXTG B Figure 4 Sequencing of the integration junctions of the circular RV proviral cassette. (A) Schematic representation of the RV genome conformation in the noncovalently linked circular preintegration complex and the subsequently cloned fused LTR junction. (B) A human cell line expressing the retroviral gag/pol genes and Cre recombinase (TelCre) were infected with the Ad/RV hybrid vector expressing puromycin resistance. Colonies were selected which had stably integrated the RV proviral cassettes and the genomic DNA was extracted. The integration junctions were subsequently cloned by PCR amplification of religated restriction-digested fragments containing the integration site [93], which were subsequently sequenced through the integration site. 5 0 8 Murphy and Vile potential in enabling the stable transduction of all cells primarily infected by the Ad vectors. C. Adenoviral/Epstein-Barr Virus Hybrid Vectors An alternative application of the Cre/LoxP recombinase system of excis ing a circular proviral molecule from an Ad vector [93] has replaced the retroviral component w îth the genetic stability of the EBV replicon system [94, 95]. This hybrid Ad/EBV vector system utilizes Ad-mediated nuclear delivery of a Cre-excisable EBV replicon w^hich can be stably maintained as an EBV episome [96]. EBV episomes contain the EBV latent origin of replication (Orip) and the EBV nuclear antigen-1 (EBNA-1) which acts on Orip, driving episomal replication (Fig. 5A). Previous studies have demonstrated that EBV nuclear episomes are stably maintained through multiple cell divisions in primate and canine cells, replicating once during S phase and segregating to both daugh ter cells w îth approximately 95% efficiency [97]. Tan and colleagues flanked Orip and EBNA-1, together w îth the puromycin resistance gene, v^ith LoxP sites and cloned them into an El-deleted Ad vector [94]. How^ever, multiple attempts to make an adenovirus failed due to suspected inhibition of Ad replication upon binding of ENBA-1 to Orip. Hence a vector was assembled which only brought EBNA-1 upstream of its promoter following Cre excision of the proviral cassette (Fig. 5B), thus silencing its expression in the absence of Cre recombinase [94]. The resultant Ad/EBV hybrid vector stably transformed 37% of surviving canine D-17 cells to puromycin resistance following coinfec- tion with AdCre. The circular EBV replicons were maintained in daughter cells for 14 weeks, ^110 cell generations. Surprisingly, the puromycin resistance gene was also discovered in an integrated form, in the cellular chromosomal DNA [94]. Integration of EBV episomes has not been reported previously in human cells, although a differential function in the canine cells might be involved. One major limitation of the hybrid system was, however, that a large cell fatality was observed upon transduction with the Ad vector into the D-17 cells at the optimum transduction conditions (m.o.i. 30). This was discussed by the authors as a function of leaky Ad gene expression from the first-generation vector in the canine cells and not related to EBNA-1 toxicity [94]. Reports have previously shown that EBNA-1 does not elicit a cytotoxic T-cell response, due to the presence of a series of glycine-alanine repeats [98]. These repeats act in cis to prevent MFIC class I presentation by inhibiting antigen processing by the ubiquitous processing pathway [98]. A very similar Ad/EBV replicon vector has also been described in the context of an E4-deleted, second-generation Ad vector [99]. Coinfection of human cells with this vector, together with AdCre (also E4-deleted), resulted in efficient delivery and excision of the replicon in the absence of vector-induced toxicity. The replicons were maintained following successive cell divisions both 17. Hybrid Adenoviral Vectors 509 EBNA-1 OriP ^^^^^^Hs^§mKm. ITR LoxP Cre \ Recombinase. \ OriP Figure 5 Episomal replication and maintenance of a Cre-excised EBV replicon from an adenoviral vector. (A) A LoxP-flanked cassette containing the EBV origin of replication (Orip) nuclear antigen (EBNA-1) and transgenes of interest was inserted into an adenoviral vector. Upon infection of cells expressing Cre recombinase, this cassette is efficiently excised as a closed circular molecule. Upon action of EBNA-1 on Orip, the circular cassette is efficiently replicated by the rolling circle mechanism, facilitating maintenance of the cassette in the infected cells. (B) In order to control the expression of the EBNA-1 genes, the promoter and gene are separated in the adenoviral cassette and become productively in line in the excised replicon form only following Cre-mediated excision. (C) By inserting the left LoxP site between the Ad LTR and ^ , leaky excision of Cre recombinase and subsequent premature excision of the LoxP cassette would render the resulting Ad vector nonpackageable due to elimination of ^ . This strategy eliminates contamination of the excised adenoviral form upon propagation of the hybrid Ad/EBV vector. 510 Murphy and Vile EBNA-1 Promoter ^^ ^̂ ^ - • • 5^—• No Expression of Gene. rm¥ lITR LoxP OriP LoxP Cre Recombinase EBNA-1 Gene Expression i Episomal B Replication OriP Figure 5 {continued) in vitro and in vivo^ suggesting efficient extrachromosomal replication as well as nuclear retention of the episome. The residual Ad backbones were, however, progressively lost by a dilution mechanism occurring in the absence of DNA replication [99]. As for all gene therapy vector systems, incorporation of all the compo nents into a single vector would simplify delivery and therapeutic efficacy. As for the previously described Cre-excisable RV provirus strategy [93], combina tion of the vector elements for the Ad/EBV has its limitations. Any expression of Cre recombinase would result in premature excision of the EBV replicon, specif ically upon initial Ad propagation. Wang and colleagues, however, enabled incorporation of all the components into a gutless helper-dependent (HD) Ad vector by use of a tissue-specific promoter to control Cre expression [100]. 17. Hybrid Adenoviral Vectors 5 1 1 Placing Cre under the control of a synthetic
promoter (HCR12), consisting of hepatic locus control elements from the human ApoE/C locus fused to the first intron of the human EFla gene, allowed adequate suppression of expression in 293 cells while permitting recombination and subsequent gene expression in the target tissue. However, promoter activity was not completely extinguished in all nonhepatic cells. In order to limit the effects of leaky Cre excision of the LoxP cassette, the Ad packaging signal was included in the excisable cassette (Fig. 5C). The placing of a LoxP site between the LTR and \\|; has been demonstrated not to inhibit Ad expression extensively [13]. Thus leaky excision would remove \\|/ from the Ad vector backbone, rendering the Ad genome nonpackageable and hence preventing contamination in the final viral stocks. Additionally, removal of \\|/ from the cassette also eliminates the El enhancer elements, which are interlinked with the packaging elements, which have been reported to additionally limit leaky viral expression events from the adenoviral tripartite leader sequence (TPL) [100]. D. Hybrid Retroviruses Trafficking to the Nucleus While previously described strategies have focused on combining the advantageous properties of retroviruses into adenoviral vectors, research has also investigated the reverse scenario. An interesting study by Lieber and col leagues investigated the potential of inserting the nuclear localization functions of an adenovirus into a retrovirus [101]. The failure of MoMuLV to cross the nuclear membrane in the absence of cell division has limited retroviral vectors. Large proteins or complexes (>40-60 kDa), such as the retroviral preinte- gration complex, are too large to pass into the nuclear membrane by simple diffusion and require nuclear localization signals (NLSs). NLSs interact with cytoplasmic receptors initiating an energy-dependent multistep translocation into the nucleus. The efficient nuclear targeting properties of Ad vectors have made them ideal gene delivery vehicles. It is generally believed that NLSs in the preterminal protein (pTP) and the core protein V play a crucial role in directing the Ad genome complex to the nucleus. The Ad pTP binds alone or in a complex with the Ad polymerase to specific sequences at the termini of the adenoviral ITRs. Lieber and colleagues-investigated whether coexpression of pTP with retroviral DNA carrying pTP-binding sites would facilitate nuclear import of the preintegration complex and transduction of quiescent cells. Pre liminary experiments demonstrated successful nuclear import of plasmid DNA via the karyotypic pTP (in the presence or absence of Ad polymerase) into the nuclei of growth-arrested cells [101]. The pTP binding motif was initially established by engineering two head- to-head adenoviral ITRs, but was later reduced to an 18-bp terminal fragment of the ITR, deemed the minimum required unit [101]. Interestingly, attempts to introduce the full Ad ITR fragment into retrovirus vectors resulted in viruses 5 1 2 Murphy and Vile with very low titers (<10^ iu/mL), indicating adverse effects on retroviral replication. The minimal ITR 18mer oligonucleotide, however, allowed high- titer retrovirus production. The pTP binding site was placed in the center of the recombinant vector between hAAT and neo in order to avoid potential interference of pTP binding on preintegration complex stoichiometry. Results demonstrated that the incorporation of the pTP karyotypic machinery in the context of the retroviral backbone could indeed efficiently translocate the RV genome across the nuclear divide. pTP-mediated transduction was, however, always less than in proliferating cells, possibly indicating weak binding to the viral DNA, which is supported by AdPol increasing nuclear import and transduction. Alternatively the nuclear matrix binding properties of pTP could interfere with the retroviral transduction functions. Disappointingly, however, pTP nuclear import of MoMuLV DNA in nondividing cells was found not to be sufficient for stable transduction. Undetermined additional cellular factors activating during S phase and/or DNA repair are required for efficient retroviral integration [101]. E. Hybrid Adenoviral/Adeno-Associated Virus Vectors Incorporation of AAV nuclear retention functions into hybrid Ad vectors has also become a great interest in gene therapy. AAV vectors have emerged strongly as candidates for gene therapy, being nonpathogenic and presenting a mechanism of stable integration into a specific locus of the human host chromosome. The terminal ITR structures contain all the c/s-acting elements required to drive episomal replication, host genome integration and packaging into infectious AAV particles [102-105]. The rep gene products mediate the amplification of the AAV genome and facilitate site-specific integration into the human chromosome 19ql33^ termed AAVSl [106, 107]. In the context of double-stranded circular DNA plasmid vectors, the presence of the two AAV ITRs was demonstrated to be sufficient to rescue an AAV genome from the plasmid backbone and to mediate its integration into host DNA [108, 102]. These findings paved the way to the development of AAV vectors and initiated the application of AAV genomes in hybrid vector systems. The ITR-flanked AAV cassettes were subsequently demonstrated to also be efficiently rescued from the backbones of other viral vectors. In cultured cells, AAV integrates into the host chromosome with a relatively low frequency of 1 X 10""^ to 3 X 10~^ genomes per cell, with alternative episomal replication of its genome permitting long-term persistent expression in cells [109]. However, the integration efficiency can be enhanced by stimulation of the host DNA repair machinery by gamma irradiation or topoisomerase inhibitors [110,111]. The only requirements for AAV integration and episomal concatemerization appear to be the presence of AAV ITRs and as-yet-undetermined cellular factors [102, 103, 108]. 17. Hybrid Adenoviral Vectors 513 Following the hybrid Ad/RV studies, AAV ITR-flanked transgene cas settes have been similarly applied in the context of an Ad backbone. AAV ITR cassettes can be efficiently rescued from Ad genomes and assembled into AAV particles upon the supply of rep and cap functions in trans [15]. In the absence of the cap genes, Ad-mediated delivery of the AAV ITR cassettes can result in its stable integration into the host genome, in the presence or absence of the rep genes (Fig. 6). However, studies on the relationship between Ad and AAV demonstrate a strong interference of AAV on the Ad life cycle [112]. Although the precise mechanism is undetermined, rep expression is sufficient to suppress the maturation of Ad replication centers [113]. Hence the major complica tion in the union of the Ad/AAV hybrid vector system has been strategies to facilitate rep expression in the context of an adenoviral vector. The AAV rep gene encodes four proteins that are expressed from indepen dent promoters (Fig. 7A). The Rep68 and Rep78 differentially spliced products are expressed from the P5 promoter and individually are capable of catalyzing AAV genome integration [114, 115]. The poorly characterized Rep40 and Rep52 proteins are expressed from the PI9 promoter and, although having Ad AAV Ad ITR hF iHlTR + Rep 19ql3.3 (AAVSl) Genomic Integration: - Rep Random Transgene AAV Genomic DNA Figure 6 Hybr id-Ad/AAV vector-mediated integration of the AAV ITR cassettes. Infection of cells with the hybrid A d / A A V vector enables precise excision of the ITR-flanked cassette from the adenoviral genome, v/hich can subsequently be integrated into the host genome. This mechanism can occur in the absence or presence of the AAV Rep proteins. In the presence of Rep the cassette is predictably integrated into the AAVSl locus on human chromosome 19. 514 Murphy and Vile Rep SA SD Cap llliiiil ̂ ^̂ ^̂ "̂ -»- 3'rrR P5 P19 P40 Cap Structural Proteins VPl,VP2andVP3. Rep78 Splicing Rep68 Rep52 Splicing A Rep40 Rep SA<SD P5 P19 P40 Rep78 B Promoter ^ Rep78 rm LoxP LoxP ^ v Cre Recombinase. - • Rep78 EXPRESSION rmpr LoxP Figure 7 Control of the expression of the AAV Rep proteins in the context of their inhibitory effects on Ad production. (A). Schematic representation of the AAV genome. Three promoters are contained in the AAV genome: P5 and p i 9 control expression of the alternatively spliced Rep68/78 and Rep40/52 transcripts, respectively, while P40 controls expression of the Cap gene products. (B) In order to restrict expression from the Rep cassette to just the Rep78 form, a point mutation was introduced into the PI 9 promoter's ATG start site, preventing Rep40/52 expression, and a similar mutation in the P5 transcript's splice site eliminated Rep68 expression. (C) In order to further restrict Rep78 expression from the Ad vector, a LoxP cassette flanking a poly(A) stop site was cloned between the Rep78 gene and its promoter. This cassette completely silences Rep78 by preventing translation by premature termination at the introduced poly(A) site. Cre-mediated excision removes this cassette, permitting Rep78 expression to proceed. 17. Hybrid Adenoviral Vectors 5 1 5 similar catalytic properties to the other proteins, their function is undetermined and believed to be distinct from Rep68/78 [116]. Recchia and colleagues inves tigated amplification conditions that v^ere likely to minimize Rep inhibition of vector production [117]. Specifically, PI9 promoter expression of Rep52 and Rep40 v̂ âs reported to impose significant inhibitory functions to Ad replica tion, although Rep68 and Rep78 functions w êre also apparent. To minimize the complications of Rep-mediated interference of Ad production, the expres sion of Rep proteins w âs restricted to just the Rep78 isotype, by inactivating the Rep52 and 40 transcripts by ATG mutation and preventing Rep68 splicing by similar point mutations at the splice site (Fig. 7B). Rep79 was placed under the control of either the T7 promoter, a promoter previously applied to the production of adenoviruses expressing toxic genes, or the a 1-antitrypsin (alat) liver-specific promoter, to additionally minimize any interference. The AdT7- Rep78 shuttle vector w âs successfully recombined in 293 cells to generate the Ad vector, whereas shuttle vectors containing the wild-type Rep, or only expressing the Rep52 and —40 isotypes, did not yield any viral plaques. The functionality of the AdT7-Rep78 vector was demonstrated in an AAV rescue study [117]. As expression from the a la t promoter restricts expression to hepatic tissues, Ueno and colleagues applied an alternative Cre/LoxP bacteriophage PI system as a switch to regulate Rep expression from an Ad vector [118]. A LoxP-flanked cassette containing a transcriptional silencing sequence (SV40 poly(A)) was cloned between the Rep78 gene and its CAG promoter (Fig. 7C). Hence upon Cre recombinase expression the LoxP cassette is excised, uniting promoter and transgene and allowing transcription to proceed. The authors failed to yield any virus with Rep78 driven by the CAG promoter in the absence of the Lox-stop cassette. The vector system thus required a third Ad expressing Cre (AdCre) to be coexpressed with AdLoxP-Rep78 and the Ad/AAV hybrid vector. Only upon application of all three vectors to HeLa cells (m.o.i.s of 10 to 20) was site-specific integration into AAVSl detected by PCR analysis of genomic DNA [118]. As with the previous systems, incorporation of all the vector components into a single gutless vector is a major aim. The application of Cre recombinase would thus, as with the previous Ad/EBV replicon system [94], require tightly controlled expression to be incorporated into the same helper-dependent (HD) vector as the LoxP cassette. 1. Helper-Dependent Ad/AAV Recchia and colleagues furthered the studies of Ad/AAV hybridology by incorporating the system into HD Ad vectors [117]. The system applied a similar two-vector strategy with the AAV ITR transgene cassette and Rep78 genes on separate gutless vectors, HD-AAV and HDalat-Rep78, respectively. The gutless Ad constructs consisted of the terminal c/s-acting regions of the Ad genome (ITRs and ^\r) together with the transgene cassette(s), as well as 5 1 6 Murphy and Vile additional inert staffer sequences, to bring the vector genome size above the efficient packaging size threshold (>27kb) [35]. Large-scale production of HDalat-Rep78 generated titers of 3 x 10^ iu from 5 x 10^ cells, indicating 50-100 Rep-expressing viruses per cell could be produced. This HDalat- Rep78 virus expressed Rep78 selectively in hepatic cells (Hep3B). Rescue of the AAV-ITR transgene cassette from HD-AAV into infectious AAV particles was observed upon coinfection of Hep3B cells w îth HDalat-Rep78 and w îld- type Ad2 helper. No AAV rescue w âs detected upon elimination of any of the three vector components, demonstrating the functionality of each component. Coinfection of HD-AAV w îth HDalat-Rep78 into a number of cell lines of hepatic origin showed stable integration of the AAV transgene cassettes into the host cell genome specifically at AAVSl, by nested PCR analysis. Southern blotting, and integration site junction sequencing [117]. FISH studies on HepG2 cells infected with both vectors demonstrated targeted integration to AAVSl in 14 of 39
(35%) metaphases analyzed. In the absence of the Rep78 vector only one integration in chromosome 19 was observed in 34 metaphases analyzed (3%). Hence, the study by Recchia and colleagues demonstrates that Rep78 expression increases the targeted integration of AAV-ITR-flanked DNA without affecting the overall integration frequency in cells of hepatic origin [117]. In contrast to other studies on 293 cells [114,119,120], however, Rep78 did not increase the stable transduction efficiency on the hepatic cell lines investigated, which was believed to be due to cell-type effects [117]. The next advance in this study will be incorporation of both cassettes into a single HD Ad vector. This will be much more complex than originally perceived considering the action of Rep78 on the AAV cassette, especially in the high copy number context of adenovirus production. Additionally, considering the Rep-independent processing of the AAV ITR cassette, the fate of the cassette at high copy number in the producer cells would be of great interest. 2. Generation of Mini-Ad/AAV Hybrid Vectors by in Vitro Hybridization Inverted repeat (IR) sequences inserted into first generation Ad vector genomes were recently reported to mediate precise genomic rearrangements resulting in vector genomes devoid of all viral genes but which were efficiently packaged into functional Ad virions [121]. These genomes were generated by a ^m/zs-recombination between two Ad genomes exchanging sequences either side of the IR regions. Hence two species are generated. Firstly, a small genome containing only the transgene cassette flanked on both sides by precisely duplicated IRs, Ad packaging signals (i\|/), and Ad ITRs (Fig. 8). Second, a larger genome is generated containing the transgene cassette flanked by the IRs and also the rest of the Ad genome (Fig. 8). The presence of the Ad packaging signal only in the mini-genome product meant that only this form could be packaged, whereas the larger genome just facilitated helper 17. Hybrid Adenoviral Vectors 5 1 7 Figure 8 Generation of mini-Ad genomes by recombination between inverted repeat (IR) regions. The presence of IR regions in adenoviral cassettes enables precise recombinations between different Ad genomes within the IR regions. This recombination generates mini-Ad genomes with the precisely replicated IR cassettes being flanked at either end by Ad ITR and ^ sequences. A second, much larger, recombinant species is also generated which also contains a precisely replicated IR cassette but is flanked on either side by the rest of the adenoviral genome. This larger recombinant, as well as being of a size nonpackageable into an adenoviral virion, lacks the Ad ^ and hence is not packaged. In contrast, the smaller mini-Ad genomes can be efficiently assembled into adenoviral particles assembled by the larger genome's helper functions. functions. Application of this precise recombination mechanism to generate mini-Ad genomes deleted of all viral genes could minimize the immunogenicity apparent with first-generation vectors. By modifying the IR regions to increase the efficiency of recombination, further selection for the recombinant mini- genomes could be achieved [121]. The mini-Ad virions could be efficiently separated on CsCl gradients by buoyant density, v\̂ ith great resolution from the larger helper viral genomes enabling efficient purification. The generation of the recombinant mini-Ad genomes was very efficient (^5 X 10"̂ genomes per cell) and did not depend on the sequences within or adjacent to the IRs [121]. The mini-Ad vectors efficiently infected cultured cells with the same efficiency as first-generation vectors. However, in the absence of any vector selection in the cell (episomal replication or integration), transgene expression was only transient (^7 days) due to the instability of the deleted genomes within transduced cells. 5 1 8 Murphy and Vile Lieber and colleagues further developed the system to incorporate AAV cassettes into a hybrid vector system [121]. The AAV ITRs flanking the trans- gene cassette vŝ ere used as the IRs to mediate the recombination event, as well as stimulating transgene integration into the host genome of transduced cells. The Ad-AAV vectors efficiently generated mini-genomes by IR recombination as by-products of first generation Ad-AAV vector amplification. The mini- genomes containing only the transgene flanked by AAV ITRs, Ad \I/s, and Ad ITRs could be efficiently assembled in Ad capsids and purified to high titers and purity. The mini-Ad-AAV hybrid vectors transduced cells w îth efficiencies comparable to AAV, but w êre less efficient than conventional Ad vectors due to elevated particle to infectious unit ratios [121]. Since the hybrid mini-vectors contained no cytotoxic viral genes, the hybrid virus could be applied at very high m.o.i.s to increase transduction rates. The AAV transgene cassettes ran domly integrated into the host cell genomes as head-to-tail concatemers, as shown by Southern blot analysis and pulsed-field gel electrophoresis. Amplification of Ad-AAV hybrid vectors in 293 cells routinely yielded final mini-Ad-AAV genome titers of 5 x 10^^ genomes per milliliter, or '^lO'^ packaged genomes per 293 cell, comprising 10% of the total number of adenoviral virions [121]. The 5.5 kDa mini-Ad-AAV hybrid vectors which contain two Ad packaging signals were, however, packaged approximately fivefold less efficiently than the corresponding full-length genomes [121]. These results are compatible with the published observations that Ad vector genomes of less than 27 kb package with much reduced potentials compared to full- length genomes [35]. Additionally, contamination of mini-Ad-AAV hybrid vector preparations with the parental Ad-AAV hybrid vector was less than 0 .1%, consistent with conventional gutless Ad purification [13]. The efficiency of vector production measured on a genome-per-cell basis was reported to be comparable to or higher than the labor-intensive techniques for AAV production. The transducing titers expressed as neomycin-resistant colonies per milliliter were 9 x 10^ for AAV and 2.5 x 10^ for the mini-Ad-AAV hybrid vector [121]. These results present significant clinical promise for mini-Ad/AAV hybrid vectors in the clinic. IV. Conclusion The establishment of hybrid Ad vectors incorporating the advantageous properties of other viruses greatly expands their therapeutic potential. In the early 1990s, after the initial decade of proof-of-concept for Ad-mediated gene therapy, the main focus was on limiting the immunogenicity of the vectors to enhance transgene expression. Further restricting the expression of the highly immunogenic late viral transcripts by E4 deletions or by complete deletion of all viral genes in the gutless vectors notably enhanced transgene expression [11-13, 35]. However, complete ablation of immunogenicity is 17. Hybrid Adenoviral Vectors 5 1 9 restricted by the highly inflammatory nature of the Ad particles themselves in the absence of viral expression. While suppression of specific immune responses can counter these effects to some extent, in many disease states w^here the immune system is already compromised this rationale is not ideal. Pseudotyping the Ad vectors vv̂ ith alternative surface moieties does, hov^ever, offer great potential. First, novel surface structures can be introduced v^hich can reduce the immunogenicity of the viral particles by either shielding or replacing the highly immunogenic w^ild-type structures. Future research may permit the complete replacement of the viral external domains with immune- tolerated surface structures. Second, the introduction of new^ targeting ligands v îll enable selected infection of desired tissue populations, limiting the required vector doses. Additionally, the avoidance of infection of nontargeted tissues, specifically cells of the immune system, v îll negate potentially immunogenic signalling w^hich the vectors can initialize upon receptor docking. It is now^ w êll accepted that the immune system is not the major limiting factor in the transient expression attained from Ad vectors. The absence of a specific mechanism of long-term retention of the viral genomes in infected cells is critical. As presented at the start of this chapter, the rapid lytic life cycle of w^ild-type adenoviruses does not require long-term persistence of the genomes. Adenovirus infection, genome replication, virion packaging, and lysis of the host cell are generally completed w^ithin 48 h. While these properties have proved highly beneficial in the area of vector production, they do not aid in vivo stability. By combining the long-term stable persistence mechanisms of other viral systems into the Ad vectors, the efficacy of Ad-mediated gene therapy has been significantly enhanced. A number of mechanisms have been presented in this chapter for the combination of adenoviral and retroviral vectors. Initial applications utilized Ad vectors to deliver RV packaging functions to producer cells in vitro^ in attempts to increase the efficiency of RV production. From these initial studies, the potential of the hybrid Ad/RV vectors for the establishment of RV producer cell in vivo w âs realized. As producers of RV packaging cells in vitro, the Ad/RV hybrid vector system has a number of advantages over conventional packaging cell lines. RV titers generated from transient plasmid- transfected producer cells are generally several orders of magnitude low^er than the best stable clones [3]. Therefore, as the Ad/RV hybrid system has been demonstrated to generate RV titers of the same orders of magnitude as conventional producer cells, it bypasses the need to isolate clonal populations and makes scaling up production more manageable. The requirement of GMP screening for replication-competent adenoviruses (RCA), as w êll as replication- competent retroviruses (RCR), w^ould, how^ever, be a concern. The separation of the different retroviral components on separate viruses, as well as limiting the potential of RCR, makes pseudotyping very simple. For instance, in the treatment of specific tissues, an envelope gene best suited for tropism to that 5 2 0 Murphy and Vile tissue can be easily incorporated into the vector system. The separation also enables characterization of individual RV components. Application of the individual Ad/RV hybrid vectors at varying m.o.i.s enables study of the RV production at varying copy load. Additionally, as different target tissues have been v^ell documented to have different potentials as RV producer cells, the hybrid Ad/RV system enables the rapid screening of tissues for their suitability as RV producer cells. How^ever, this measure of suitability is also influenced by the susceptibility of the cells to Ad transduction. Understanding the effects of saturating RV components could allov\̂ us to determine w^hat factors need to be further regulated in future hybrid vectors to enable enhanced RV production both in vitro and in vivo. Elucidation of host factors vital to efficient assembly of RV particles w^ould be very valuable. In future vectors, these host factors could be codelivered or upregulated to enhance RV titers. One major question is: w^hat advantages does the hybrid Ad/RV vector system have over conventional Ad or RV delivery? The ability to establish RV producer cells in vivo following Ad infection is a major step forw^ard in gene therapy. Previous methods of ex vivo transduction with retroviral vectors and reimplantation are laborious and inefficient. Vector spread is limited by the restricted migratory properties of the reimplanted cells. Application of the hybrid Ad/RV vector enables a noninvasive therapy with enhanced distribution and infectivity in target tissues. The subsequent local release of retroviral particles following adenoviral transduction also tackles the problem of inserting high levels of vector deep into the middle of tissue or tumor masses, rather than to just the peripheral layers. The major advantage over conventional Ad vectors is the establishment of a stable population of transgene-expressing cells in the surrounding tissues, through RV integration, following the initial transient Ad transduction. This permanency of therapeutic transgene has major implications in the clinic, specifically for the treatment of inherited diseases. The separation of the RV genes, as well as the introduction of additional regulatory elements carried on separate rAds, instills a multiple- vector transduction strategy. Vector systems involving more than one vector are limited by codelivery kinetics. The greater the number of individual vectors, the lower the probability that a cell will receive the full vector repertoire to allow retroviral production to occur. Therapeutic transgene expression can, however, proceed from the adenoviral vector itself, initiating an initial boost of gene expression, followed by a secondary level of sustained expression in RV transduced cells. Currently, however, the secondary phase of RV expression is much reduced compared to the initial Ad-mediated expression. This would minimize the sustained therapeutic effect of the vector system. Nevertheless, this hybrid Ad/RV vector system has great potential for the treatment of genetic disorders. The dual transduction properties of the Ad/RV hybrid vector also present the possibility of combinatory gene therapy where the Ad and RV portions 17. Hybrid Adenoviral Vectors 5 2 1 of the vector provide different therapeutic effects. This mechanism could have specific advantages to the treatment of
cancer. The initial Ad transduction could act to initially immunostimulate the tumor mass, aiding a break in tolerance by drav^ing in immune effector cells and initiating a "danger signal." The secondary RV transduction could deliver a cytoreductive transgene aimed at tumor cell killing, to eliminate tumor tissue and further immunostimulate the tumor environment. A major limitation of the system is the requirement of active cell division in neighboring cell populations to enable RV transduction. Hence, inserting a gene in the Ad vector, separate from the retroviral cassette, could trigger cell division of neighboring tissues so that they become fully receptive to the subsequently available retrovirus. An alternative strategic context of application could be applied to tumors, v^here the actively dividing tumor tissue is generally surrounded by virtually quiescent normal tissue. Utilizing a highly regulated cytotoxic gene, under the control of an inducible or tissue-specific promoter system, the primary Ad infection would enable production of retroviral particles w^hich in theory v^ould selectively infect dividing tumor cells. Subsequent cytotoxic gene expression could, to some extent, restrict cell killing to tumor cells. Ad-mediated delivery of an excisable closed circular RV cassette that can subsequently be integrated into the host genome w^ould be of great value to gene therapy in the clinic. The system provides the potential to direct stable transgene expression in each primarily Ad-infected cell. This would be a significant advance on the previous Ad/RV hybrid system, where the secondary RV transduction is extensively reduced compared to the primary Ad transduction. Although the closed circular form is not the primary substrate for retrovirus integration, in the absence of the wild-type substrate, Int has been demonstrated to integrate such structures into the host genome. While the efficiency of such a system has still to be addressed, further elaboration of the integration mechanism could enable increased affinity of the RV machinery for closed-circle LTR proviral forms. The system would also have the potential of combinatory gene therapy by the inclusion of transgene cassettes within or outside the integrating RV cassette. Transgenes outside the excisable cassette would provide transient expression for the duration of the Ad genome retention in infected cells. The integrated cassette could provide stable expression for the lifetime of the cell. The major advance of this system will come from the development of highly regulated expression systems that can completely silence Cre expression. Silencing of Cre recombinase expression would enable assembly of all the vector components into a single gutless HD Ad vector. Although the system proposed by Wang and colleagues [122] goes some way to prevent expression, the system is still leaky and restricts therapeutic application to hepatic tissue. The alternative strategy of maintaining a Cre-excised circular molecule by utilizing the EBV episomal replication system provides another potentially 5 2 2 Murphy and Vile powerful gene therapy vector, providing many of the advantageous properties detailed above. The Ad/EBV hybrid system would again require absolute con trol of Cre expression to combine all the components into a single vector. One limitation of this system is that EBNA-1 gene expression would have to be permanently maintained in the host cell, which could involve long-term cell regulatory or immunological problems in vivo. Conversely, the integration mechanism requires only transient expression of integrase to facilitate inte gration, and the transgene cassette is then maintained in the context of host cell chromosome replication. While the EBV replicon has the advantage of avoiding integration-related shutdown of transgene expression, other cellular factors are believed to be involved in the eventual loss transgene expression. EBV retention in human cells has been deemed limited and lost with time [123, 124]. Without drug selection, plasmids carrying the EBV elements are lost from human cells at rates of between 1 and 5% per generation [125]. The Ad/AAV hybrid vector system provides a powerful mechanism of maintained transgene expression by integration or episomal replication. The system also provides the potential of predictable integration at a specific locus in the human genome in the presence of Rep78. The establishment of targeted integration strategies introduces valuable safety features into a gene-therapy protocol. This advantageous property of integration also carries with it the potential hazard of insertional mutagenesis and the risk of activating cancer oncogenes in vivo. Although there are limited literature reports on the impact of such phenomena in a gene therapy protocol, as vector technology increases and the efficiencies of integration in human tissues are potentiated, these effects could become more significant. However, even in the context of the targeted integration of AAV, the exact phenotype of integration at chromosome 19^5^13.4, as well as the activity of genes integrated at such a locus are still to be determined. The generation of the mini-Ad/AAV hybrid vectors enables the high-titer purification of adenoviral particles deleted of all the Ad genes, analogous to the HD rationale. The mechanism of preparation and purification, however, appear to be simpler. The Ad/AAV hybrid vector is applied to the producer cells as an Ad, which also supplies the helper functions. This bypasses the necessity of HD plasmid transfection and subsequent serial passage to enhance titers to enable purification from the contaminating helper virus. The extensive size difference of the derived mini-Ad/AAV genomes, from the parental Ad/AAV genomes, also enables more efficient purification by buoyant density on CsCl gradients. Additionally, any contaminating parental vector will be a functional Ad/AAV hybrid vector. The biological stability of these mini-adenoviruses, in terms of both particle stability outside the cell and genome stability within the cell, still needs to be addressed. Nevertheless, considering the integration of the ITR AAV cassettes, the mini-Ad genome stability is not as important. Additionally although the transduction efficiency of the mini-Ad particles is 17. Hybrid Adenoviral Vectors 5 2 3 similar to AAV, the ratio of total particles to infectious virions is enhanced, limiting their efficiency compared to conventional Ad vectors. The vector is also limited in terms of codelivery of the rep gene, v^hich unlike the HD vectors cannot be easily incorporated into the same vector. HSV-based hybrid vectors have also been w êll reported in literature, presenting a number of advantageous properties over the described Ad-based systems. The development of the HSV-1 amplicon technology and helper-free packaging systems has made HSV-based vectors very promising clinical tools for gene therapy [39]. The large insert capacity of the amplicons (150 kb) and the concatemer-styled packaging, w îth up to 10 genome copies per virion introduces pov^erful features to gene therapy vectorology [25]. HSV vectors, like Ads, have tropism for most cells in the human body, but have particular affinity for neuronal tissues. The HSV-1-based amplicons do not, how^ever, retain the episomal maintenance functions of the parental herpes viruses and thus, as w îth Ad vectors, the genomes are rapidly lost in dividing cells. Hence, hybrid technology has been investigated to enhance the expression from HSV amplicon vectors. As w îth the Ad/AAV hybrid system, the presence of an AAV ITR-flanked cassette in the HSV amplicon vector can promote both extra- chromosomal amplification and integration of the transgene cassette into the host genome. The HSV/AAV hybrid vector system has been demonstrated to stably transform dividing cells for over 25 passages in culture [126]. Hepatic transduction in vivo v^ith an HSV/AAV hybrid vector supported gene expres sion in vivo for considerably longer periods than traditional HSV-1 amplicons, w îth minimal toxicity and immunogenicity [119]. An additional feature of the HSV/AAV studies w âs the placement of the rep gene under the control of its ow n̂ promoter, as literature has reported potential dov\An-regulation feedback inhibition of transcription v^hen Rep levels increase [127]. Thus the natural expression machinery of Rep is utilized to regulate its expression. Compared to Ad vectors, the HSV amplicon vector titers are limited (lO'̂ to 10^ iu/mL). Increased copy number can compensate for reduced titers in some fields of gene therapy, although for many corrective genetic therapies higher transduction efficiencies from higher titer viral applications may prove more efficacious. The reduced immunogenicity of the HSV-1 amplicons is, how^ever, a major advantage over Ad vectors. Other hybrid vectors have also combined RV and EBV functions w^ithin the HSV-1 amplicons, v^hich also have great potential as gene delivery vectors [123, 124, 128] The development of hybrid viral vector systems has thus revolution ized the way gene therapy vectors are conceived. The combination of the advantageous properties of different vectors goes some v^ay to establishing a vector system approaching the ideologies of a perfect gene transfer vehicle. The technologies are, how^ever, in their infancy and many factors need to be elucidated before the full potentials of the vectors can be achieved. In essence, further detailed elucidation of the viral life cycles and their interactions w îth 5 2 4 Murphy and Vile host cell factors is necessary. Understanding these factors will allow vectors to be developed which can interact with the host cellular machinery to facilitate long-term stable gene expression. Future "hybrid" vectors will be developed quite distinct from the currently perceived parental vectors. Virtually synthetic viral vectors will be established with predictable biological properties, which can effect desired clinical functions. The vast array of clinical phenotypes and biological properties of target tissues involved in human disease will, however, require a wide spectrum of clinical vectors, fashioned to specific disorders. Nevertheless, the current advances in gene therapy technology will ensure that hybrid viral vectors will play a major role in future clinical protocols. References 1. Coffin, J. M. (1996). Retroviridae: The viruses and their repHcation. In "Fundamental Virology" (B. N. Fields et ai, Eds.), 3rd ed., pp. 771-813. Raven Press, New York. 2. Vile, R. G., and Russell, S. J. (1995). Retroviruses as vectors. Br. Med. Bull. 51, 139-158. 3. Cossett, F. -L., Takeuchi, Y., Battini, J. -L., Weiss, R. A., and CoUins, M. K. L. (1995). High titer packaging cells producing recombinant retroviruses resistant to human complement. / . Virol. 69, 7430-7436. 4. Zhang, W. W. (1997). Review: Adenovirus vectors: Development and application. Exp. Opin. Invest. Drugs 6, 1419-1457. 5. Shenk, T. (1996). Adenoviridae: The viruses and their replication. In "Fields Virology" (B. N. Fields et ai, Eds.), 3rd ed.. Vol. 2, pp. 2111-2148. Lippincott-Raven, New York. 6. Bett, A. J., Prevec, L., and Graham, F. L. (1993). Packaging capacity and stability of human adenovirus type 5 vectors./. Virol. 67, 5911-5921. 7. Graham, F. L., Smiley, J., Russell, W. C., and Nairn, R. (1977). Characterisation of a human cell line transformed by DNA from human adenovirus type 5. / . Gen. Virol. 36, 59-72. 8. Bett, A. J., Haddara, W., Prevec, L., and Graham, F. L. (1994). An efficient and flexible system for construction of adenovirus vectors with inserts or deletions in early regions 1 and 3. Proc. Natl. Acad. Set USA 91, 8802-8806. 9. Gorziglia, M. I., Kadan, M. J., Yei, S., Lim, J., Lee, G. M., Luthra, R., and Trapnell, B. C. (1996). Elimination of both El and E2a from adenovirus vectors further improves prospects for in vivo human gene therapy. / . Virol. 70, 4173-4178. 10. Fang, B., Wang, H., Gordon, G., Bellinger, D. A., Read, M. S., Brinkhous, K. M., Woo, S. L. C , and Eisensmith, R. C. (1996). Lack of persistence of El-recombinant adenoviral vectors containing a temperature-sensitive E2A mutation in immunocompetent mice and hemophilia B dogs. Gene Ther. 3, 217-222. 11. Armentano, D., Zabner, J., Sacks, C , Sookdeo, C. C , Smith, M. P., St. George, J. A., Wads- worth, S. C , Smith, A. E., and Gregory, R. J. (1997). Effect of the E4 region on the persistence of transgene expression from adenovirus vectors./. Virol. 71, 2408-2416. 12. Wang, Q., Greenburg, G., Bunch, D., Farson, D., and Finer, M. H. (1997). Persistent trans- gene expression in mouse liver following in vivo gene transfer with a 5E1/5E4 adenovirus vector. Gene Ther. 4, 393-400. 13. Parks, R. J., Chen, L., Anton, M., Sankar, U., Rudnicki, A., and Graham, F. L. (1996). A helper-dependent adenovirus vector system: Removal of helper virus by Cre-mediated excision of the viral packaging signal. Proc. Natl. Acad. Sci. USA 93, 13,565-13,570. 14. Berns, K. I. (1991). Parvoviridae and their replication. In "Fundamental Virology" (B. N. Fields et al., Eds.), 3rd ed., pp. 817-837. Raven Press, New York. 17. Hybrid Adenoviral Vectors 5 2 5 15. Kremer, E. J., and Perricaudet, M. (1995). Adenovirus and adeno-associated virus-mediated gene-transfer. Br. Med.
Bull. 51, 31-44. 16. Flotte, T. R., Afione, S. A., and Zeitlin, P. L. (1994). Adeno-associated virus vector gene expression occurs in nondividing cells in the absence of vector DNA integration. Am. J. Resp. CellMol. Biol. 11, 517-521. 17. Russell, D. W., Miller, A. D., and Alexander, I. E. (1994). Adeno-associated virus vectors preferentially transduce cells in S phase. Proc. Natl. Acad. Set. USA 91, 8915-8919. 18. Walsh, C.E., Liu,J. M., Xiao, X., Young, N. S., Nienhuis, A. W., and Samulski, R. J. (1992). Regulated high level expression of a human gamma-globin gene introduced into erythroid cells by an adeno-associated virus vector. Proc. Natl. Acad. Set. USA 89, 7257-7261. 19. Linden, R. M., Ward, P., Giraud, C , Winocour, E., and Berns, K. I. (1996). Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. USA 93, 11,288-11,294. 20. Muzyczka, N. (1992). Use of AAV as a general transduction vector for mammahan cells. Curr. Top. Micro. Immunol. 158, 97-129. 21. Verma, I. M., and Somia, N. (1997). Gene therapy — promises, problems and prospects. Nature 389, 239-242. 22. Roizman, B., and Sears, A. E. (1991). Herpes simplex viruses and their replication. In "Fundamental Virology" (B.N. Fields etal., Eds.), 3rd ed., pp. 849-895. Raven Press, New York. 23. Efstathiou, S., and Minson, A. C. (1995). Herpes virus-based vectors. Br. Med. Bull. 51, 45-55 . 24. Huard, J., Akkaraju, G., Watkins, S. C., PikecavalcoH, M., and Glorioso, J. C. (1997). LacZ gene transfer to skeletal muscle using a replication-defective herpes simplex virus type 1 mutant vector. Hum. Gene Ther. 8, 439-452. 25. Kwong, A. D., and Frenkel, N. (1995). Biology of herpes-simplex virus (HSV) defective viruses and development of the amplicon system. In "Viral Vectors" (M. G. Kaplitt and A. D. Loewy, Eds), pp. 25-42 . Academic Press, New York. 26. Frenkel, N., Singer, O., and Kwong, A. D. (1994). The herpes simplex virus amplicon — A versatile defective virus vector. Gene Ther. l(Suppl. 1), S40-S46. 27. Wong-Staal, F. (1991). Human immunodeficiency viruses and their replication. In "Funda mental Virology" (B. N. Fields et al., Eds.), 3rd ed., pp. 709-723. Raven Press, New York. 28. Zufferey, R., Nagy, D., Mandel, R. J., Naldini, L., and Trono, D. (1997). Multiply attenu ated lentiviral vector achieves efficient gene delivery in vivo. Nat. Biotech. 15, 871-875. 29. Xiao, X., Li, J., and Samulski, R. J. (1998). Production of high-titer recombinant adeno- associated virus vectors in the absence of helper adenovirus. / . Virol. 72, 2224-2232. 30. Yang, Y., Jooss, K. U., Su, Q., Ertl, H. C. J., and Wilson, J. M. (1996). Immune response to viral antigens versus transgene product in the elimination of recombinant adenovirus-infected hepatocytes in vivo. Gene Ther. 3, 137-144. 31. Burns, J. C., Friedmann, T., Driever, W., Burrascano, M., and Yee, J. K. (1993). Vesicular Stomatitis virus G glycoprotein pseudotyped retroviral vectors: Concentration to very high titers and efficient transfer to mammalian and non-mammalian cells. Proc. Natl. Acad. Sci. USA 90, 8033-8037. 32. Weitzman, M. D., Kyostio, S. R. M., Kotin, R. M., et al. (1994). Adeno-associated virus (AAV) Rep protein mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91, 5808-5812. 33. Miller, D. B., Adam, M. A., and Miller, A. D. (1990). Gene transfer by retrovirus vectors occurs only in Cells that are actively replicating at the time of infection. Mol. Cell Biol. 10, 4239-4242. 34. Poeschla, E. M., Wong-Staal, F., and Looney, D. J. (1996). Development of HIV vectors for anti-HIV gene therapy. Proc. Natl. Acad. Sci. USA 93, 11,396-11,399. 5 2 6 Murphy and Vile 35. Parks, R. J., and Graham, F. L. (1997). A helper-dependent system for adenovirus vec tor production helps define a low^er limit for efficient DNA packaging. / . Virol. 71, 3293-3298. 36. Vos, J. -M. H. (1995). Herpesviruses as genetic vectors. In "Viruses in Human Gene Ther apy." Carolina Academic Press and Chapman and Hall, Durham, NC, and London. 37. Gough, M. J., and Vile, R. G. (1999). Different approaches in the gene therapy of cancer. Forum 9, 225-236. 38. Yang, Y., Li, Q., Ertl, C. J. H., and Wilson, J. (1995). Cellular and humoral immune responses to viral antigens create barriers to lung-directed gene therapy w îth recombinant adenoviruses./. Virol. 69,2004-2015. 39. Fraefel, C , Song, S., Lim, F., Lang, P., Yu, L., Wang, Y., Wild, P., and Geller, A. L (1996). Helper virus-free transfer of herpes simplex virus type 1 plasmid vectors into neural cells. / . Virol. 70, 7190-7197. 40. Yei, S., Mittereder, N., Te, K., O'SuUivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1, 192-200. 41. Worgall, S., Wolff, G., Falck-Pedersen, E., and Crystal, R. G. (1997). Innate immune mech anisms dominate elimination of adenoviral vectors following in vivo administration. Hum. Gene Ther. 8, 37-44. 42. Kieff, E., and Liebowitz, D. (1991). Epstein-Barr virus and its replication. In "Fundamental Virology" (B. N. Fields et al., Eds.), 2nd ed., pp. 897-928. Raven Press, New York. 43. Rapp, F., Melnick, J. L., Brutel, J. S., and Kitahara, T. (1964). The incorporation of SV40 genetic material into adenovirus 7 as measured by intranuclear synthesis of SV40 tumor antigen. Proc. Natl. Acad. Sci. USA 52, 1348-1352. 44. Lewis, B. A., TuUis, G., Seto, E., Horikoshi, N., Weinmann, R., and Shenk, T. (1995). Ade novirus ElA proteins interact with the cellular YYl transcription factor. / . Virol. 69, 1628-1636. 45. Freund, C. T., Tong, X. W., Block, A., Contant, C. F., Kieback, D. G., Rowley, D. R., and Lerner, S. P. (2000). Adenovirus-mediated suicide gene therapy for bladder cancer: Com parison of the cytomegalovirus- and Rous sarcoma virus-promoter. Anticancer Res. 20, 2811-2816. 46. Chen, L., Perlick, H., and Morgan, R. A. (1997). Comparison of retroviral and adeno- associated viral vectors designed to express human clotting factor IX. Hum. Gene Ther. 8, 125-35. 47. Jackson, R. J., and Kaminski, A. (1995). Internal initiation of translation in eukaryotes: the picornavirus paradigm and beyond. RNA 1, 985-1000. 48. Yee, J. K., Friedmann, T., and Burns, J. C. (1994). Generation of high-titer pseudotyped retroviral vectors with very broad host range. Methods Cell Biol 43(A), 99-112. 49. Schnierle, B. S., Stitz, J., Bosch, V., Nocken. F., Merget-Millitzer, H. Engelstadter, M., Kurth, R., Groner, B., and Cichutek, K. (1997). Pseudotyping of murine leukemia virus with the envelope glycoproteins of HIV generates a retroviral vector with specificity of infection for CD4-expressing cells. Proc. Natl. Acad. Sci. USA 94, 8640-8645. 50. Emi, N., Friedmann, T., and Yee, J. K. (1991). Pseudotype formation of murine leukemia virus with the G protein of vesicular stomatitis virus. / . Virol. 65, 1202-1207. 51. Pensiero, M. N., Wysocki, C. A., Nader, K., and Kikuchi, G. E. (1996). Development of amphotropic murine retrovirus vectors resistant to inactivation by human serum. Hum. Gene Ther. 7 ,1095-1101. 52. Diaz, R. M., Eisen, T., Hart, L R., and Vile, R. G. (1998). Exchange of viral promoter/enhancer elements with heterologous regulatory sequences generates targeted hybrid vectors to enhance both local and systemic antitumor effects of HSVtk or cytokine expression in a murine melanoma model. / . Virol. 72, 789-795. 17. Hybrid Adenoviral Vectors 5 2 7 53. Danno, S., Itoh, K., Baum, C , Ostertag, W., Ohnishi, N., Kido, T., Tomiwa, K., Mat- suda, T., and Fujita, J. (1999). Efficient gene transfer by hybrid retroviral vectors to murine spermatogenic cells. Hum. Gene Ther. 10, 1819-1831. 54. Kass-Eisler, A., Leinwand, L., Gall, J., Bloom, B. and Falck-Pedersen, E. (1996). Circumvent ing the immune-response to adenovirus-mediated gene-therapy. Gene Ther. 3, 154-162. 55. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, L, Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falckpedersen, E., Hackett, N. R., Crystal, R. G., and MastrangeU, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 56. MastrangeU, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, L, Crystal, R. G., and Falck- Pedersen, E. (1996). Sero-switch adenovirus-mediated in vivo gene-transfer — Circumvention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 57. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector w îth a type 17 fiber enhances gene transfer to human airway epithelia. / . Yirol. 73, 8689-8695. 58. Croyle, M. A., Stone, M., Amidon, G. L., and Roessler, B. J. (1998). In vitro and in vivo assessment of adenovirus 41 as a vector for gene delivery to the intestine. Gene Ther. 5, 645-54. 59. Kelleher, Z. T., and Vos, J. M. (1994). Long-term episomal gene delivery in human lymphoid cells using human and avian adenoviral-assisted transfection. Biotechniques 17, 1110-1117. 60. Paillard, F. (1997). Advantages of non-human adenoviruses versus human adenoviruses. Hum. Gene Ther. 8, 2007-9. 61. Hofmann, C , Loser, P., Cichon, G., Arnold, W., Both, G. W., and Strauss, M. (1999). Ovine adenovirus vectors overcome preexisting humoral immunity against human adenoviruses in vivo./. Virol. 73, 6930-6936. 62. Moffatt, S., Hays, J., HogenEsch, H., and Mittal, S. K. (2000). Circumvention of vector- specific neutralizing antibody response by alternating use of human and non-human adenoviruses: implications in gene therapy. Virology 272, 159-67. 63. Wickham, T. J. (2000). Targeting adenovirus. Gene Ther. 7, 110-114. 64. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endotheHal and smooth muscle cells by using bispecific antibodies./. Virol. 70, 6831-6838. 65. Wickham, T. J., Tzeng, E., Shears, L. L, 2nd, Roelvink, P. W., Li, Y., Lee, G. M., Brough, D. E., Lizonova, A., and Kovesdi, L (1997). Increased in vitro and in vivo gene transfer by adenovirus vectors containing chimeric fiber proteins. / . Virol. 71, 8221-8229. 66. Shinoura, N., Yoshida, Y., Tsunoda R., Ohashi, M., Zhang, W., Asai, A., Kirino, T., and Hamada, H. (1999). Highly augmented cytopathic effect of a fiber-mutant ElB-defective adenovirus for gene therapy of gliomas. Cancer Res. 59, 3411-3416. 67. Duisit, G., Salvetti, A., MouUier, P., and Cosset, F. L. (1999). Functional characterization of adenoviral/retroviral chimeric vectors and their use for efficient screening of retroviral producer cell lines. Hum. Gene Ther. 10, 189-200. 68. Rettinger, S. D., Kennedy, S. C , Wu, X., Saylors, R. L., Hafenrichter, D. G., Flye, M. W., and Ponder, K. P. (1994). Liver-directed gene therapy: Quantitative evaluation of promoter elements by using in vivo retroviral transduction. Proc. Natl. Acad. Sci. USA 91,1460-1464. 69. Salmons, B., Sailer, R. M., Baumann, J. G., and Gunzburg, W. H. (1995). Construction of retroviral vectors for targeted delivery and expression of therapeutic genes. Leukemia 9(Suppl. 1), S53-S60. 70. Noguiez-Hellin, P., Meur, M. R., Salzmann, J. L., and Klatzmann, D. (1996). Plasmoviruses: Nonviral/viral vectors for Gene Therapy. Proc. Natl. Acad. Sci. USA 93, 4175-4180. 5 2 8 Murphy and Vile 71. Culver, K. W., Ram, Z., Wallbridge, S., Ishii, H., Oldfield, E. H., and Blaese, R. M. (1992). In vivo gene transfer with retroviral vector-producer cells for treatment of experimental brain tumors. Science 256, 1550-1552. 72. Feng, M., Jackson, W. H, Jr., Goldman, C. K., Rancourt, C , Wang, M., Dusing, S. K., Siegal, G., and Curiel, D. T. (1997). Stable in vivo gene transduction via a novel aden oviral/retroviral chimeric vector. Nat. Biotech. 15, 866-870. 73. Kaplan, A. H., Manchester, M., Smith, T., Yang, Y. L., and Swanstrom, R. (1996). Condi tional human immunodeficiency virus type 1 protease mutants show no role for the viral protease early in virus replication. / . Virol. 70, 5840-5844. 74. Gossen M., and Bujard H. (1993). Anhydrotetracycline, a novel effector for tetracycUne controlled gene expression systems in eukaryotic cells. Nucleic Acid Res. 21, 4411-4412. 75. Yang, Y., Vanin, E. F., Whitt, M. A., Fornerod, M., Zwart, R., Schneiderman, R. D., Grosveld, G., and Nienhuis, A. W. (1997). Inducible, high-level production of infectious murine leukemia retroviral vector particles pseudotyped with vesicular stomatitis virus G envelope protein. Hum. Gene Ther. 6, 1203-1213. 76. Yoshida, Y., Emi, N., and Hamada, H. (1997). VSV-G-pseudotyped retroviral packaging through adenovirus-mediated inducible gene expression. Biochem. Biophys. Res. Commun. 232,379-382. 77. Caplen, N. J., Higginbotham, J. N.,
Scheel, J. R., Vahanian, N., Yoshida, Y., Hamada, H., Blaese, R. M., and Ramsey, W. J. (1999). Adeno-retroviral chimeric viruses as in vivo transducing agents. Gene Ther. 6, 454-459. 78. Lin, X. (1998). Construction of new retroviral producer cells from adenoviral and retroviral vectors. Gene Ther. 5, 1251-1258. 79. Bertran, J., Miller, J. L., Yang, Y., Fenimore-Justman, A., Rueda, F., Vanin, E. F., and Nien huis, A. W. (1996). Recombinant adeno-associated virus-mediated high-efficiency, transient expression of the murine cationic amino acid transporter (ecotropic retroviral receptor) permits stable transduction of human HeLa cells by ecotropic retroviral vectors. /. Virol. 70, 6759-6766. 80. Qing, K., Bachelot, T., Mukherjee, P., Wang, X. S., Peng, L., Yoder, M. C , Leboulch, P., and Srivastava, A. (1997). Adeno-associated virus type 2-mediated transfer of ecotropic retrovirus receptor cDNA allows ecotropic retroviral transduction of established and primary human cells./. Virol. 71, 5663-5667. 81. Scott-Taylor, T, H., Gallardo, H. F., Gansbacher, B., and Sadelain, M. (1998). Adenovirus facilitated infection of human cells with ecotropic retrovirus. Gene Ther. 5, 621-629. 82. Huber, B. E., Richards, C. A., and Krenitsky, T. A. (1991). Retroviral-mediated gene therapy for the treatment of hepatocellular carcinoma: An innovative approach for cancer therapy. Proc. Natl. Acad. Sci. USA 88, 8039-8043. 83. Bui, L. A., Butterfield, L. H., Kim,J. Y., Ribas, A., Seu, P., Lau, R., Glaspy, J. A., and McBride, W. H., and Economou, J. S. (1997). In vivo therapy of hepatocellular carcinoma with a tumor-specific adenoviral vector expressing interleukin-2. Hum. Gene Ther. 8, 2173-2182. 84. Uto, H., Ido, A., Hori, T., Hirono, S., Hayashi, K., Tamaoki, T., and Tsubouchi, H. (1999). Hepatoma-specific gene therapy through retrovirus-mediated and targeted gene transfer using an adenovirus carrying the ecotropic receptor gene. Biochem. Biophys. Res. Commun. 265,550-555. 85. Zheng, C , Baum, B. J., ladarola, M. J., and O'Connell, B. C. (2000). Genomic integration and gene expression by a modified adenoviral vector. Nat. Biotechnol. 18, 176-180. 86. Harui, A., Suzuki, S., Kochanek, S., and Mitani, K. (1999). Frequency and stability of chromosomal integration of adenovirus vectors./. Virol. 73, 6141-6146. 87. Brown, P. O. (1990). Integration of retroviral DNA. In "Retroviruses. Strategies of Replica tion" (R. Swanstrom and P. K. Vogt, Eds.), pp. 19-48. Springer Verlag, Berlin. 17. Hybrid Adenoviral Vectors 5 2 9 88. Varmus, H. E., and Swanstrom, R. (1985). Replication of retroviruses. In "RNA Tumor Viruses" (R. Weiss, N. Teich, H. Varmus and J. Coffin, Eds.), pp 75-134. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 89. Brown, P. O., Boweman, P., Varmus, H. E., and Bishop, J. M. (1989). Retroviral integration: structure of the initial covalent product and its precursor, and a role for the viral IN protein. Proc. Natl. Acad. Set. USA 86, 2525-2529. 89. Panganiban, A. T., and Temin, H. M. (1984). Circles with two tandem LTRs are precursors to integrated retrovirus DNA. Cell 36, 673-679. 90. Shoemaker, C , Goff, S., Gilboa, E., Pasking, M., Mitra, S. W., and Baltimore, D. (1980). Structure of a cloned circular Moloney murine leukemia virus molecule containing an inverted segment: Implications for retrovirus integration. Proc. Natl. Acad. Sci. USA 77, 3932-3936. 92. Lobel, L. I., Murphy, J., and Goff, S. P. (1989). The palindromic LTR-LTR junction is not an efficient substrate for proviral integration. / . Virol. 63, 2629-2637. 93. Murphy, S. J., Chong, H., Bell, S., Diaz, R. M., and Vile, R. G. A novel integrating adenovi ral/retroviral hybrid vector for gene therapy. Submitted for publication. 94. Tan, B. T., Wu, L., and Berk, A. J. (1999). An adenovirus-Epstein-Barr virus hybrid vector that stably transforms cultured cells with high efficiency. / . Virol. 73, 7582-7589. 95. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 96. Sugden, B., Marsh, K., and Yates, J. (1985). A vector that replicates as a plasmid and can be efficiently selected in B-lymphoblasts transformed by Epstein-Barr virus. Mol. Cell. Biol. 5, 410-413. 97. Yates, J. L., and Guan, N. (1991). Epstein-Barr virus-derived plasmids replicate only once per cell cycle and are not amplified after entry into cells. / . Virol. 65, 483-8 . 98. Levitskaya, J., Sharipo, A., Leonchiks, A., Ciechanover, A., and Masucci, M. G. (1997). Inhibition of ubiquitin/proteasome-dependent protein degradation by the Gly-Ala repeat domain of the Epstein-Barr virus nuclear antigen 1. Proc. Natl. Acad. Sci. USA 94, 12,616-12,621. 99. Leblois, H., Roche, C , Di Falco, N., Orsini, C , Yeh, P., and Perricaudet, M. (2000). Stable transduction of actively dividing cells via a novel adenoviral/episomal vector. Mol. Ther. 1, 314-322. 100. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 101. Lieber, A., Kay, M. A., and Li, Z. Y. (2000). Nuclear import of moloney murine leukemia virus DNA mediated by adenovirus preterminal protein is not sufficient for efficient retroviral transduction in nondividing cells./. Virol. 74, 721-734. 102. Xiao, X., Xiao, W., Li, J., and Samulski, R. J. (1997). A novel 165-base-pair terminal repeat sequence is the sole cis requirement for the adeno-associated virus life cycle. / . Virol. 71, 941-948. 103. Yang, C. C , Xiao, X., Zhu, X., Ansardi, D. C , Epstein, N. D., Frey M. R., Matera A. G., and Samulski, R. J. (1997). Cellular recombination pathways and viral terminal repeat hairpin structures are sufficient for adeno-associated virus integration in vivo and in vitro. / . V/Vo/. 71, 9231-9247. 104. Duan, D., Sharma, P., Yang, J., Yue, Y., Dudus, L., Zhang, Y., Fisher, K. J., and Engel- hardt, J. F. (1998). Circular intermediates of recombinant adeno-associated virus have defined structural characteristics responsible for long-term episomal persistence in muscle tissue./. Virol. 72, 8568-8577. 5 3 0 Murphy and Vile 105. Wu, P., Phillips, M. L, Bui, J., and Terwilliger, E. F. (1998). Adeno-associated virus vector- mediated transgene integration into neurons and other nondividing cell targets. / . Virol. 72, 5919-5926. 106. Weitzman, M. D., Kyostio, S. R., Kotin, R. M., and Owens, R. A. (1994). Adeno-associated virus (AAV) Rep proteins mediate complex formation between AAV DNA and its integration site in human DNA. Proc. Natl. Acad. Sci. USA 91, 5808-5812. 107. Walker, S.L., Wonderling, R. S., and Owens, R. A. (1997). Mutational analysis of the adeno-associated virustype 2 Rep68 protein helicase motifs. / . Virol. 71, 6996-7004. 108. Balague, C , Kalla, M., and Zhang, W. W. (1997). Adeno-associated virus Rep78 protein and terminal repeats enhance integration of DNA sequences into the cellular genome. / . Virol. 71, 3299-3306. 109. Rutledge, E. A., and Russell, D. W. (1997). Adeno-associated virus vector integration junc tions./. Virol. 71, 8429-8436. 110. Alexander, I. E., Russell, D. W., Spence, A. M., and Miller, A. D. (1996). Effects of gamma irradiation on the transduction of dividing and nondividing cells in brain and muscle of rats by adeno-associated virus vectors. Hum. Gene Ther. 7, 841-850. 111. Russell, D. W., Alexander, I. E., and Miller, A. D. (1995). DNA synthesis and topoisomerase inhibitors increase transduction by adeno-associated virus vectors. Proc. Natl. Acad. Sci. USA 92, 5719-5723. 112. Carter, B. J., Laughlin, C. A., de la Maza, L. M., and Myers, M. (1979). Adeno-associated virus autointerference. Virology 92, 449-62. 113. Weitzman, M. D., Fisher, K. J., and Wilson, J. M. (1996). Recruitment of wild-type and recombinant adeno-associated virus into adenovirus replication centres. / . Virol. 70, 1845-1854. 114. Surosky, R. T., Urabe, M., Godwin, S. G., McQuiston, S. A., Kurtzman, G. J., Ozawa, K., and Natsoulis, G. (1997). Adeno-associated virus Rep proteins target DNA sequences to a unique locus in the human genome. / . Virol. 71, 7951-7959. 115. Lamartina, S., RoscilU, G., Rinaudo, D., Delmastro, P., and Toniatti, C. (1998). Lipofection of purified adeno-associated virus Rep68 protein: Toward a chromosome-targeting nonviral particle./. Virol. 72, 7653-7658. 116. Berns, K. I., and Linden, R. M. (1995). The cryptic life style of adeno-associated virus. Bioessays. 17, 237-245. 117. Recchia, A., Parks, R. J., Lamartina, S., Toniatti, C., Pieroni, L., Palombo, F., CiUberto, G., Graham, F. L., Cortese, R., La Monica, N., and Colloca, S. (1999). Site-specific integration mediated by a hybrid adenovirus/adeno-associated virus vector. Proc. Natl. Acad. Sci. USA 96,2615-2620. 118. Ueno, T., Matsumura, H., Tanaka, K., Iwasaki, T., Ueno, M., Fujinaga, K., Asada, K., and Kato, L (2000). Site-specific integration of a transgene mediated by a hybrid adenovirus/adeno-associated virus vector using the Cre/loxP-expression-switching system. Biochem. Biophys. Res. Commun. 273, 473-478. 119. Fraefel, C., Jacoby, D. R., Lage, C., Hilderbrand, H., Chou, J. Y., Alt, F. W., Breakefield, X. O., and Majzoub, J. A. (1997). Gene transfer into hepatocytes mediated by helper virus-free HSV/AAV hybrid vectors. Molec. Med. 3, 813-825. 120. SheUing, A. N., and Smith, M. G. (1994). Targeted integration of transfected and infected adeno-associated virus vectors containing the neomycin resistance gene. Gene Ther. 1, 165-169. 121. Lieber, A., Steinwaerder, D. S., Carlson, C. A., and Kay, M. A. (1999). Integrating adenovirus-adeno-associated virus hybrid vectors devoid of all viral genes. / . Virol. 73, 9314-9324. 122. Wang, X., Zeng, W., Murakawa, M., Freeman, M. W., and Seed, B. (2000). Episomal segre gation of the adenovirus enhancer sequence by conditional genome rearrangement abrogates late viral gene expression./. Virol. 74, 11,296-11,303. 17. Hybrid Adenoviral Vectors 5 3 1 123. Wang, S., and Vos, J. M. (1996). A hybrid herpesvirus infectious vector based on Epstein-Barr virus and herpes simplex virus type 1 for gene transfer into human cells in vitro and in vivo. / . Virol. 70, 8422-8430. 124. Sena-Esteves, M., Saeki, Y., Camp, S. M., Chiocca, E. A., and Breakefield, X. O. (1999). Single-step conversion of cells to retrovirus vector producers with herpes simplex virus-Epstein-Barr virus hybrid amplicons./. Virol. 73, 10,426-10,439. 125. Yates, J. L., Warren, N., and Sugden, B. (1985). Stable replication of plasmids derived from Epstein-Barr virus in various mammalian cells. Nature 313, 812-815. 126. Jacoby, D. R., Fraefel, C , and Breakefield, X. O. (1997). Hybrid vectors: A nev^ generation of virus-based vectors designed to control the cellular fate of delivered genes. Gene Ther. 4, 1281-1283. 127. Labow, M. A., Hermonat, P. L., and Berns, K. I. (1986). Positive and negative autoregulation of the adeno-associated virus type 2 genome. / . Virol. 60, 251-258. 128. Savard, N., Cosset, F. L., and Epstein, A. L. (1997). Defective herpes simplex virus type 1 vectors harboring gag, pol, and env genes can be used to rescue defective retrovirus vectors. / . Virol. 71,4111-4117. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease I: Cancer Raj K. Batra,'§ Sherven Sharma/^ and Lily Wu,'§ *Division of Pulmonary and Critical Care Medicine Veterans Administration Greater Los Angeles Health Care System Los Angeles, California ^Wadsworth Pulmonary Immunology Laboratory University of California, Los Angeles Los Angeles, California ''^Departments of Urology and Pediatrics ^University of California, Los Angeles School of Medicine and Jonsson Comprehensive Center Los Angeles, California I. Introduction The development of molecular therapeutics for the treatment of human disease has a rational and predictable course. Because these therapeutics are generally derived from an understanding of molecular mechanisms underlying a disease process, the treatment strategies are hypothesis-driven and specifically targeted toward a pathway underlying the molecular and cellular pathogenesis. Accordingly, in addition to establishing therapeutic efficacy, the evaluation of a molecular therapeutic also confirms the importance of a specific genetic or biological pathway in the pathogenesis of a disease process. The evaluation of a molecular therapeutic typically begins by providing a molecular/cellular proof of concept in vitro, followed by an expansion of therapeutic princi ples and toxicological analyses of the intervention in animal models, and finally a systematic sequence of safety and clinical efficacy trials in human subjects. Logically, gene therapy paradigms using adenoviral (Ad) vectors can be expected to proceed along this course in order to be considered for the treatment of human disease. This chapter will focus on the use of animal ADENOVIRAL VECTORS FOR GENE THERAPY 5 3 3 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 3 4 Batra ef al. models in the process of evaluating adenoviral gene transfer strategies for the treatment of human cancer. In this respect, we v îll offer a personal perspective, concentrated on outlining principles rather than cataloging indi vidual
examples. Because the focus is on principles, the revievŝ v îll not be an inventory of the various experimental therapeutic strategies for cancer that utilize the adenoviral vector, although specific examples may be cited. Rather, ŵ e w îll use our background and experience to illustrate the prob lems inherent in testing experimental hypotheses in animal models of cancer, w îth the confidence that themes particular to our research may have broader applicability. Last, because the authors have an interest in utilizing Ad-gene transfer techniques for the treatment of lung and prostrate cancer, respectively, this chapter will emphasize experimental designs relevant to those clinical entities. A primary goal of in vivo/animal experimentation is to build on an in vitro proof-of-concept and to strengthen the rationale for clinical testing of an experimental therapeutic intervention. To justify animal studies, there should already be an existent pathophysiological rationale and/or in vitro experimental data suggesting that a strategy is likely to be effective. At this juncture, the investigator is faced w îth the formidable challenge of approximating a human disease in an animal model. Although animal models cannot be exact replicas of the human disease, they should, at the very least, provide useful molecular and cellular similarities to the pathogenesis and clinical manifestations of the target disease [1]. For a variety of reasons (low expense for breeding and maintenance, susceptibility to tumorigenesis, well-defined immunosuppressive states, feasible duration of experimental studies, etc.) mice are considered to be the prototypic animal model for experimentation. Ideally, a mouse model would mimic the target human disease in its etiology, genetics, clinical presentation, and progression. To model human lung cancer, for example, the ideal mouse model would systematically (in defined pathological stages) develop lung cancer from exposure to cigarette smoke, and the disease could be characterized by sequential gene defects that culminate in the clinical progression that typifies the human disease. Second, in designing the experimental approach, the investigator must also take into consideration the "pharmacological intervention or drug" (the Ad vector here) that is being tested. Because the ideal drug should have reliable delivery, specific targeted distribution and mechanism of action, and predictable elimination, the challenge to test an adenoviral vector based ther apeutic in an apt animal model becomes particularly daunting for a gene therapist. Thus, to test whether an Ad-based therapeutic will have efficacy for the treatment of human cancer, we must (1) model the complex human disease in vivo and then (2) test a multifaceted biological compound with ill-defined pharmacokinetic and pharmacodynamic properties that are likely 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 5 unique to the host and/or the disease state. In order to overcome the inher ent complexity of the problem, we have adopted an approach that uses a combination of models to overcome specific deficiencies that accompany each individually. Consequently, v ê utilize xenogeneic models (engraftment of het erologous tissue derived from donors of a different species, typically into an immunodeficient host) to study the therapeutic-gene effects and Ad vec tor-target cell interactions. Syngeneic (engraftment of tissue from genetically identical donors) and allogeneic (engraftment of tissues from a genetically dissimilar member of the same species) models are used to study host-tumor interactions in terms of immunological parameters and metastasis. To further discern the specific immunologic parameters important for tumor rejection in mice, specific knockout (targeted gene disruption) mice are utilized. Last, we extensively utilize transgenic (in this context, referring to the tissue-specific expression of a transforming oncogene) models to study the effects of a molec ular therapeutic in the setting of established orthotopic (referring to organ- or site-specific) malignancy. We believe that integrating the results of these indi vidual approaches w îll enable us to meet the goals of in vivo experimentation for advancing adenoviral gene therapy. II. Animal Models of Lung Cancer A. Human Lung Cancer Lung cancer is the leading cause of cancer-associated mortality in both men and w^omen. Although susceptibility to environmental carcinogens may be predetermined and foUov^ a pattern of autosomal dominant Mendelian inher itance [2, 3], lung cancer results from an accumulation of acquired genetic mutations [4-6]. In fact, it is suggested that 10-20 genetic mutations may be necessary for the development of lung cancer [7], although the discrete steps for the progression of a hyperplastic bronchial lesion to metaplasia and anaplasia have not been uncovered. Tobacco use is the strongest epidemiologic risk for the development of lung cancer and it is anticipated that approximately 10% of all smokers w îll develop lung cancer over their lifetime [8]. Current paradigms predict that lung cancer results from the w^idespread exposure of the carcinogen, leading to a process of "field cancerization," w^hereby the entire aerodigestive track is exposed to the offending agents and leads to the occurrence of synchronous and metachronous tumors [9]. The tobacco carcinogens apparently invoke the multiple clonal chromosomal abnormalities found throughout the airw^ays and alveoli of smokers [10, 11]. Following, the series of genetic mutations likely results in patterned aberrancies in signal transduction and cell-cycle pathw^ays, eventuating in malignant and metastatic phenotypes [12]. The general pattern of genetic changes are characteristic but 5 3 6 Batra ef a/. not specific for pathologic subtypes of lung cancer (see below). Overall, K-ras mutations are observed in 20-50% [13], p53 mutations are present in 50% [14], 60% exhibit reduced expression of pl6-ink4a [15, 16], and 30% show deletion of Rb, Small-cell lung cancers (SCLC) display a greater proclivity to c-m);c-amplification and a greater degree of p53 (80%) and rb mutations (90%). Chromosome 3p deletions, occurring at a chromosomal fragile site that includes the FHIT locus, are found in 50% of non-small-cell lung can cers (NSCLC) and in 90% of SCLC primary tumors [17]. Overexpression of the tyrosine growth factor receptor erbB2-neu is seen in 10-30% and overexpression oi bcl-2 [18] in 10-25% of NSCLC tumors [19]. Clinically, lung cancer is discriminated into SCLC and NSCLC categories by histopathology or cytopatholgy and by their characteristic clinical presenta tions and divergent responses to conventional cytoreductive therapies. NSCLC may be further subclassifed pathologically into squamous cell (SCCa), adeno carcinoma, broncho-alveolar cell carcinoma (BAC), adenosquamous (mixed pathology), or large-cell carcinoma. As noted above, the progression of lung cancer from a premalignant state to the clinical/pathological entity that is diag nosed in the vast majority of patients is unknown. This is because although the disease is prevalent, it is typically diagnosed when it has already spread outside the lungs and is pathologically advanced. Not surprisingly, because of the late stage of diagnosis, progressive genetic instability confers marked genetic and phenotypic heterogeneity within lung cancers, even in individual patients. The late stage of diagnosis also results in an absolute lack of premalignant material, making it difficult to assign specific roles for the genetic mutations in the systematic progression of lung cancer. Recently, however, some of the characteristic genetic mutations of lung cancer (e.g., loss of heterozygosity at chromosome 3/?, /?53 mutations) are being identified in microdissected dysplas- tic epithelium [20]. Similar observations are implicating the characteristic K-ras abnormalities in lung cancer as a correlate of mucinous differentiation [21]. A precursor to lung adenocarcinoma, a lesion pathologically termed alveolar atypical hyperplasia or AAH, is being advanced. AAH is described by increased cellular proliferation when compared to adjacent normal parenchyma and by immunohistochemical evidence of p53 stabilization, K-ras mutations, and c-erb-B2 overexpression [22-24]. The presence of these mutations in AAH may explain why such mutations may be detectable in sputum cytology spec imens that predate the onset of clinical lung cancer [25]. Identification of these early events are a particular focus of study because they may serve as genetic markers for malignant progression, or as targets of specific genetic or chemopreventative approaches. More relevant to this discussion, perhaps, these early events may be better modeled in murine models than late stage lung cancer (see below). Thus, there exists an inherent complexity in human lung cancer, and to precisely recapitulate the disease process in animals is not practical. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 7 B. Animal Models of Human Lung Cancer 1. Murine Lung Cancer and Transplantable Allografts Due to time of model development, ease of experimentation, and cost restraints, murine models of disease are the accepted standards. However, there are generic shortcomings in this approach. For example, cigarette smoke, w^hich is a strong epidemiological risk for the development of human lung cancer and is proximally responsible for approximately 85-90% of lung cancer cases in humans [26], is only w^eakly carcinogenic in mice [27, 28]. In addition, although both mouse and human lung adenocarcinomas may share common molecular defects [27], the histopathological repertoire of spontaneous or induced tumors in mice is very limited [29, 30], and morphologically, nearly all mouse lung tumors bear structural similarities only to BAG or well- differentiated adenocarcinomas. Consequently, whereas humans typically die from lung cancer of "late stage" metastatic disease, mice succumb to respiratory failure following the diffuse involvement of their lungs by "early stage" carcinoma in situ [1]. Spontaneous lung cancer develops in 3% of wild mice [31, 32] with strain-dependent sensitivity. Clones have been isolated from spontaneously arising tumors, and established as cultures in vitro. These cultures now serve as a readily available source for the generation of transplantable allografts. Many investigators, including our group [33-38] have extensively utilized line 1 alveolar carcinoma (L1C2), a murine lung cancer cell line that is syngeneic to BALB/c, and 3LL (Lewis lung cancer), which is syngeneic to C57B1/6. Usually, these cell lines are utilized to generate transplantable heterotopic (referring to a location outside of the organ of origin, typically subcutaneous) tumors in syngeneic mice. Our group has utilized these models to investigate, in general, the interplay between the immune system and the host. Both L1C2 and 3LL tumors are relatively "nonimmunogenic," as is human lung cancer, and immunogenetic strategies that modulate the immune system to generate an anti-tumor immune response can be systematically investigated in these models. However, other lung tumor-allografts, especially when cells are selected to express "marker antigens" to enable their easy detection in culture systems, may indeed become immunogenic. Notably, the transplantable allograft system is artificial, and all recipient hosts have a "stress" response to the implanted tumor that cannot be recapitulated in control animals. In addition, extrapolating anti-tumor responses in mice to humans is not a straightforward proposition, and many therapies that reliably "cure" tumors in inbred strains of mice are not as effective in humans. In part, these differences may be attributable to differences in immune responses in the two hosts. For example, cluster determinants (CD-antigens) in murine strains may not have homologous or functional cellular analogs in the human host. Laboratory animals used for medical experimentation are genetically inbred strains with reliable phenotypic characteristics. Although this feature 5 3 8 Batra et al. imposes a generic limitation on the extrapolation of results in lab animal studies to outbred populations, and thus, human disease, there are signifi cant advantages that need to be considered. The inbred nature of laboratory animals enable investigators to reliably establish disease in an animal host, and subsequently to study that disease process in controlled subsets. With respect to tumorigenesis, murine-A/J and SWR strains are the most sensi tive, BALB/c is of intermediate sensitivity, and DBA and C57BL/6 are the most resistant. Crosses betw^een susceptible and resistant inbred mouse strains may allows for the mapping of modifier loci for the development of lung cancer [39]. For example, it is reported that the propensity of strains to develop lung tumors correlates w îth a polymorphism in the second intron of K-ras [40]. Practical experience suggests that there are common genetic alterations affecting known tumor suppressor genes and proto-oncogenes occur during mouse lung carcinogenesis. Molecular abnormalities may also be shared w îth human lung cancer, and K-ras activation is a conspicuous example [41]. Human adenocarcinomas commonly carry K-ras mutations; most of these mutations are in codon 12 and are transversions of GGT to either TGT or GTT. It is postulated that these mutations occur early in lung cancer pathogenesis since they can be detected in sputum samples of smokers prior to the clinical diagnosis of lung cancer. Analogously, 80 to 90% of both spontaneous and chemically induced murine lung tumors con tain K-ras mutations. Moreover, K-ras mutations also occur early in murine
lung tumorigenesis, and remarkably, codon 12 is the site of genetic change induced by many chemical carcinogens [1]. Furthermore, a consistent loss of mouse chromosome region 4, an area that contains the mouse homolog of the human pl6-ink4a [42, 43], has been described to result in an allelic loss of the pl6-ink4a seen in 50% of mouse adenocarcinomas. Similarly, p53 mutations are found, albeit infrequently [44], although mouse chromosomal regions containing p53 and Rb more commonly exhibit LOH [43]. Reduced expression of Rb and pl6 and increased c-myc expression [39] have also been reported. These commonalties have suggested some to conclude that mouse and human lung carcinomas are sufficiently similar for the murine model to be informative [1], and have formed the rationale for the testing of chemo- preventative strategies [39] in mice. Analogously, these commonalties may be advanced to form the basis for the testing of genetic therapies in murine tumors as w êll. Mice strains also vary with respect to inducible-tumorigenesis. Generally, mice that are sensitive to the development of spontaneous lung tumors are also at the highest risk for chemically induced tumors [31] and form the basis for the quantitative carcinogenecity bioassays. Although a variety of agents, including urethane, metals, and concentrated components of tobacco smoke such as pol- yaromatic hydrocarbons and nitrosoamines [45, 46], can induce lung cancer in mice, tobacco smoke per se is only weakly carcinogenic [28]. Murine lung 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 3 9 tumors histologically resemble early lesions that originate peripherally (from type 2 alveolar cells or Clara cells) and simulate papillary or bronchioloalveolar cell cancer (BAG). In contrast, the bulk of human tumors are bronchogenic (arise in the airways) and, as described above, display a broad histopathologic variation. In fact, individual human lung cancers may be histologically hetero geneous; i.e., they often display mixed morphologies v^ithin the same tumor specimen. So how^ does one reconcile these differences betv^een murine lung cancer and human lung cancer, and moreover, can one generalize observations and results from one species to another, or even from one human being to another? When considered in the context of adenoviral gene delivery, there is a limiting paucity of in vivo data to generate any broad conclusion. On the contrary, our observations in vitro suggest that gene transfer into subtypes of human lung cancer is highly variable, and strategies directed toward achiev ing intratumoral gene transfer may require patient or disease-specific vector formulations [47]. The biological heterogeneity of human lung cancer drives our inves tigations along specified pathways, utilizing many different models and strategies to come up with viable treatment approaches. For instance, we believe that a systematic assessment of the efficiency and optimal route of adenoviral gene delivery in vivo into murine lung tumors and trans planted human xenografts needs to be performed. Researchers are beginning to identify the Ad-cellular attachment receptor (termed the Coxackievirus- adenovirus receptor (CAR) [48]) as a major determinant underlying effi cient transduction [49]. Along these lines, the scope and "polarity" of CAR expression in tumors in vivo needs to be defined. Thus, one focus of our program is to systematically evaluate gene transfer into these model sys tems using conventional and retargeted adenoviral vectors with the aim of optimizing a vector system and a mode of delivery. This focus evolves from the premise supported by our in vitro data that the histological heterogeneity of lung tumors may be a harbinger of variable responsive ness to both adenoviral entry and/or the efficacy of adenoviral gene ther apy [47]. Because uniform targeting of tumor in vivo may be unattainable, we have also generated protocols in which the Ad-vector is used in pre cisely controlled ex vivo "dosing" approaches to genetically modify antigen- presenting cells (APCs) or tumor cells to vaccinate the host against their tumor [37]. 2. Murine Models That Spontaneously Develop Lung Cancer Murine models of lung cancer include strains susceptible to chemically induced tumors and transgenic strains that express viral and cellular onco genes. The simian virus-40 large T-Ag (SV40-TAg) has been commonly used to produce tumors in transgenic mice [50, 51]. SV40-TAg binds and inca pacitates the cell cycle checkpoint and DNA-binding capabilities of the p53 5 4 0 Batra ef aL and Rb gene products, resulting in uncontrolled cellular proliferation [52]. To develop a murine model of lung cancer, Wikenheiser and colleagues chose to express the SV40-TAg under the transcriptional control of the lung-specific human surfactant protein C (SP-C) promoter in transgenic mice [53, 54]. They demonstrated that these mice consistently developed multifocal lung adenocarcinomas that had pathological features similar to some human lung adenocarcinomas, and that the mice succumbed to respiratory distress by age 4 - 5 months. As expected, the transgenic animals developed no tumors in any other organ systems, although some nonmalignant tissue also expressed the transgene [53]. Within the lungs, tumors consistently involved the bronchi- olar and alveolar regions of the lung while sparing the large airw^ays. The tumors of these mice also varied w îth respect to the expression of the large TAg, suggesting perhaps that SV-40 TAg may contribute to transformation, but continued expression may not be necessary for tumor progression. Like wise, organ-specific expression of SV40-TAg using the regulatory regions of uteroglobin [55] and the Clara cell-specific Mr 10,000 protein (CC-10) also results in the induction of lung tumors [56]. Uteroglobin is a marker protein for the nonciliated epithelial Clara cells, the source of xenobiotic metabolism in the lung, lining the respiratory and terminal bronchioli of the lungs. In animals expressing SV40-TAg under the uteroglobin promoter control, the pulmonary epithelium was morphologically normal at 2 months, dysplastic by 4 months, and transgenic animals were described as developing multifocal pulmonary adenocarcinoma present in various stages of differentiation by 5 months of age. In situ hybridization studies suggested that tumors did not contain the transcripts of the uteroglobin gene, and again, late stage tumors lost expression of the large T-Ag. Tumors also formed in the urogenital tract where uteroglobin is also expressed. Transgenic mice were also generated using the CCIO kDa promoter driving SV-40 large T-Ag [56]^ and it is in this model that we have chosen to test the immunomodulatory capacity of secondary lymphoid chemokine or sic [36]. In the 7736 mouse fine, CC-lOTAg-transgenic mice develop multifocal pulmonary adenocarcinomas and succumb to respiratory failure at 16-20 weeks of age. Pathology is localized to the lungs, and the tumors express the large T-Ag in normal Clara cells and in transformed tumor cells. Pathological progression is similar to that described above, with the lungs appearing morphologically normal at 2 months of age, a number of tumor foci are grossly discernable by 3 months, and the majority of the lung is replaced by coalesced nodules by 4 months of age. As tumor progresses, the expression of endogenous CCIO expression diminishes, and there is increased nuclear p53 expression, suggesting binding and stabilization of the protein by the large T-Ag [56]. From our standpoint, we have found that the reliable progression of lethal tumors in these transgenic mice enable us the test a number of hypotheses, dosing schemes, and dosing routes. Importantly, the effects of immunomodulation by 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 4 1 the gene transfer of specific cytokines and chemokines into tumor cells in vivo can be determined. Moreover, one can compare this direct-delivery strategy W\t\\ alternative approaches, including ex vivo modification of autologous APCs using recombinant Ad-vectors. The subsequent reintroduction of gene- modified APCs back into the tumor environment overcomes the inability of dendritic cells to maturate in the presence of tumor in vivo [57] by providing functional APCs that are capable of processing and presenting tumor antigens to cytolytic T cells in vivo [6]. 3. Murine Models vŝ ith Transplantable Xenografts Xenotransplantation of human tumors into immunocompromised mice began in the late 1960s [58] follov^ing the discovery of the nude mouse in 1962 and its characterization as an athymic mutant in 1968 [59]. The morphologic and karyotypic stability of tumors serially passaged in nude mice v^as described [60], and it v^as established that xenotransplanted tumors in nude mice often retained distinctive phenotypic and functional characteristics found in the human host [61]. However, the "tumor-take" rate for nude mouse xenotransplants is tumor-specific, and generally, carcinomas are more difficult to estabUsh than melanomas or sarcomas [62]. Thus, progressive tumor grow^th from inoculated primary tumors (i.e., cultured directly from the patient) is observed in only 33% for lung cancers [61, 63] and is virtually nil for primary breast or prostate cancers. In addition to properties inherent to the tumor, nude-mouse-related factors also impact on tumor take. For example, mice infected W\t\v the mouse hepatitis virus do not accept xenotransplants, presumably because of enhanced NK-cell activity [64]. In this regard, it is important to recall that although nude mice lack functionally mature T cells, they are capable of mounting normal humoral responses to T-cell-independent antigens [65] and they exhibit high NK-cell activity [GG]^ and these properties probably impact negatively on the tumor-take rate of xenotransplants. The high NK-cell activity also abrogates the metastatic potential of implanted tumors, and the incidence of metastasis is higher in mice Wixh lov^er NK cell activity, e.g., young (3-week-old) syngeneic mice or the beige (bgV bgO mutants derived from the C57BL/6 mice [67, 68]. The discovery of a severe combined immunodeficiency in mice [69] offered yet another option for hosting human tumor xenografts. The scid/scid mice are characterized by the virtual absence of functional T and B lumphocytes due to aberrancies in the rearrangement of antigen receptor genes [70]. The first successful engraftment of human solid organ tumors into scid mice began w îth the subcutaneous inoculation using the A549 lung adenocarcinoma cell line [71]. Since that time, a variety of human solid-organ cancers, both from cell lines and primary tumor specimens, have been successfully engrafted [72]. The higher rates of successful engraftment, presumably because of the lack of residual B-cell function in scid mice, have led many investigators to prefer 5 4 2 Batra ef al. scid/scid mice over nuinu mice as the host recipients of human xenograft tumors. Xenografts are still impacted upon by the scid host's innate immunity, and NK and monocyte/macrophage activities can be upregulated in these hosts. For specific needs, selective breeding of other available mutants (beige mutants with reduced NK-cell activity and osteopetrosis with altered macrophage differentiation) enables the generation of strains that harbor overlapping defects in immune function [73]. Furthermore, genetic engineering and gene- targeting technology has helped create murine-mutants with exquisitely specific immune defects, including mice in which CD4 or CDS T cells are deleted [74] and mice which lack p-2 microglobulin and thus do not express transplantation antigens \1S\. Xenotransplants have many advantages, the primary being that they provide a replenishable source of human tumor. This enables the genetic characterization and gene discovery of tumor-specific phenotypes and, in rare occasions, the progression toward an advanced or metastatic phenotype of the tumor (e.g., from an androgen-dependent prostate tumor to one that is androgen independent, see below). Xenografts incorporating human tumor cells in immune-deficient mice are plentiful. For example, we have devel oped a novel animal model mimicking intrapleural malignancy that allows for a controlled, focal dosing of reagents and evaluation of therapeutic ben efit [76]. The model is composed of 2.5-cm segments of rat intestine that is denuded, and then everted so that the serosal surface is converted into the lumenal surface of a tube. Lung cancer cells are instilled into the lumen via a polyethylene cannula on day - 1 , allowed to adhere to the serosal sur face overnight, and this tubular xenograft is implanted into the interscapular subcutaneous tissue of a nude mouse on day 0 \J(i\ The graft simulates metastatic tumor growth on the pleural surface basal lamina both grossly and histopathologically and enables robust quantitation of tumor kinetics \1G\. The appearance of tumor on this surface is nodular, and these nodules coalesce over time with intervening fibrous stroma. Neovascularization is evident on histological exam of the graft, and tumor growth is continuous with a vari ety of NSCLC cell lines. We have found this model to offer certain tangible advantages. For example, with respect to the transduction characteristics of tumor, the value of this model is evidenced
by the following: (1) the cells are representative of human lung cancer; (2) the location of the tumor is precisely known and tumor is directly accessible; (3) the vast majority of cells that repopulate the graft are derived from those instilled (host leukocytes and fibrocytes comprise the remaining minority); (4) the mode of delivery of reagents (fluid inoculation rather than intratumoral injection) is designed so as to be clinically applicable for installation into pleural space; (5) the size of the xenograft enables quantitative assessments of transgene expres sion and morphometry simultaneously, containing human tumor into nude mice \7(i\. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 3 C. Gene Therapy of Lung Cancer Using Adenoviral Vectors 1. Gene-Based Therapies Targeting Molecular Transformation Abnormalities at the cell surface (e.g., erbBI), signal transduction (e.g., ras -oncogene), gene regulation and cell cycle control (e.g., /?53, Rfo, c-myc- oncogene), or apoptosis (e.g., p53, BCL-2) are all implicated in the process of transformation and can serve as targets for rational therapeutic intervention. For example, to overcome the deficits due to mutated p53, one strategy for lung cancer gene therapy has opted to replace the mutated p53 gene v^ith a normal copy [77]. Restoring p53 function in these cells has led to decreased tumorigenicity of human cancer cells in vitro and in animal models [78, 79]. Based on these preliminary studies, the first clinical gene therapy trial for human NSCLC also utilized a /?53-gene transfer strategy [77]. In this study, nine patients with advanced NSCLC vv̂ ere treated w îth either bronchoscopic or percutaneous CT-guided injections with a retroviral p53 expression vector (a genetically reengineered retrovirus that is designed to integrate into the cell genome and express the normal /?53-protein). Of the seven patients evaluated, three showed evidence of tumor regression at the treatment site and six showed increased apoptosis of tumor cells on posttreatment biopsies. Importantly, there was no significant toxicity associated with the therapy, and in situ gene transfer was achieved. However, limited therapeutic efficacy was observed and the mechanisms responsible for the anti-tumor effects are still under study. For example, although it was originally believed that mutated p53 function would have to be compensated in each and every cell for restoration of the normal apoptosis-program, the results suggested otherwise. Because there was substantive tumor regression despite poor in situ gene transfer, mechanisms for the observed "bystander effect" were hypothesized [80]. The term "bystander effect" refers to the ability of gene-modified tumor cells to mediate killing of neighboring nontransfected cells. One plausible explanation is that wild-type /?53 induces release of angiostatic factors, thus undermining the blood supply to the tumor [81]. In addition, the expression of p53 may also contribute to an immune-mediated response [82, 83]. These issues have led to more mechanism-based bench and animal studies, as well as other phase 1 clinical trials using Ad vectors encoding the p53 gene for a variety of cancers, including lung tumors [84]. Because of the high frequency of p53 mutations, another strategy that uses replication-competent viruses has been hypothesized to be ideally suited for lung cancer. This approach employs adenoviruses (mutant dll520 or ONYX-015) that are suggested to selectively replicate in p53-mutated (there fore, selectively in cancer) cells [85, 86]. Consequently, these mutant viruses are promoted as "magic bullets" that kill tumor cells and leave normal tis sues intact. This particular approach has generated considerable controversy 5 4 4 Batra ef aL both in terms of its reputed efficacy as well as its proposed mechanism of action [87-89]. In brief, its effectiveness in both in vitro and in vivo models of lung cancer needs to be confirmed. Nevertheless, the approach represents a prime example of a novel hypothesis-driven strategy that attempts to exploit the biology of a mutant virus to clinical advantage. 2. Immunogene Therapy Effective immunotherapy has the potential for systemic eradication of disease, a payoff that is especially enticing for the treatment of lung cancer. Pre vious, largely unsuccessful immunomodulatory campaigns utilized nonspecific immune strategies (e.g., BCG adjuvants). Increasingly, the interest now is in developing specific immune interventions for lung cancer. The major obstacle for effective immunotherapy of lung cancer has been a meager understanding of the immunobiology of this disease. However, a better understanding of the reciprocal interaction between the tumor and the immune system is starting to emerge, lending itself to plausible hypotheses for intervention. We realize that an effective aniti-tumor response may either provoke the immune system to recognize and attack the tumor, or conversely, it may serve to reduce the immunosuppression encumbered upon the host by the tumor. Specific and effective anti-tumor immunity requires both adequate tumor- antigen presentation and the subsequent generation of effector lymphocytes. A variety of cytokines have been investigated to implement such a program in situ [90-97], and many of the studies have utilized the Ad-vector for gene delivery. For several reasons, our efforts have focused on IL-7, IL-12, and more recently on the chemokine sic, for the treatment of lung cancer. The rationale underlying the use of these particular cytokines and chemokines is that they all optimize conditions for tumor antigen processing and presentation by the host's APCs, and they help appropriately localize and sustain the effector lymphocytes response [36, 37, 97, 98]. Although the cellular infiltrates differ depending on the cytokine and model used, many studies indicate that tumor cells that have been transfected with cytokine genes can generate specific and systemic antitumor immunity in vivo. Based on these promising animal studies, what prevents these strategies from being translated into successful and curative human clinical trials? One major problem in human cancer patients may be that although lung cancers express tumor antigens [99], they are ineffective as APCs [100]. Tumor cells cannot function as APCs because (i) they lack costimulatory molecules, (ii) they are unable to adequately process Ag, and (iii) they secrete a variety of inhibitory peptides which promote a state of specific T-cell anergy. Thus, even for highly immunogenic tumors, professional APCs are required for antigen presentation [101]. As described above, local augmentation of IL-7 and IL-12 may help to overcome some of these defects [37]. In addition, one may bring into the tumor environment professional APCs to orchestrate a satisfactory 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 5 immune response against the tumor. In this regard, dendritic cells (DCs) are potent APCs that are ideal for interacting with and activating naive T cells to generate antigen-specific immunity [102, 103]. Recent advances in the isolation and in vitro propagation of DC has stimulated great interest in the use of these cells for clinical cancer therapy [104, 105]. In such approaches, DC may be envisioned to serve as vehicles for genes expressing antigens [106] or expressing cytokines in lung cancer gene therapy [33]. In addition, DC-based immunogenetic therapies may be used in combination v^ith other strategies that have been optimized for Ag presentation [34, 37]. Importantly, of the various approaches tested to gene modify the DCs, our colleagues at UCLA have determined that the Ad-vector is best suited for DC-transduction [107]. 3. Targeting Tumor Invasion and Angiogenesis Overcoming metastatic disease is paramount for effective lung cancer therapy, and the biology underlying metastasis is gaining clarity. Metastasis is a process involving several complimentary yet distinct elements, including the capacity for tumor cells to invade and traverse the basement membrane, and to reestablish viable tumor foci in distant organs. Each step in this process may serve as a point for therapeutic intervention in lung cancer. As the molecular biology becomes better understood, the opportunity to incorporate specific genes into vector systems invariably materializes. The initial step, tumor invasion, requires proteolysis, v^hich has been suggested to be mediated by an overexpression and secretion of matrix metalloproteinases (MMPs) by lung cancer cells [108-111]. Therapeutically, gene transfer strategies have incorporated tissue inhibitors of metalloproteinases (TIMP) to inhibit invasion and metastasis [112], or have utilized antisense abrogation of MMPs to inhibit tumorigenicity [113]. Similarly, angiogenesis (induced grow^th of blood vessels) is suspected to be critical for tumor survival and progression at each stage of metastasis [114]. Angiogenic progression in lung cancer is felt to be due to an imbalance of angiogenic and angiostatic factors, and the risk of metastasis in NSCLC directly correlates v^ith the extent of tumor-derived angiogenesis [114]. Thus, strategies that inhibit of angiogenic mediators or restore angiostatic factors have potential utility for all stages of lung cancer [115-119]. The important mediators implicated in promoting or inhibiting angiogenesis lend themselves favorably for inclusion into gene therapy strategies. For example, recent studies indicate that vascular endothelial growth factor (VEGF) is an important angiogenic factor produced by a variety of tumors, including lung cancer. Lymph nodes with NSCLC metastases express significantly higher levels of VEGF than do normal, uninvolved nodes [120], consistent with the speculation that VEGF plays an important role in the metastasis of lung cancer. In addition to VEGF, recent studies have also implicated CXC chemokines in the abnormal angiogenic/angiostatic balance in NSCLC [121]. Members of 5 4 6 Batra ef at. this family containing the ELR motif (e.g., IL-8) are angiogenic, whereas those that lack this motif (e.g., interferon-inducible protein 10; IP-10) are angiostatic. Accordingly, neutralizing antibodies to IL-8 reduce angiogenesis and consequently the growth of human lung tumors in scid mice [122]. Other molecular strategies to specifically target angiogenic vessels are also being developed. For example, the adhesion protein av^s is relatively specific for angiogenic vessels where it mediates endothelial cells interaction with extracellular matrix components [123] and enables cell motility [124]. Importantly, its blockade can promote tumor regression in vivo in lung cancer models by inducing apoptosis of tumor-associated blood vessels [125]. More recently, phage-display peptide libraries, which are used to screen the specific binding of a massive array of peptides, have isolated small peptides which selectively bind to receptors (including avPa) on angiogenic vessels. Conjugat ing these peptides to chemotherapeutic agents have enabled investigators to specifically target tumor vasculature and abrogate tumor growth [126]. 4. Adjuvants to Conventional Therapeutic Approaches for Lung Cancer Conventional multimodality therapy for lung cancer incorporates surgery, radiation, and chemotherapy using a variety of clinical protocols dictated by the subtype and extent of disease. Theoretically, gene therapies may play important synergistic roles in augmenting the effectiveness of conventional approaches. For many such strategies, there already exists a scientific rationale to test them in combination with conventional multimodality therapy. For example, one may enhance the radiation-sensitivity or chemosensitivity of tumor cells (e.g., p53 or iKBa gene therapy) [127, 128] or modify normal tissue susceptibility to cytoablative therapy (e.g., mucosal/tissue protection: by virtue of MDR-1 or bFGF gene transfer). Examples of synergism with the suicide gene therapy approaches have also been studied. The HSV thymidine kinase gene/ganciclovir system induces radiation sensitivity into transduced tumor cells [129], suggest ing that these two forms of therapy can be combined to potentiate antitumor responses [130]. Similarly, tumor cells transduced with the cytosine deaminase transgene exhibit enhanced radiation sensitivity following pretreatment with 5-fluorocytosine [131]. Because the loss of p53 function can result in tumor resistance to ionizing radiation [132], restoring p53 function may restore apop- totic pathways and promote effective radiation or chemotherapy. In fact, gene transfer of wild-type p53 has been shown to enhance radiation sensitivity [133] and can act synergistically with as-platinum-based chemotherapy to augment cytotoxicity [134]. Many of the approaches outlined above as being strategies for gene therapy of 'lung cancer" are generic; these approaches can be generalized to a variety of malignancies since transformed cells have in common the same aberrant growth regulatory and signal transduction pathways. The molecular 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 7 and cellular pathogenesis of tumor invasion and immune evasion are also similar betvs^een tumors originating in diverse organ systems. Unfortunately, this commonality may not confer a broad-based advantage w^hen gene therapy strategies are advanced clinically. In this respect, vectors need to provide both efficient gene delivery as w êll as tumor specificity, and as a result, the gene trans fer strategies have to become "disease specific." Targeted vectors (as discussed elsew^here in this compilation) have to incorporate features rendering them capable of selective cell surface adherence or entry or, alternatively, express their therapeutic transgenes under tumor-specific regulation. Unfortunately, a lung cancer-specific cell surface target (for transductional targeting)
has not been identified, and one is left trying to use targets that are generally over- expressed in tumor cells or tumor-induced endothelium 1135, 136]. Similarly, lung cancer also does not express a specific tumor marker. Thus, transcriptional targeting approaches largely utilize elements that are "tissue-specific" rather than "cancer-specific." Accordingly, constructs where transgene expression is regulated by tissue-specific promoters (e.g., SLPI, SP-A, CC-10) are being actively developed and tested. III. Animal Models of Human Prostate Cancer A. Human Prostate Cancer After lung cancer, cancer of the prostate (CaP) is the second most com mon cause of cancer death in American males. A latent disease, many men have prostate cancer cells long before overt signs of the disease are apparent. The annual incidence of CaP is over 100,000 in the United States, of w^hich over 40,000 w îll die of the disease. Nearly a third of patients present with locally advanced or metastatic disease, and androgen deprivation therapy forms the basis of conventional therapy for the majority of these patients. How^ever, cur rently available approaches for advanced CaP are not curative [137], primarily because the cells lose their dependence on androgenic stimulation. The mech anisms of progression of CaP cells to hormone independence under androgen ablation therapy remain unclear. To investigate the factors and mechanisms that underlie the development of androgen resistance and metastasis, reliable in vivo models that mimic human CaP progression are essential. Moreover, it is critical that tumor models mirror the pathology and cellular and molecular characteristics of human CaP if it is to serve as a useful tool for basic research, drug screening, or the evaluation of new therapeutic strategies. B. Spontaneous and Transgenic Models of Human Prostate Cancer Currently, a single animal model cannot epitomize the multifaceted aspects of CaP pathogenesis and progression. Rodent models of prostate 5 4 8 Batra ef al. carcinoma have been developed by hormone treatment [138], spontaneous development [139], transgenic prostate-specific oncogene expression [140], and knockout of CaP-tumor suppressor genes [141]. However, these mod els are largely inadequate in recapitulating the progression of human disease as bone metastasis, [142] the major cause of chnical morbidity attributable to CaP. Despite pitfalls, the mouse transgenic TRAMP model has been useful for studying the development and progression of prostatic adenocarcinoma. TRAMP mice, generated by expressing SV40-T antigen specifically in prostatic epithehum [140], develop prostatic intraepithelial neoplasia (PIN) by 10-12 weeks of age and eventually progress to adenocarcinoma with metastasis to lymph nodes and lungs [143]. As in human disease, androgen ablation therapy in these mice contributes to the emergence of androgen-independent disease with a poorly differentiated phenotype [144]. C. Xenograft Models of Human Prostate Cancer As for lung cancer, investigators have chosen a number to utilize xenograft models of CaP. Unfortunately, CaP xenografts are far more fas tidious than lung cancer xenografts, and the generation of models that are representative of typical human disease has only recently been accomplished. Until recently, the majority of research conducted for CaP relied on the cell lines PC-3, DU145, and LNCaP. Among these, only LNCaP cells exhibit androgen responsiveness and express the prostate-specific antigen (PSA) and androgen receptor (AR). Thus, the relevance of DU-145 and PC-3 cells to clinical CaP has been questioned. To overcome the shortage of represen tative models of human CaP, a number of investigators began establishing xenografts in immune-deficient scid/scid mice using samples obtained directly from patients [145-149]. These xenografts offered the following advantages: (1) the expansion of small amounts of starting clinical material, (2) the enrich ment of relatively homogeneous cell populations from heterogeneous tumor cell populations, (3) the ability to investigate progression to metastasis and androgen independence [145, 146, 148], and (4) representative diversity that provided a more realistic picture of the heterogeneous nature of this disease. Investigators at UCLA established six distinct CaP xenografts from patients with locally advanced or metastatic diseases into scid/scid mice. Two of these xenografts, LAPC-4 and LAPC-9, have been maintained continuously for more than 2 years by serial passage in scid/scid mice [145, 146], and LAPC-4 has also been successfully established as a cell line in tissue culture to enable correlation with investigations performed in vitro, [145]. LAPC-4 and LAPC-9 offer several advantages over previous models; both express the wild-type androgen receptor (AR), both xenografts have intact AR-signal transduction pathways, and both secrete high levels of the androgen-dependent protein PSA. Accordingly, they grow as androgen-dependent cancers in male scid mice 18. Utility of Ad Vectors in Animal Models I: Cancer 5 4 9 and respond to androgen ablation treatment, but interestingly, they eventually progress to a hormone-refractory, androgen-independent state [145, 146]. LAPC-4 and LAPC-9 can be implanted subcutaneously, orthotopically into the mouse prostate, or intratibially. Orthotopic tumors metastasize reproducibly to regional lymph nodes and lung, providing an opportunity to study prostate cancer metastasis. Intratibial injection results in the formation of osteoblastic tumors typical of human CaP where bony metastasis is the major cause of morbidity. From a research standpoint, the generation of these xenografts has provided significant dividends. Given the inability to culture CaP by other means, the xenografts have been used to identify chromosomal abnormalities and to pinpoint the genes important to the pathogenesis of CaP. For example, loss of chromosome lOq w âs a frequently observed genetic defect in prostate cancer. Recently, the PTEN/MMAC tumor suppressor gene v^as identified and mapped to chromosome 10^23.3 [150, 151]. PTEN encodes a protein/lipid phosphatase w^hich has been clearly established to function as a negative regulator of the PI3-kinase/Akt signaling pathw^ay [152-158]. Loss of PTEN leads to constitutive activation of PI3-kinase, and in turn the Akt-signaling pathway [158]. PI3-kinase is also a downstream target of several growth factors implicated in CaP pathogenesis including epidermal growth factor receptor (EGFR), insulin-like growth factor receptor (IGFR) and Her2/neu, and it is possible that deregulation of this pathway in PTEN-deficient cells may indeed be responsible for the cancer phenotype. Of note, knockout mice lacking PTEN as a consequence of targeted deletion develop multiple cancers, including prostatic hyperplasia and prostatic intraepithelial neoplasia [141, 159]. Correspondingly, 50-60% of all prostate cancer xenografts established contain deletions, mutations, or absent expression of PTEN [160,161], making the xenografts a relevant and valuable source for biological and therapeutic discovery. Prostate cancer gene therapy approaches that specifically target this pathway are now underway in these models. In addition to modeling the abnormalities of the PTEN/MMAC pathway, xenografts are important in delineating the role of androgens and androgen receptor (AR) signaling in CaP. Prostate epithelial cells utilize androgen as a growth and differentiation factor and are dependent on androgen for survival. Once transformed, androgen deprivation is associated with a transition of CaP cells through a range of diminishing androgen-dependence, and ultimately androgen independence. Although not well understood, this process likely involves perturbations in AR signaling of cellular growth control. Potential AR-related perturbations may involve (1) AR mutation or gene amplification, (2) cross-talk between AR and other signal pathways, and/or (3) alterations in transcriptional coregulators. Greater than 80% of clinical CaP specimens have confirmed AR expression, even in advanced androgen-independent dis eases [162, 163]. Among these, AR-gene mutation or amplification has been 5 5 0 Batra ef al. documented in 20 -40% of CaP cases [164-166]. Both LNCaP and the CWR22 xenografts bear AR mutations that enable the receptor to be acti vated by nonandrogenic steroid hormones such as progesterone and estrogen. In addition, in a patient who had failed androgen ablation, it was recently demonstrated that his CaP-cells possessed a mutated AR with altered lig- and affinity. Essentially, the mutant AR functioned as a high-affinity Cortisol receptor, enabling the CaP cells to circumvent the androgen requirement for growth [167]. Another emergent theme is that some hormone refractory can cers have activated the AR signaling pathway through a ligand-independent mechanism. For example, in LAPC-4 cells expressing wild-type AR, the overex- pression of Her-2/neu has been shown to activate AR [168]. Not surprisingly, the LAPC-4 xenograft progresses to androgen-independence after androgen ablation and differential gene expression studies reveal a consistent increase in Her-2/neu protein expression in androgen-independent tumors. Further more, forced overexpression of Her-2/neu in androgen-dependent CaP cells is sufficient to confer androgen-independent growth in vitro and to accelerate androgen-independent growth in castrated animals. Thus, Her-2/neu overex pression activates the AR signaling pathway in the absence of ligand and enhances the magnitude of AR response in the presence of low levels of andro gen. Last, reconstitution experiments in a heterologous cell type expressing low levels of endogenous AR suggest that these effects of Her-2/neu on the AR pathway require AR-expression [168]. Although the point where Her-2/neu and AR pathway intersects is still undefined, nuclear receptor coactivators might be potential targets since amplification of steroid receptor coactivator, AIBl, is documented in breast and ovarian cancer [169]. Cross-talk between Her-2/neu and AR signaling pathways should provide a novel mechanistic insight into the development of androgen independence. D. Gene Therapy Approaches with Adenovectors in Prostate Cancer Recombinant Ad vectors are most commonly used for CaP because they have demonstrated the capacity to deliver genes intraprostatically in animal models [170]. Hence, several ongoing human CaP clinical gene therapy trials are using Ad [171, 172]. With respect to these applications, several groups are developing transcriptionally targeted prostate-specific Ad [172-175]. These strategies are beneficial in gene therapy applications in that they potentially restrict the expression of cytotoxic therapeutic genes to the malignant cells. Most commonly, the kallikrein-protease prostate specific antigen (PSA) gene regulatory regions have been used to direct prostate-specific expression because prostate epithelia, normal or malignant, specifically express the PSA [176]. Unfortunately, the transcriptional output from the native PSA enhancer and promoter (as from most highly regulated tissue-specific promoters) is much lower than from strong constitutive viral promoters such as CMV. For example. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 1 our studies suggest that the native PSA enhancer and promoter inserted into Ad can direct tissue-specific and androgen-inducible expression in LNCaP cells, but the transcriptional activity is 50-fold lower than the constitutive CMV promoter [Wu et al.^ unpubhshed data]. By exploiting the known properties of the native PSA control regions, we have improved the activity and specificity of the prostate-specific PSA enhancer (Wu et al. unpublished data). Previous studies had established that AR molecules bound cooperatively to AREs in the PSA enhancer core (—4326 to —3935) act synergistically with AR bound to the proximal promoter to regulate transcriptional output [177, 178]. To exploit the synergistic nature of AR action, we generated chimeric enhancer constructs by (1) insertion of a synthetic element containing four tandem copies of the proximal PSA promoter AREI (ARE4) element or (2) duplication of enhancer core and (3) removal of intervening sequences (—3744 to —2875) between the enhancer and the promoter. Each of these three strategies augments activity and androgen inducibility and retained a high degree of tissue discriminatory ability. As a result of these combined approaches, the two most active constructs are termed PSE-BC (duplication of core) and PSE-BAC (insertion of core and ARE4) are approximately 20-fold higher in activity than native PSA enhancer/promoter construct, PSE, composed of the PSA enhancer (-5322 to —2855) fused to the proximal promoter (—541 to +12). Most importantly, the enhanced activity and specificity of the new PSA-enhancer/promoter constructs are retained in an adenoviral vector. The recently developed human CaP xenografts should be excellent models to refine and evaluate this novel prostate-targeted gene therapy because their AR pathways are intact and their growth regulatory pathways bear close resemblance to clinical disease. IV. Summary and Discussion We have presented for discussion a broad-based review of the utility of adenoviral vectors in animal models of lung cancer. Since this entire compi lation is devoted to Ad-gene therapy, we have particularly embellished the sections on "animal models" of disease, especially as they pertain to lung and prostate cancer. These examples illustrate that the development of our approaches may need to be disease specific, especially with respect to targeting and mode of delivery. From this review, it is evident that to realize the full potential of cancer gene therapy, advances need to be made on a number of fronts. Not only do we need to construct better Ad-vectors or more rele vant animal models, we also need to incorporate emerging technologies to a useful purpose within the experimental design. For example, the pathway to
human clinical trials may be better paved by an improved ability to gather interim surrogate measures of gene transfer and expression in animal models. 5 5 2 Batra et al. The implementation of a quantitative and noninvasive method capable of monitoring transgene expression in living animals repetitively w^ould be useful toward validating the efficacy of any gene therapy strategy. In this respect, a number of investigators, including those at UCLA, are developing sensitive technologies for imaging transgene expression using positron emission tomog raphy (PET) and optical measurements. PET is a noninvasive, tomographic imaging modality that already has clinical applications for the diagnosis and management of several diseases including cancer. New^er high-resolution ani mal microPET technology developed at UCLA, is allow^ing for the study of smaller animal systems (mice, rats, small primates) previously difficult to image v^ith a resolution approaching 2 mm [179]. With relevance to gene therapy for cancer, the herpes simplex virus 1 thymidine kinase (HSVl-tk) gene has been demonstrated to be an excellent "PET reporter gene" by virtue of trapping positron-emitting 8-[18F] fluoroganciclovir (FGCV) specifically only in cells expressing HSVl-tk[180]. Using FGCV, repetitive PET imaging of adenovirus- directed hepatic expression of the HSVl-tk reporter gene in living mice has been achieved [180-182]. More importantly direct correlation between the retained PET reporter probe and the levels of HSVl-tk gene expression in the targeted organ have also been demonstrated [180-182]. Thus, PET is a sensitive and quantitative modality to image the location and magnitude of adenoviral vector-mediated gene expression in living animals which could be translated to clinical gene therapy apphcation. Similarly, a charge-coupled device (CCD) camera is a highly sensitive camera for measuring photons. Advances in CCD technology can now enable investigators to quantitatively and reliably image low levels of luminescence (from the heterologous expres sion of the firefly luciferase gene) arising from within living animals [183]. Although tomographic images are not possible, and the signal is dependent on the depth of tissue from which the light source emanates, it is possible to get reproducible and semiquantitative images. The simplicity and minimal background signal of optical CCD luciferase approach may complement the detailed tomographic imaging of MicroPET and the newer confocal microscopy techniques and, ultimately, be more predictive of gene transfer strategies in the treatment of human disease. AcknovNfledgments We thank Drs. Steven M. Dubinett and Charles L. Sawyers in the Department of Medicine, Dr. Robert E. Reiter in the Department of Urology, and Dr. Sanjiv Gambhir in the Department of Molecular and Medical Pharmacology at the UCLA School of Medicine for thoughtful advice. This project has been supported by the Veterans Administration-Career Development Av^ard and Medical Research Funds (R.K.B.), NIH-R01-CA78654 (R.K.B.), Cahfornia Cancer Research Program (L.W.), Department of Army (L.W.), the UCLA-Jonsson Comprehensive Cancer Center, and the UCLA-Gene Medicine Program. 18. Utilify of Ad Vectors in Animal Models 1: Cancer 5 5 3 References 1. Malkinson, A. M. (1998). Molecular comparison of human and mouse pulmonary adeno carcinomas. Exp. Lung Res. 24, 541. 2. Sellers, T. A., Bailey-Wilson, J. E., Elston, R. C , Wilson, A. F., Elston, G. Z., Ooi, W. L., and Rothschild, H. (1990). Evidence for mendelian inheritance in the pathogenesis of lung cancer. / . Natl. Cancer Inst. 82, 1272. 3. Schwartz, A. G., Yang, P., and Swanson, G. M. (1996). Famihal risk of lung cancer among nonsmokers and their relatives. Am. J. Epidemiol. 144, 554. 4. Carbone, D. (1997). The biology of lung cancer. Semin. Oncol. 24, 388. 5. Salgia, R., and Skarin, A. T. (1998). Molecular abnormalities in lung cancer./. Clin. Oncol. 16, 1207. 6. Dubinett, S. M., Miller, P. W., Sharma, S., and Batra., R. K. (1998). Gene therapy for lung cancer. Hematol. Oncol. Clin. North Am. 12, 569. 7. Sethi, T. (1997). Science, medicine, and the future. Lung cancer. Br. Med. J. 314, 652. 8. Shopland, D. R., Eyre, H. J., and Pechacek., T. F. (1991). Smoking-attributable cancer mor tality in 1991: Is lung cancer now the leading cause of death among smokers in the United States? / . Natl. Cancer Inst. 83, 1142. 9. Sozzi, G., Miozzo, M., Pastorino, U., Pilotti, S., Donghi, R., Giarola, M., De Gregorio, L., Manenti, G., Radice, P., Minoletti, F., et al. (1995). Genetic evidence for an independent origin of multiple preneoplastic and neoplastic lung lesions. Cancer Res. 55, 135. 10. Mao, L., Lee, J. S., Kurie, J. M., Fan, Y. H., Lippman, S. M., Lee, J. J., Ro, J. Y., Brox- son. A., Yu, R., Morice, R. C., Kemp, B. L., Khuri, F. R., Walsh, G. L., Hittelman, W. N., and Hong., W. K. (1997). Clonal genetic alterations in the lungs of current and former smokers. / . Natl. Cancer Inst. 89, 857. 11. Wistuba, II, Lam, S., Behrens, C., Virmani, A. K., Fong, K. M., LeRiche, J., Samet, J. M., Srivastava, S., Minna, J. D., and Gazdar., A. F. (1997). Molecular damage in the bronchial epithelium of current and former smokers. / . Natl. Cancer Inst. 89, 1366. 12. Batra, R., Sharma, S., and Dubinett., S. (2000). New gene and cell-based therapies for lung cancer. Semin. Resp. Med. 21, 463. 13. Slebos, R., Kibbelaar, R., Dalesio, O., Kooistra, A., Stam, J., Meijer, C., Wagenaar, S., Van- derschueren, R., van Zandwijk, N., Mooi, W., et al. (1990). K-ras oncogene activation as a prognostic marker in adenocarcinoma of the lung. N. Engl. J. Med. 323, 561. 14. Mitsudomi, T., Steinberg, S. M., Nau, M. M., Carbone, D., D'Amico, D., Bodner, S., Oie, H. K., Linnoila, R. I., Mulshine, J. L., Minna, J. D., et al. (1992). p53 gene mutations in non-small-cell lung cancer cell lines and their correlation with the presence of ras mutations and clinical features. Oncogene 7, 171. 15. Kamb, A., Shattuck-Eidens, D., Eeles, R., Liu, Q., Gruis, N. A., Ding, W., Hussey, C , Tran, T., Miki, Y.,Weaver-Feldhaus, J., et al. (1994). Analysis of the p l6 gene (CDKN2) as a candidate for the chromosome 9p melanoma susceptibility locus. Nat. Genet. 8, 23. 16. Shapiro, G. I., Edwards, C. D.,Kobzik, L., Godleski, J., Richards, W., Sugarbaker, D. J., and Rollins., B. J. (1995). Reciprocal Rb inactivation and pl6INK4 expression in primary lung cancers and cell lines. Cancer Res. 55, 505. 17. Sozzi, G., Veronese, M. L., Negrini, M., Baffa, R., CotticelU, M. G., Inoue, H., TornieUi, S., Pilotti, S., De Gregorio, L., Pastorino, U., Pierotti, M. A., Ohta, M., Huebner, K., and Croce., C. M. (1996). The FHIT gene 3pl4.2 is abnormal in lung cancer. Cell 85, 17. 18. Pezzella, F., Turley, H., Kuzu, I., Tungekar, M. F., Dunnill, M. S., Pierce, C. B., Harris, A., Gatter, K. C , and Mason., D. Y. (1993). bcl-2 protein in non-small-cell lung carcinoma. N. Engl. J. Med. 329, 690. 19. Kern, J. A., Schwartz, D. A., Nordberg, J. E., Weiner, D. B., Greene, M. I., Torney, L., and Robinson., R. A. (1990). pl85neu expression in human lung adenocarcinomas predicts shortened survival. Cancer Res. 50, 5184. 5 5 4 Batra ef al. 20. Sundaresan, V., Ganly, P., Hasleton, P., Rudd, R., Sinha, G., Bleehen, N. M., and Rab- bitts., P. (1992). p53 and chromosome 3 abnormalities, characteristic of maUgnant lung tumours, are detectable in preinvasive lesions of the bronchus. Oncogene 7, 1989. 21. Marchetti, A., Pellegrini, S., Bertacca, G., Buttitta, F., Gaeta, P., CarniceUi, V., Nardini, V., Griseri, P., Chella, A., Angeletti, C. A., and G. Bevilacqua. (1998). FHIT and p53 gene abnormalities in bronchioloalveolar carcinomas. Correlations with clinicopathological data and K-ras mutations./. Pathol. 184, 240. 22. Kerr, K. M., Carey, F. A., King, G., and Lamb., D. (1994). Atypical alveolar hyperplasia: relationship v^ith pulmonary adenocarcinoma, p53, and c-erbB-2 expression./. Pathol. 174, 249. 23. Westra, W. H., Baas, I. O., Hruban, R. H., Askin, F. B., Wilson, K., Offerhaus, G. J., and Slebos., R. J. (1996). K-ras oncogene activation in atypical alveolar hyperplasias of the human lung. Cancer Res. 56, 2224. 24. Cooper, C. A., Carby, F. A., Bubb, V. J., Lamb, D., Kerr, K. M., and Wyllie, A. H. (1997). The pattern of K-ras mutation in pulmonary adenocarcinoma defines a new pathway of tumour development in the human lung. / . Pathol. 181, 401. 25. Mao, L., Hruban, R. H., Boyle, J. O., Tockman, M., and Sidransky., D. (1994). Detection of oncogene mutations in sputum precedes diagnosis of lung cancer. Cancer Res. 54, 1634. 26. Yesner, R. (1993). Pathogenesis and pathology. Clin. Chest Med. 14, 17. 27. Tuveson, D. A., and Jacks, T. (1999). Modeling human lung cancer in mice: Similarities and shortcomings. Oncogene 18, 5318. 28. Witschi, H. (1998). Tobacco smoke as a mouse lung carcinogen. Exp. Lung Res. 24, 385. 29. Malkinson, A., and Belinsky, S. (1996). The use of animal models in prechnical studies. In "Lung Cancer: Principles and Practice" (Pass, H., Mitchell, J., Johnson, D., and Turrisi, A., Eds.). Lippincott-Raven, Philadelphia. 30. Stoner, G. D. (1998). Introduction to mouse lung tumorigenesis. Exp. Lung Res. 24, 375. 31. Shimkin, M. B., and Stoner., G. D. (1975). Lung tumors in mice: Application to carcinogen esis bioassay. Adv. Cancer Res. 21, 1. 32. Malkinson, A. M. (1992). Primary lung tumors in mice: An experimentally manipulable model of human adenocarcinoma. Cancer Res. 52, 2670s. 33. Sharma, S., Miller, P., Stolina, M., Zhu, L., Huang, M., Paul, R., and Dubinett., S. (1997). Multi-component gene therapy vaccines for lung cancer: Effective eradication of estabhshed murine tumors in vivo with Interleukin 7 / Herpes Simplex Thymidine Kinase-transduced autologous tumor and ex t^/Vo-activated dendritic cells. Gene Ther. 4, 1361. 34. Miller, P. W., Sharma, S., Stolina, M., Chen, K., Zhu, L., Paul, R. W., and Dubinett., S. M. (1998). Dendritic cells augment granulocyte-macrophage colony-stimulating factor (GM- CSF)/herpes simplex virus thymidine kinase-mediated gene therapy of lung cancer. Cancer Gene Ther. 5, 380. 35. Sharma, S., Stolina, M., Lin, Y., Gardner, B., Miller, P. W., Kronenberg, M., and Dubi nett., S. M. (1999). T cell-derived IL-10 promotes lung cancer growth by suppressing both T cell and APC function. / . Immunol. 163, 5020. 36. Sharma, S., Stolina, M., Luo, J., Strieter, R. M., Burdick, M., Zhu, L. X., Batra, R. K., and Dubinett., S. M. (2000). Secondary lymphoid tissue chemokine mediates T cell-dependent antitumor responses in vivo. / . Immunol. 164, 4558. 37. Miller, P. W., S. Sharma, Stolina, M., Butterfield, L. H., Luo, J., Lin, Y., Dohadwala, M., Batra, R. K., Wu, L., Economou, J. S., and Dubinett., S. M. (2000). Intratumoral adminis tration of adenoviral interleukin 7 gene-modified dendritic cells augments specific antitumor immunity and achieves tumor eradication. Hum. Gene Ther. 11, 53. 38. Stolina, M., Sharma, S., Lin, Y., Dohadwala, M., Gardner, B., Luo, J., Zhu, L., Kronen berg, M., Miller, P., Lee, J., and Dubinett., S. (2000). Specific inhibition of cyclooxygenase 2 restores antitumor immunity by altering the balance of IL-10 and IL-12 synthesis. / . Immunol. 164, 361. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 5 39. Herzog, C. R., Lubet, R. A., and You., M. (1997). Genetic alterations in mouse lung tumors: Implications for cancer chemoprevention./. Cell Biochem. (Suppl. 28-29), 49. 40. Chen, B.,Johanson, L., Wiest,J. S., Anderson, M. W., and You., M. (1994). The second intron of the K-ras gene contains regulatory elements associated with mouse lung tumor susceptibility. Proc. Natl Acad. Set. USA 91, 1589. 41. You, M., Candrian, U., Maronpot, R. R., Stoner, G. D., and Anderson., M. W. (1989). Activation of the Ki-ras protooncogene in spontaneously occurring and chemically induced lung tumors of the strain A mouse. Proc. Natl. Acad. Set. USA 86, 3070. 42. Herzog, C. R., Wiseman, R. W., and M. You. (1994). Deletion mapping of a putative tumor suppressor gene on chromosome 4 in mouse lung tumors. Cancer Res. 54, 4007. 43. Wiseman, R. W., C. Cochran, Dietrich, W., Lander, E. S., and Soderkvist., P. (1994). Allelo- typing of butadiene-induced lung and mammary adenocarcinomas of B6C3F1 mice: Frequent losses of heterozygosity in regions homologous to human tumor-suppressor genes. Proc. Natl. Acad. Sci. USA 91, 3759. 44. Horio, Y., Chen, A., Rice, P., Roth, J. A., Malkinson, A. M., and Schrump., D. S. (1996). Ki- ras and p53 mutations are early and late events, respectively, in urethane-induced pulmonary carcinogenesis in A/J mice. Mol. Carcinog. 17, 217. 45. Hecht, S. S., Morse, M. A., Amin, S., Stoner, G. D., Jordan, K. G., Choi, C. I., and Chung., F. L. (1989). Rapid
single-dose model for lung tumor induction in A/J mice by 4-(methylnitrosamino)-l-(3-pyridyl)-l-butanone and the effect of diet. Carcinogenesis 10, 1901. 46. Kim, S. H., and Lee., C. S. (1996). Induction of benign and malignant pulmonary tumours in mice with benzo(a)pyrene. Anticancer Res. 16, 465. 47. Batra, R., Olsen, J., Pickles, R., Hoganson, S., and Boucher., R. (1998). Transduction of non-small cell lung cancer cells by adenoviral and retroviral vectors. Am. J. Respir. Cell Mol. Biol. 18, 402. 48. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., and Finberg., R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320. 49. Hutchin, M. E., Pickles, R. J., and Yarbrough., W. G. (2000). Efficiency of adenovirus- mediated gene transfer to oropharyngeal epithelial cells correlates with cellular differentiation and human coxsackie and adenovirus receptor expression. Hum. Gene Ther. 11, 2365. 50. Compere, S. J., Baldacci, P., and Jaenisch., R. (1988). Oncogenes in transgenic mice. Biochim. Biophys. Acta 948, 129. 51. Kao, C , Huang, J., Wu, S. Q., Hauser, P., and Reznikoff., C. A. (1993). Role of SV40 T antigen binding to pRB and p53 in multistep transformation in vitro of human uroepithelial cells. Carcinogenesis 14, 2297. 52. Levine, A. J., and Momand., J. (1990). Tumor suppressor genes: the p53 and retinoblastoma sensitivity genes and gene products. Biochim. Biophys. Acta 1032, 119. 53. Wikenheiser, K., J. Clark, Linnoila, R., Stahlman, M., and Whitsett., J. (1992). Simian virus 40 large T antigen directed by transcriptional elements of the human surfactant protein C gene produces pulmonary adenocarcinomas in transgenic mice. Cancer Res. 52, 5342. 54. Wikenheiser, K., and Whitsett., J. (1997). Tumor progression and cellular differentiation of pulmonary adenocarcinomas in SV40 large T antigen transgenic mice. Am. J. Respir. Cell Mol. Biol. 16, 713. 55. Sandmoller, A., R. Halter, Suske, G., Paul, D., and Beato,, M. (1995). A transgenic mouse model for lung adenocarcinoma. Cell Growth Differ. 6, 97. 56. Magdaleno, S., Wang, G., Mireles, V., Ray, M., Finegold, M., and Demayo., F. (1997). Cyclin-dependent kinase inhibitor expression in pulmonary clara cells transformed with SV40 large t antigen in transgenic mice. Cell Groivth Differ. 8, 145. 57. Gabrilovich, D. I., Chen, H. L., Girgis, K. R., Cunningham, H. T., Meny, G. M., Nadaf, S., Kavanaugh, D., and Carbone., D. P. (1996). Production of vascular endothehal growth 5 5 6 Batra ef aL factor by human tumors inhibits the functional maturation of dendritic cells. Nature Med. 2, 1096. 58. Rygaard, J., and Povlsen., C. O. (1969). Heterotransplantation of a human malignant tumour to "Nude" mice. Acta Pathol. Microbiol. Scand. 77, 758. 59. Pantelouris, E. M. (1968). Absence of thymus in a mouse mutant. Nature 217, 370. 60. Povlsen, C. 0.,Visfeldt, J., Rygaard, J., and Jensen., G. (1975). Growth patterns and chro mosome constitutions of human malignant tumours after long-term serial transplantation in nude mice. Acta Pathol. Microbiol. Scand. [A] 83, 709. 61. Shimosato, Y., Kameya, T., and Hirohashi., S. (1979). Growth, morphology, and function of xenotransplanted human tumors. Pathol. Annu. 14(2), 215. 62. Fidler, I. J. (1986). Rationale and methods for the use of nude mice to study the biology and therapy of human cancer metastasis. Cancer Metastasis Rev. 5, 29. 63. Bepler, G., and Neumann., K. (1990). Nude mouse xenografts as in vivo models for lung carcinomas. In Vivo 4, 309. 64. Kyriazis, A. P.,DiPersio, L., Michael, J. G., and Pesce., A. J. (1979). Influence of the mouse hepatitis virus (MHV) infection on the growth of human tumors in the athymic mouse. Int. ]. Cancer 23, 402. 65. Reed, N. D., Manning, J. K., Baker, P. J., and Ulrich., J. T. (1974). Analysis of 'thymus- independent' immune responses using nude mice. In "Proceedings of the First International Workshop on Nude Mice" (J. Rygaard and C O . Povlsen, Eds.), pp. 95-103. Verlag, Stuttgart. 66. Hanna, N. (1982). Role of natural killer cells in control of cancer metastasis. Cancer Metastasis Rev. 1, 45. 67. Hanna, N., and Burton., R. C. (1981). Definitive evidence that natural killer (NK) cells inhibit experimental tumor metastases in vivo. / . Immunol. 127, 1754. 68. Talmadge, J. E., Meyers, K. M., Prieur, D. J., and Starkey., J-. R. (1980). Role of NK cells in tumour growth and metastasis in beige mice. Nature 284, 622. 69. Bosma, G. C., Custer, R. P., and Bosma., M. J. (1983). A severe combined immunodeficiency mutation in the mouse. Nature 301, 527. 70. Bosma, M. J., and Carroll., A. M. (1991). The SCID mouse mutant: definition, characteri zation, and potential uses. Annu. Rev. Immunol. 9, 323. 71. Reddy, S., Piccione, D., Takita, H., and Bankert., R. B. (1987). Human lung tumor growth established in the lung and subcutaneous tissue of mice with severe combined immunodefi ciency. Cancer Res. 47, 2456. 72. Williams, S. S., Alosco, T. R., Croy, B. A., and Bankert, R. B. (1993). The study of human neoplastic disease in severe combined immunodeficient mice. Lab. Anim. Sci. 43, 139. 73. Croy, B. A., Percy, D. H., and Smith., A. L. (1993). What are scid mice and why is it timely to devote a special topic issue to them? Lab. Anim. Sci. 43, 120. 74. Mak, T. W., Rahemtulla, A., Schilham, M., Koh, D. R., and Fung-Leung., W. P. (1992). Generation of mutant mice lacking surface expression of CD4 or CD8 by gene targeting. / . Autoimmun. 5 (Suppl A), SS. 75. KoUer, B. H., and Smithies., O. (1992). Altering genes in animals by gene targeting. Annu. Rev. Immunol. 10, 705. 76. Hoganson, D., Matsui, H., Batra, R., and Boucher., R. (1998). Toxin gene-mediated growth inhibition of lung adenocarcinoma in an animal model of pleural malignancy. Hum. Gene Ther.9, 1143. 77. Roth, J. A., Nguyen, D., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Person, D. Z., Hong, W. K., Komaki, R., Lee, J. J., Nesbitt, J. C , Pisters, K. M., Putnam, J. B., Schea, R., Shin, D. M., Walsh, G. L., Dolormente, M. M., Han, C. I., Martin, F. D., Yen, N., Xu, K., Stephens, L. C , McDonnell, T. J., Mukhopadhyay, T., and Cai., D. (1996). Retrovirus- mediated wild-type p53 gene transfer to tumors of patients with lung cancer. Nat. Med. 2, 985. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 5 7 78. Qazilbash, M., Xiao, X., Cowan, K., and Walsh., C. (1997). Cancer gene therapy using a novel adeno-associated virus vector expressing human wild-type p53. Gene Ther. 4, 675. 79. Takahashi, T., Carbone, D., Takahashi, T., Nau, M., Hida, T., Linnoila, I., Ueda, R., and Minna., J. (1992). Wild-type but not mutant p53 suppresses the growth of human lung cancer cells bearing multiple genetic lesions. Cancer Res. 52, 2340. 80. Freeman, S. M., Abboud, C. N., Whartenby, K. A., Packman, C. H., Koeplin, D. S., Moolten, F. L., and Abraham., G. N. (1993). The "bystander effect": Tumor regression when a fraction of the tumor mass is genetically modified. Cancer Res. 53, 5274. 81. Nishizaki, M., Fujiwara, T., Tanida, T., Hizuta, A., Nishimori, H., Tokino, T., Naka- mura, Y., Bouvet, M., Roth, J. A., and Tanaka., N. (1999). Recombinant adenovirus express ing wild-type p53 is antiangiogenic: A proposed mechanism for bystander effect. Clin. Cancer Res. 5, 1015. 82. Chen, H., and Carbone., D. (1997). p53 as a target for anti-cancer immunotherapy, Mol. Med. Today 3, 7. 83. Vierboom, M. P., Nijman, H. W., Offringa, R., van der Voort, E. I., van Hall, T., van den Broek, L., Fleuren, G. J., Kenemans, P., Kast, W. M., and Melief., C. J. (1997). Tumor eradication by wild-type p53-specific cytotoxic T lymphocytes./, Exp. Med. 186, 695. 84. Swisher, S. G., Roth, J. A., Nemunaitis, J., Lawrence, D. D., Kemp, B. L., Carrasco, C. H., Connors, D. G., El-Naggar, A. K,, Fossella, F., Glisson, B. S., Hong, W. K., Khuri, F. R., Kurie, J. M., Lee, J. J., Lee, J. S., Mack, M., Merritt, J. A., Nguyen, D. M., Nesbitt, J. C , Perez-Soler, R., Pisters, K. M., Putnam, J. B., Jr., Richli, W. R., Savin, M., Waugh, M. K,, and et al. (1999). Adenovirus-mediated p53 gene transfer in advanced non-small-cell lung cancer. / . Natl. Cancer Inst. 91, 763. 85. Bischoff, J. R., Kirn, D. H., Wilhams, A., Heise, C , Horn, S., Muna, M., Ng, L., Nye, J. A., Sampson-Johannes, A., Fattaey, A., and McCormick., F. (1996). An adenovirus mutant that replicates selectively in p53-deficient human tumor cells. Science 274, 7. 86. Heise, C , Sampson-Johannes, A., Williams, A., McCormick, F., Von Hoff, D., and Kirn., D. (1997). ONYX-015, an ElB gene-attenuated adenovirus, causes tumor-specific cytolysis and antitumoral efficacy that can be augmented by standard chemotherapeutic agents. Nat. Med. 3, 639. 87. Hall, A. R., Dix, B. R., S. J.O'Carroll, and Braithwaite,, A. W. (1998). p53-dependent cell death/apoptosis is required for a productive adenovirus infection. Nat. Med. 4, 1068. 88. Harada, J. N., and Berk., A. J. (1999). p53-Independent and -dependent requirements for ElB-55 K in adenovirus type 5 replication. / . Virol. 73, 5333. 89. Rothmann, T., A. Hengstermann, Whitaker, N. J., Scheffner, M., and zur Hansen., H. (1998). Replication of ONYX-015, a potential anticancer adenovirus, is independent of p53 status in tumor cells. / . Virol. 72, 7. 90. Fearon, E., Pardoll, D., Itaya, T,, Golumbek, P., Levitsky, H., Simons, J., Karasuyama, H., Vogelstein, B., and Frost., P. (1990). Interleukin-2 production by tumor cells bypasses T helper function in the generation of an antitumor response. Cell 60, 397. 91. Alhone, A., Consalvo, M., Nanni, P., Lollini, P. L,, Cavallo, F., GiovareUi, M., Forni, M., Guhno, A., Colombo, M. P., Dellabona, P., Hock, H., Blankenstein, T., Rosenthal, F. M., Gansbacher, B., Bosco, M. C , Musso, T., Gusella, L., and Forni., G. (1994), Immunizing and curative potential of replicating and nonreplicating murine mammary adenocarcinoma cells engineered with interleukin (IL)-2, IL-4, IL-6, IL-7, IL-10, tumor necrosis factor alpha, granulocyte-macrophage colony-stimulating factor, and gamma-interferon gene or admixed with conventional adjuvants. Cancer Res. 54, 6022. 92. Bottazzi, B., Walter, S., Govoni, D., Colotta, F., and Mantovani., A. (1992). Monocyte chemotactic cytokine gene transfer modulates macrophage infiltration, growth, and suscep tibility to IL-2 therapy of a murine melanoma. / . Immunol. 148, 1280. 5 5 8 Batra et aL 93. Colombo, M. P., Ferrari, G., Stoppacciaro, A., Parenza, M., Rodolfo, M., Mavilio, F., and Parmiani., G. (1991). Granulocyte colony-stimulation factor (G-CSF) gene transfer suppress tumorigenicity of a murine adenocarcinoma in vivo. / . Exp. Med. 173, 889. 94. Heike, Y., Takahashi, M., Kanegae, Y., Sato, Y., Saito, L, and Saijo., N. (1997). Interleukin- 2 gene transduction into freshly isolated lung adenocarcinoma cells with adenoviral vectors. Hum. Gene Ther. 8, 1. 95. Zitvogel, L., Tahara, H., Robbins, P., et al. (1995). Cancer immunotherapy of established tumors v^ith IL-12: effective delivery by genetically engineered fibroblasts. / . Immunol. 155, 1393. 96. Dranoff, G., Jaffee, E., Lazenby, A., Golumbek, P., Levitsky, H., Brose, K., Jackson, V., Hamada, H., PardoU, D., and Mulligan., R. C. (1993). Vaccination with irradiated tumor cells engineered to secrete murine granulocyte-macrophage colony-stimulating factor stimu lates potent, specific, and long-lasting anti-tumor immunity. Proc. Natl. Acad. Sci. USA 90, 3539. 97. Sharma, S., Wang, J., Huang, M., Paul, R., Lee, P., McBride, W., Economou, J., Roth, M., Kiertscher, S., and Dubinett., S. (1996). Interleukin-7 gene transfer in non-small cell lung cancer decreases tumor proliferation, modifies cell surface molecule expression, and enhances antitumor reactivity. Can. Gene Ther. 3, 302. 98. Sica, D., Rayman, P., Stanley, J., Edinger, M., Tubbs, R. R., Klein, E., Bukowski, R., and Finke., J. H. (1993). Interleukin 7 enhances the proliferation and effector function of tumor- infiltrating lymphocytes from renal-cell carcinoma. Int. J. Cancer 53, 941. 99. Yoshino, L, Goedegebuure, P. S., Peoples, G. E., Parikh, A. S., DiMaio, J. M., Lyerly, H. K., Gazdar, A. F., and Eberlein., T.J. (1994). HER2/neu-derived peptides are shared antigens among human non-small cell lung cancer and ovarian cancer. Cancer Res. 54, 3387. 100. Restifo, N. P., Esquivel, F., Kawakami, Y., Yewdell, J. W., Mule, J. J., Rosenberg, S. A., and Bennink, J. R. (1993). Identification of human cancers deficient in antigen processing./. Exp. Med. 177, 265. 101. Huang, A. Y. C , Golumbek, P., Ahmadzadeh, M., Jaffee, E., PardoU, D., and Levitsky., H. (1994). Role of bone marrow-derived cells in
presenting MHC class Lrestricted tumor antigens. Science 264, 961. 102. Caux, C , Liu, Y., and Banchereau., J. (1995). Recent advances in the study of dendritic cells and follicular dendritic cells. Immunol. Today 16, 2. 103. Steinman, R. M. (1991). The dendritic cell system and its role in immunogenicity. Annu. Rev. Immunol. 9, 271. 104. Hsu, F., Benike, C , Fagnoni, F., Files, T., Czerwinski, D., Taidi, B., Fugleman, E., and Levy., R. (1996). Vaccination of patients with B-cell lymphoma using autologous antigen- pulsed dendritic cells. Nat. Med. 2, 52. 105. Nestle, F., Alijagic, S., Gilliet, M., Sun, Y., Grabbe, S., Dummer, R., Burg, G., and Schaden- dorf., D. (1998). Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4, 328. 106. Ribas, A., Butterfield, L., McBride, W., Jilani, S., Bui, L., VoUmer, C , Lau, R., Dissette, V., Hu, B., A. Chen, Glaspy, J., and Economou., J. (1997). Genetic immunization for the melanoma antigen MART-1/Melan-A using recombinant adenovirus-transduced murine dendritic cells. Cancer Res. 57, 2865. 107. Arthur, J., Butterfield, L., Roth, M., Bui, L., Kiertscher, S., Lau, R., Dubinett, S., Glaspy, J., McBride, W., and Economou., J. (1997). A comparison of gene transfer methods in human dendritic cells. Cancer Gene Ther. 4, 17. 108. Bolon, L, Devouassoux, M., Robert, C , Moro, D., Brambilla, C , and Brambilla., E. (1997). Expression of urokinase-type plasminogen activator, stromelysin 1, stromelysin 3, and matrilysin genes in lung carcinomas. Aw. / . Pathol. 150, 1619. 18. Utility of Ad Vectors in Animal Models I: Cancer 5 5 9 109. Garbisa, S., Scagliotti, G., Masiero, L., Di Francesco, C., Caenazzo, C., Onisto, M., Micela, M., Stetler-Stevenson, W., and Liotta., L. (1992). Correlation of serum metallo- proteinase levels with lung cancer metastasis and response to therapy. Cancer Res. 52, 4548. 110. Kawano, N., Osawa, H., Ito, T., Nagashima, Y., Hirahara, F., Inayama, Y., Nakatani, Y., Kimura, S., Kitajima, H., Koshikawa, N., Miyazaki, K., and Kitamura., H. (1997). Expres sion of gelatinase A, tissue inhibitor of metalloproteinases-2, matrilysin, and trypsin(ogen) in lung neoplasms: An immunohistochemical study. Hum. Pathol. 28, 613. 111. Mari, B., Anderson, I., Mari, S., Ning, Y., Lutz, Y., Kobzik, L., and Shipp., M. (1998). Stromelysin-3 is induced in tumor/stroma cocultures and inactivated via a tumor-specific and basic fibroblast grov^th factor-dependent mechanism./. Biol. Chem. 273, 618. 112. DeClerck, Y., Perez, N., Shimada, H., Boone, T., Langley, K., and Taylor., S. (1992). Inhi bition of invasion and metastasis in cells transfected with an inhibitor of metalloproteinases. Cancer Res. 52, 701. 113. Noel, A., Lefebvre, O., Maquoi, E., VanHoorde, L., Chenard, M., Mareel, M., Foidart, J., Basset, P., and Rio., M. (1996). Stromelysin-3 expression promotes tumor take in nude mice. / . Clin. Invest. 97, 1924. 114. Skobe, M., Rockwell, P., Goldstein, N., Vosseler, S., and Fusenig., N. (1997). Halting angio- genesis suppresses carcinoma cell invasion. Nat. Med. 3, 1222. 115. Folkman, J. (1995). Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1, 27. 116. Fontanini, G., Vignati, S., Lucchi, M., Mussi, A., Calcinai, A., Boldrini, L., Chine, S., ilvestri, V., Angeletti, C , Basolo, F., and Bevilacqua., G. (1997). Neoangiogenesis and p53 protein in lung cancer: Their prognostic role and their relation with vascular endothelial growth factor (VEGF) expression. Br. J. Cancer 75, 1295. 117. O'Reilly, M. S., Holmgren, L., Shing, Y., Chen, C , Rosenthal, R. A., Moses, M., Lane, W. S., Cao, Y., Sage, E. H., and Folkman., J. (1994). Angiostatin: A novel angiogenesis inhibitor that mediates the suppression of metastases by a Lewis lung carcinoma. Cell 79, 315. 118. O'Reilly, M. S., Boehm, T., Shing, Y., Fukai, N., Vasios, G., Lane, W. S., Flynn, E., Birk- head, J. R., Olsen, B. R., and Folkman., J. (1997). Endostatin: An endogenous inhibitor of angiogenesis and tumor growth. Cell 88, 277. 119. Cyster, J. (1999). Chemokines and cell migration in secondary lymphoid organs. Science 286, 2098. 120. Ohta, Y., Watanabe, Y., Murakami, S., Oda, M., Hayashi, Y., Nonomura, A., Endo, Y., and Sasaki., T. (1997). Vascular endothehal growth factor and lymph node metastasis in primary lung cancer. Br. } . Cancer 76, 1041. 121. Arenberg, D., Polverini, P., Kunkel, S., Shanafelt, A., Hesselgesser, J., Horuk, R., and Stri cter., R. (1997). The role of CXC chemokines in the regulation of angiogenesis in non-small cell lung cancer. / . Leukocyte Biol. 62, 554. 122. Arenberg, D., Kunkel, S., Polverini, P., Glass, M., Burdick, M., and Stricter., R. (1996). Inhibition of Interleukin-8 reduces tumorigenesis of human non-small cell lung cancer in SCID mice. / . Clin. Invest. 97, 2792. 123. Hynes, R. (1992). Integrins: Versatility, modulation, and signaling in cell adhesion. Cell 69, 11. 124. Leavesley, P., Schwartz, M., Rosenfeld, M., and Cheresh., D. (1993). Integrin bl- and b3- mediated endothelial cell migration is triggered through distinct signaling mechanisms. / . Cell Biol. 121,163. 125. Brooks, P., Montgomery, A., Rosenfeld, M., Reisfeld, R., Hu, T., Klier, G., and Cheresh., D. (1994). Integrin avb3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79, 1157. 126. Arap, W.,Pasqualini, R., and Ruoslahti., E. (1998). Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science 279, 377. 5 6 0 Batra ef a/. 127. Wang, C. -Y., Mayo, M. W., and Baldwin., A. S. J. (1996). TNF- and cancer therapy-induced apoptosis: Potentiation by inhibition of NF-kB. Science 274, 784. 128. Batra, R. K., Guttridge, D. C , Brenner, D. A., Dubinett, S. M., Baldwin, A. S., and Boucher., R. C. (1999). IkappaBalpha gene transfer is cytotoxic to squamous-cell lung cancer cells and sensitizes them to tumor necrosis factor-alpha-mediated cell death. Am. ]. Respir. Cell Mol. Biol. 21, 238. 129. Kim, J. H., Kim, S. H., Brown, S. L., and Freytag., S. O. (1994). Selective enhancement be an antiviral agent of the radiation-induced cell killing of human glioma cells transduced with HSV-tk gene. Cancer Res. 54, 6053. 130. McBride, W., and Dougherty., G. (1995). Radiotherapy for genes that cause cancer. Nat. Med. 1, 1215. 131. Hanna, N., Mauceri, H., Wayne, J., Hallahan, D., Kufe, D., and Weichselbaum., R. (1997). Virally directed cytosine deaminase/5-fluorocytosine gene therapy enhances radiation res ponse in human cancer xenografts. Cancer Res. 57, 4205. 132. Mcllwrath, A., Vasey, P., Ross, G., and Brown., R. (1994). Cell cycle arrests and radiosen- sitivity of human tumor cell lines: Dependence on wild-type p53 for radiosensitivity. Cancer Res. 54,3718. 133. Gallardo, D., Drazen, Z. E., and McBride., W. H. (1996). Adenovirus-based Transfer of Wild-Type p53 Gene Increases Ovarian Tumor Radiosensitivity. Cancer Res. 56, 4891. 134. Nguyen, D., Spitz, F., Yen, N., Cristiano, R., and Roth., J. (1996). Gene therapy for lung cancer: enhancement of tumor suppression by a combination of sequential systemic cisplatin and adenovirus-mediated p53 gene transfer./. Thorac. Cardiovasc. Surg. 112, 1372. 135. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel., D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574. 136. Wickham, T., Roelvink, P., Brough, D., and Kovesdi., I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570. 137. Jones, G. W., Mettlin, C., Murphy, G. P., Guinan, P., Herr, H. W., Hussey, D. H., Chmiel, J. S., Fremgen, A. M., Clive, R. E., Zuber-Ocwieja, K. E., et al. (1995). Patterns of care for carcinoma of the prostate gland: Results of a national survey of 1984 and 1990. / . Am. Coll. Surg. 180, 545. 138. Noble, R. L. (1977). The development of prostatic adenocarcinoma in Nb rats following prolonged sex hormone administration. Cancer Res. 37, 1929. 139. Voigt, W., and Dunning, W. F. (1974). In vivo metabohsm of testosterone-3 H in R-3327, an androgen-sensitive rat prostatic adenocarcinoma. Cancer Res. 34, 1447. 140. Greenberg, N. M., DeMayo, F., Finegold, M. J., Medina, D., Tilley, W. D., Aspinall, J. O., Cunha, G. R., Donjacour, A. A., Matusik, R. J., and Rosen., J. M. (1995). Prostate cancer in a transgenic mouse. Proc. Natl. Acad. Sci. USA 92, 3439. 141. Podsypanina, K., Ellenson, L. H., Nemes, A., Gu, J., Tamura, M., Yamada, K. M., Cordon- Cardo, C., Catoretti, G., Fisher, P. E., and Parsons., R. (1999). Mutation of Pten/Mmacl in mice causes neoplasia in multiple organ systems. Proc. Natl. Acad. Sci. USA 96, 1563. 142. Zhau, H. E., Li, C. L., and Chung., L. W. (2000). Establishment of human prostate carci noma skeletal metastasis models. Cancer 88, 2995. 143. Gingrich, J. R., Barrios, R. J., Morton, R. A., Boyce, B. F., DeMayo, F. J., Finegold, M. J., Angelopoulou, R., Rosen, J. M., and Greenberg., N. M. (1996). Metastatic prostate cancer in a transgenic mouse. Cancer Res. 56, 4096. 144. Gingrich, J. R., Barrios, R. J., Kattan, M. W., Nahm, H. S., Finegold, M. J., and Green berg., N. M. (1997). Androgen-independent prostate cancer progression in the TRAMP model. Cancer Res. 57, 4687. 145. Klein, K. A., Reiter, R. E., Redula, J., Moradi, H., Zhu, X. L., Brothman, A. R., Lamb, D. J., Marcelh, M., Belldegrun, A., Witte, O. N., and Sawyers., C. L. (1997). Progression of 18. Utility of Ad Vectors in Animal Models I: Cancer 5 6 1 metastatic human prostate cancer to androgen independence in immunodeficient SCID mice. Nat. Med. 3, 402. 146. Craft, N., Chhor, C , Tran, C , Belldegrun, A., DeKernion, J., Witte, O. N., Said, J., Reiter, R. E., and Sawyers., C. L. (1999). Evidence for clonal outgrowth of androgen- independent prostate cancer cells from androgen-dependent tumors through a two-step process. Cancer Res. 59, 5030. 147. Elhs, W. J., Vessella, R. L., Buhler, K. R., Bladou, F., True, L. D., Bigler, S. A., Curtis, D., and Lange., P. H. (1996). Characterization of a novel androgen-sensitive, prostate-specific antigen-producing prostatic carcinoma xenograft: LuCaP 23. Clin. Cancer Res. 2, 1039. 148. Wainstein, M. A., He, F., Robinson, D., Kung, H. J., Schwartz, S., Giaconia, J. M., Edge- house, N. L., Pretlow, T. P., Bodner, D. R., Kursh, E. D., et al. (1994). CWR22: Androgen- dependent xenograft model derived from a primary human prostatic carcinoma. Cancer Res. 54, 6049. 149. van Weerden, W. M., de Ridder, C. M., Verdaasdonk, C. L., Romijn, J. C , van der Kwast, T. H., Schroder, F. H., and van Steenbrugge., G. J. (1996). Development of seven new human prostate tumor xenograft models and their histopathological characterization. Am. J.Pathol. 149, 1055. 150. Li, J., Yen, C , Liaw, D., Podsypanina, K., Bose, S., Wang, S. I., Puc, J., Miliaresis, C , Rodgers, L., McCombie, R., Bigner, S. H., Giovanella, B. C , Ittmann, M., Tycko, B., Hib- shoosh, H., Wigler, M. H., and Parsons., R. (1997). PTEN, a putative protein tyrosine phosphatase gene mutated in human brain, breast, and prostate cancer. Science 275, 1943. 151. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., Frye, C , Hu, R., Swedlund, B., Teng, D. H., and Tavtigian., S. V. (1997). Identification of a candidate tumour suppressor gene, MMACl, at chromosome 10q233 that is mutated in multiple advanced cancers. Nat. Genet. 15, 356. 152. Davies, M. A., Lu, Y., Sano, T., Fang, X., Tang, P., LaPushin, R., Koul, D., Bookstein, R., Stokoe, D., Yung, W. K., Mills, G. B., and Steck., P. A. (1998). Adenoviral transgene expres sion of MMAC/PTEN in human glioma cells inhibits Akt activation and induces anoikis. Cancer Res. 58, 5285. 153. Furnari, F. B., Huang, H. J., and Cavenee., W. K. (1998). The phosphoinositol phosphatase activity of PTEN mediates a serum-sensitive Gl growth arrest in glioma cells. Cancer Res. 58, 5002. 154. Haas-Kogan, D., Shalev, N., Wong, M., Mills, G., Yount, G., and Stokoe., D. (1998). Protein kinase B (PKB/Akt) activity is elevated in glioblastoma cells due to mutation of the tumor suppressor PTEN/MMAC. Curr. Biol. 8, 1195. 155. Myers, M. P.,Pass, I., Batty, L H., Van der Kaay, J., Stolarov, J. P., Hemmings, B. A., Wigler, M.H. , Downes, C. P., and Tonks., N. K. (1998). The lipid phosphatase activity of PTEN is critical for its tumor suppressor function. Proc. Natl. Acad. Sci. USA 95, 13,513. 156. Stambolic, V., Suzuki, A., de la Pompa, J. L., Brothers, G. M., Mirtsos, C , Sasaki, T., Ruland, J., Penninger, J. M., Siderovski, D. P., and Mak., T. W. (1998).
Negative regulation of PKB/Akt-dependent cell survival by the tumor suppressor PTEN. Cell 95, 29. 157. Sun, H., Lesche, R., Li, D. M., J. Liliental, Zhang, H., Gao, J., Gavrilova, N., Mueller, B., Liu, X., and Wu., H. (1999). PTEN modulates cell cycle progression and cell survival by regulating phosphatidylinositol 3,4,5,-trisphosphate and Akt/protein kinase B signaling pathway. Proc. Natl. Acad. Sci. USA 96, 6199. 158. Wu, X., Senechal, K., Neshat, M. S., Whang, Y. E., and Sawyers., C. L. (1998). The PTEN/MMAC 1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway. Proc. Natl. Acad. Sci. USA 95, 15,587. 159. Di Cristofano, A., Pesce, B., Cordon-Cardo, C , and Pandolfi., P. P. (1998). Pten is essential for embryonic development and tumour suppression. Nat. Genet. 19, 348. 5 6 2 Batra ef of. 160. Vlietstra, R. J., van Alewijk, D. C , Hermans, K. G., G. J.van Steenbrugge, and Trapman., J. (1998). Frequent inactivation of PTEN in prostate cancer cell lines and xenografts. Cancer Res. 58, 2720. 161. Whang, Y. E., Wu, X., Suzuki, H., Reiter, R. E., Tran, C., Vessella, R. L., Said, J. W., Isaacs, W. B., and Sawyers., C. L. (1998). Inactivation of the tumor suppressor PTEN/MMACl in advanced human prostate cancer through loss of expression. Proc. Natl. Acad. Sci. USA 95, 5246. 162. Trapman, J., and Brinkmann., A. O. (1996). The androgen receptor in prostate cancer. Pathol. Res. Pract. 192, 752. 163. Hobisch, A., Culig, Z., Radmayr, C., Bartsch, G., Klocker, H., and A. Hittmair. (1995). Distant metastases from prostatic carcinoma express androgen receptor protein. Cancer Res. 55,3068. 164. Gaddipati, J. P., McLeod, D. G., Heidenberg, H. B., Sesterhenn, I. A., Finger, M. J., Moul, J. W., and Srivastava., S. (1994). Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res. 54, 2861. 165. Taplin, M. E., Bubley, G. J., Shuster, T. D., Frantz, M. E., Spooner, A. E., Ogata, G. K., Keer, H. N., and Balk., S. P. (1995). Mutation of the androgen-receptor gene in metastatic androgen-independent prostate cancer. N. Engl. ]. Med. 332, 1393. 166. Visakorpi, T., Hyytinen, E., Koivisto, P., Tanner, M., Keinanen, R., Palmberg, C., Palotie, A., Tammela, T., Isola, J., and O. P. Kallioniemi. (1995). In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nat. Genet. 9, 401. 167. Zhao, X. Y., Malloy, P. J., Krishnan, A. V., Swami, S., Navone, N. M., Peehl, D. M., and Feldman., D. (2000). Glucocorticoids can promote androgen-independent growth of prostate cancer cells through a mutated androgen receptor. Nat. Med. 6, 703. 168. Craft, N., Shostak, Y., Carey, M., and Sawyers., C. L. (1999). A mechanism for hormone- independent prostate cancer through modulation of androgen receptor signaUng by the HER-2/neu tyrosine kinase. Nat. Med. 5, 280. 169. Anzick, S. L., Kononen, J., Walker, R. L., Azorsa, D. O., Tanner, M. M., Guan, X. Y., Sauter, G., Kallioniemi, O. P., Trent, J. M., and P. S. Meltzer. (1997). AIBl, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 277, 965. 170. Steiner, M. S., Zhang, Y., Carraher, J., and Lu., Y. (1999). In vivo expression of prostate- specific adenoviral vectors in a canine model. Cancer Gene Ther. 6, 456. 171. Herman, J. R., Adler, H. L., Aguilar-Cordova, E., Rojas-Martinez, A., Woo, S., Timme, T. L., Wheeler, T. M., Thompson, T. C , and Scardino., P. T. (1999). In situ gene therapy for adenocarcinoma of the prostate: a phase I clinical trial. Hum. Gene Ther. 10, 1239. 172. Rodriguez, R., Schuur, E. R., Lim, H. Y., Henderson, G. A., Simons, J. W., and Hender son., D. R. (1997). Prostate attenuated replication competent adenovirus (ARCA) CN706: A selective cytotoxic for prostate-specific antigen-positive prostate cancer cells. Cancer Res. 57,2559. 173. Gotoh, A., Ko, S. C , Shirakawa, T., Cheon, J., Kao, C , Miyamoto, T., Gardner, T. A., Ho, L. J., Cleutjens, C. B., Trapman, J., Graham, F. L., and Chung., L. W. (1998). Devel opment of prostate-specific antigen promoter-based gene therapy for androgen-independent human prostate cancer. / . JJrol. 160, 220. 174. Yu, D. C , Sakamoto, G. T., and Henderson., D. R. (1999). Identification of the transcrip tional regulatory sequences of human kallikrein 2 and their use in the construction of calydon virus 764, an attenuated replication competent adenovirus for prostate cancer therapy. Cancer Res. 59, 1498. 175. Latham, J. P., Searle, P. F., Mautner, V., and James., N. D. (2000). Prostate-specific antigen promoter/enhancer driven gene therapy for prostate cancer: Construction and testing of a tissue-specific adenovirus vector. Cancer Res. 60, 334. 18. Utility of Ad Vectors in Animal Models 1: Cancer 5 6 3 176. AumuUer, G.,Seitz, J., Lilja, H., Abrahamsson, P. A., von der Kammer, H., and Scheit., K. H. (1990). Species- and organ-specificity of secretory proteins derived from human prostate and seminal vesicles. Prostate 17, 31. 177. Huang, W., Shostak, Y., Tarr, P., Sawyers, C , and Carey., M. (1999). Cooperative assembly of androgen receptor into a nucleoprotein complex that regulates the prostate-specific antigen enhancer./. Biol. Chem. 274, 25756. 178. Reid, K. J., Hendy, S. C , Saito, J. L., Sorensen, P., and Nelson., C. C. (2000). Two classes of androgen receptor elements mediate cooperativity through allosteric interactions. / . Biol. Chem. 60, 24. 179. Shao, Y., Cherry, S. R., Farahani, K., Meadors, K., Siegel, S., Silverman, R. W., and Mars- den., P. K. (1997). Simultaneous PET and MR imaging. Phys. Med. Biol. 42, 1965. 180. Gambhir, S. S.,Barrio, J. R., Wu, L., Iyer, M., Namavari, M., Satyamurthy, N., Bauer, E., Parrish, C , MacLaren, D. C , Borghei, A. R., Green, L. A., Sharfstein, S., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1998). Imaging of adenoviral-directed herpes simplex virus type 1 thymidine kinase reporter gene expression in mice with radiolabeled ganciclovir./. Nucl. Med. 39, 2003. 181. MacLaren, D. C , Gambhir, S. S., Satyamurthy, N., Barrio, J. R., Sharfstein, S., Toyokuni, T., Wu, L., Berk, A. J., Cherry, S. R., Phelps, M. E., and Herschman., H. R. (1999). Repetitive, non-invasive imaging of the dopamine D2 receptor as a reporter gene in living animals. Gene Ther. 6, 785. 182. Gambhir, S. S., Barrio, J. R., Phelps, M. E., Iyer, M., Namavari, M., Satyamurthy, N., Wu, L., Green, L. A., Bauer, E., MacLaren, D. C , Nguyen, K., Berk, A. J., Cherry, S. R., and H. R. Herschman. (1999). Imaging adenoviral-directed reporter gene expression in living animals with positron emission tomography. Proc. Natl. Acad. Sci. USA 96, 2333. 183. Contag, P. R.,01omu, I. N., Stevenson, D. K., and Contag., C. H. (1998). Bioluminescent indicators in living mammals. Nat. Med. 4, 245. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease II: Genetic Disease Raymond John Pickles Cystic Fibrosis/Pulmonary Research and Treatment Center University of North Carolina at Chapel Hill Chapel Hill, North Carolina I. Introduction A disease at the forefront of gene therapy research over the past decade is cystic fibrosis (CF). This hereditary, single-gene-defect disease, ahhough affecting epithefial cells of multiple organs of the body, results most often in mortality due to complications associated with the lung. Cystic fibrosis lung disease has been considered as a prototypic disease state for "proof-of-concept" gene-therapy strategies. The lack of an alternative long-term treatment for the pulmonary manifestations of this disease, the accessibility of the lung via the airway lumen, and the fact that viruses known to infect the lung were being developed into nonreplicating gene transfer vectors led investigators to believe that administration of gene transfer vectors to the lung could potentially result in an effective treatment of this disease. Shortly after the cloning of the gene responsible for CF pathophysiology, two groundbreaking observations made gene therapy for CF lung disease appear imminent. First, isolated epithelial cells cultured from the airway epithelium of CF patients could be phenotypically "corrected" by transferring into the cells the cDNA corresponding to the CF gene [1-5]. Second, adenoviral (Ad) vectors engineered to express the CF gene were administered to the airways of experimental animals and transgene expression observed in cells that were considered to require "correction" [6]. These initial observations produced a flurry of scientific activity and excitement in both the gene therapy and CF ADENOVIRAL VECTORS FOR GENE THERAPY 5 6 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 6 6 Raymond John Pickles scientific communities and within 3 years of these observations the first clinical trials describing successful Ad-mediated gene transfer to the airway epithelium of CF patients in vivo were reported [7]. These promising early observations have unfortunately not withstood further investigation. After approximately 20 gene therapy clinical trials for CF lung disease (of which greater than 70% utilized Ad) it has become apparent that gene transfer to airway epithelium in vivo is not a simple procedure. The difficulty lies in the evolution of the respiratory epithelium as an effective barrier to invading pathogens entering the lung (e.g., viruses). The epithelium achieves this "barrier function" by presentation of a host of innate and cell-mediated immune systems, which for gene transfer vectors culminate in reduced uptake and expression of the transgene. In this chapter, I describe the evidence that led investigators to believe that Ad would be useful in CF lung disease, why subsequently this simplistic approach failed, and how increasing knowledge of lung biology and viral bioengineering has and will allow novel strategies to be tested. In light of this emphasis on basic research, new strategies and models will need to be tested and successful demonstration of efficiency and safety will be required before we once again enter the clinic with Ad for CF lung disease gene therapy. II. Pathophysiology of Cystic Fibrosis (CF) Lung Disease Cystic fibrosis is a multifaceted disease with major morbidity and mor tality resulting from chronic decline of lung function. This disease is the most common fatal inherited disease in Caucasians with 1 in 2500 live births affected [8]. Although CF is most devastating to the lung (accounting for 90% of mortality), resulting in chronic repetitive infections, chronic obstructive pul monary disease, and respiratory failure, other tissues are also affected, including the liver, pancreas, the gastrointestinal tract, and the sweat glands. The abnor mal CF gene (250 kb) encodes an mRNA of 6,5 kb which translates into an 180-kDa protein that has been extensively characterized as a cAMP-activated chloride ion channel, named the cystic fibrosis transmembrane conductance regulator (CFTR) [3, 9]. In the lung, CFTR is normally expressed in the respi ratory epithelium and although the specific functions of CFTR are complex, is predominately involved in maintenance of ionic homeostasis in this tissue. Over 900 different mutations of CFTR have now been reported, resulting in a range of clinical manifestations and differing severity of the disease. Flowever, 70% of these mutations are due to a three-base-pair deletion leading to the absence of phenylalanine (F) at position 508 (AF508) [10]. This particular mutation leads to misfolded CFTR being retained within the endoplasmic recticulum 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 6 7 of cells, so reducing CFTR function at the plasma membrane [11]. Currently, although the specific localization and functional capacity of AF508 CFTR in the different affected organs is a matter of controversial debate [12] and other mutations can display partial CFTR function, for CF patients, expres sion of abnormal CFTR in the airway epithelium generally results in reduced chloride ion secretion, hyperabsorption of sodium ions, increased viscosity of airw^ay secretions, impaired mucociliary clearance, chronic bacterial infection, bronchiectasis, and premature death [8, 13]. Given that all of these effects are likely primary or secondary to loss of CFTR function, the most efficacious w ây to treat the broad range of effects w^ould be to replace the defective CFTR gene w îth a normal copy. Gene therapy for CF lung disease therefore seeks to replace normal CFTR in the airv^ay epithelial cells to hopefully "correct" lung epithelium function. III. Trials and Tribulations with Adenoviral Vectors for CF Lung Disease Clinical gene transfer trials v\Aith CF patients investigating the safety and efficacy of gene transfer vectors (predominately adenoviral and liposomal vectors) have been performed in both the United States and United Kingdom. Details of these trials and the background preclinical studies have been com prehensively reviewed
in a recent review^ [14]. Although preclinical data have been largely promising for lung-directed gene transfer, the trials performed to date have show^n, at best, only partial "correction" (<20%) of the CF bioelectrical defect [7, 15-18]. This relatively low^ degree of correction is most likely due to inefficient transfer of the CFTR cDNA to the airway epithelial cells, i.e., a low efficiency of gene transfer, and is most likely not sufficient to be of benefit to CF patients although long-term reversal of disease symptoms were not monitored in this studies. The gene transfer efficiency required for physiological correction of CF lung disease has been a matter of recent debate. While Johnson and colleagues have shown that "correction" of ^^10% of CF cells restores normal chloride secretory function to an epithelium, this degree of "correction" was insufficient to correct the hyperabsorption of sodium [19]. Since "correction" of the sodium defect is likely to be necessary for resolving CF lung disease, then transduction of a higher proportion of epithelial cells will be required [1, 20]. Indeed, it has been suggested that greater than 80% of epithelial cells will have to express CFTR to restore the normal sodium transporting capabilities of the epithelium [20]. With regards to efficiency of gene expression on a per cell basis, it appears that CFTR is normally expressed at levels as low as 10 copies per cell and heterozygotes for the CF gene although expressing only 5 6 8 Raymond John Pickles 50% of normal CFTR show no disease symptoms. This suggests that the level of expression per cell does not need to be high in order to correct function. On the other hand, overexpression of CFTR has been shown to have deleterious effects on cell function although the effects on polarized airway epithelial cells are not documented [21]. Issues of safety have arisen due to elicitation of inflammatory responses after Ad instillation in both animal and human experiments [22-29]. These effects have often been due to the large "loads" of vector that has been administered. A current hypothesis is that improvements in gene transfer efficiency may allow smaller quantities of Ad to be administered, possibly circumventing much of the inflammatory response. IV. The Ainvay Epithelium: Cellular Targets for CF Gene Therapy Airway epithelial cells are present throughout the conducting airways of the lung, including the nasal, tracheal, bronchial, and bronchiolar regions. In the upper airway, the surface epithelium lines these structures and is continuous with the tubulo-acinar submucosal mucus-secreting glands that invaginate from the airway surface. Airway epithelial cell-type composition is dependent both on the regional location and on the particular species studied and the reader is referred to comprehensive reviews that describe species- specific epithelial cell distribution in more detail [30, 31]. The epithefial cell types present in the lung are numerous and include ciliated cells, mucus- secreting cells (goblet), serous cells, clara cells, and basal cells. The cell types of the alveolar structures of the lung (alveolar Types I and II cells) are not thought to participate in the pathophysiology of CF lung disease. In human airways, the upper airway regions (nasal, tracheal, bronchial) are composed of a pseudostratified mucociliary epithelium in which ciliated cells predominate with interspersed mucus-secreting goblet cells. The columnar cells overlie intermediary differentiated cells and basal cell layers which interface with the basement membrane. In addition, the human upper airways contain numerous submucosal glands. In the human lower airways, the bronchioles are lined with a simple cubiodal ciliated epithelium containing few mucus-secreting cells, no basal cells, and an absence of submucosal glands. An important morphological difference between the upper airways of human and mice, the most common animal model for investigating airway administration of gene transfer vectors, is that for the mouse upper airway (excluding the nasal cavity epithelium) the columnar cells are roughly an equal distribution of ciliated and clara cells, compared to the predominance of ciliated cells in the human upper airway [32]. Clara cells are a nonciliated bronchiolar mucus-secreting cell type with distinct 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 6 9 properties from ciliated cells. Clara cells, although present in human airway, are located only in the distal airways and account for only a fraction of the cells present in that region [32]. The airway basal cells, or at least a subpopulation, are considered to be stem cell precursors for all other airway epithelial cells in the upper airway regions. Basal cells can differentiate into mucus or ciliated cell phenotypes [33]. Whereas mucus cells may also be able to differentiate into ciliated cells, the ciliated cell is considered as a terminally redifferentiated cell type. An important observation with regard to experimental models of human airway epithelial cells is that isolation of upper airway epithelial cells for tissue culture purposes results initially in a predominately basal cell-like culture since isolated basal cells proliferate at a greater rate than isolated ciliated and mucus cells. Furthermore, for cells isolated from CF airways, the rate of proliferation of basal cells is even greater than that in normal airway, probably reflecting responses to ongoing inflammatory processes [34]. Therefore, morphological differences need to be considered when designing models to study the interactions of gene transfer vectors with airway cells that are presumed to represent the cells in the lung that are exposed to lumenally delivered vectors. Although CF is a disease of the respiratory epithelium, the exact airway region where CF lung disease initiates is still a matter of debate. It does appear that the first signs of pathology occur in the distal airways with findings of bronchiolitis and mucus plugging in the small airways and although the exact nature of how the CFTR defect initiates the disease is not totally resolved, it does appear that hydration of the periciliary fluid layer in these regions may be a major cause [35, 36]. Currently, both the airway surface columnar cells lining the lumen of the small bronchiolar airways and the serous cells of the submucosal glands are candidates for the location for the onset of the disease. The cell type that is believed to be predominately involved in the onset of disease and therefore the specific target for gene transfer is the ciliated cell since these cells exhibit all of the ion and fluid transporting functions of CFTR and display abnormal function in patients with CF [37]. However, the submucosal gland serous cell is the highest CFTR-expressing cell type in the lung, suggesting that these cells may also be an important target for gene replacement [38]. Ultimately, it will be important to determine the location of disease initiation since it is likely that for a lumenal gene therapy to be successful, administration of vector will have to occur early in the life of a CF patient. Later in life, when the airways possess overwhelming mucus plugging and associated bacterial colonization and inflammation, delivery of genes to the target cells will likely become restricted. The current thrust for CF gene therapy strategies is to deliver transgenes to target cell types before such other barriers to treatment are present. 5 7 0 Raymond John Pickles V. Adenoviral Vectors as Gene Transfer Vectors in the Lung A. Animal Models for CF Airway Gene Transfer Studies The generation of CF mouse models was an important step for under standing the physiology of CF disease. There have now been over 10 different mouse models produced displaying a range of CF-associated genetic muta tions [39]. Although most of the models reflect the most common human mutation, either a complete gene knockout or a AF508 mutation of the mouse CFTR, other models with less common human mutations (e.g., G551D) have also been reported. The multiorgan pathophysiology associated with the different models has been recently reviewed [39]. Interestingly, although the gastrointestinal phenotype of CF mice is similar to that observed in CF patients, there is no CF-like pathology associated with the CF mouse lung. A comparison of bioelectrical measurements between CF human and CF murine airways has revealed that both species exhibit, relative to normals, hyperabsorption of sodium and an absent or reduced cAMP-induced chlo ride secretory response. However, it has been deduced that the ion transport defects in the CF mouse airway do not lead to CF-like lung pathology because CF murine airways compensate for the loss of CFTR activity by upregulat- ing an alternative chloride secretory channel that is regulated by changes in intracellular calcium [40]. However, from a practical standpoint, the ability to measure the "bioelectrical defect" in CF mouse airways makes the model useful in terms of monitoring "bioelectrical correction" with gene transfer strategies, but the ability to monitor inhibition or reversal of CF-like pathology induced by transfer of normal CFTR is not possible in these current mod els. Therefore, the current gold standard for success in CF gene transfer to mouse lung in vivo is correction of the chloride (and sodium) ion transport defects. Most gene delivery strategies to murine airways have focused on the epithelium of the nasal mucosa and trachea mainly because of accessibility to these regions but also because these regions are similar to those targeted for human CF gene-therapy trials. Unfortunately, baseline bioelectric mea surements of murine trachea indicate that these tissues not display sodium hyperabsorption [41], a key indicator for the human disease, and one that will likely need to be corrected for a treatment to be successful. In contrast, the epithelium of the CF mouse nasal cavity and freshly isolated CF murine nasal mucosa both display sodium hyperabsorption and reduced cAMP-induced chloride secretory activity providing an ideal model for study [42]. A fur ther difficulty with murine airways (excluding nasal epithelium) is the large proportion of clara cells that are present throughout the upper airway. The 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 1 distribution of this cell-type in the mouse may be misleading when compar ing gene transfer efficiency between mouse and human upper airways (see below). The murine nasal mucosa, however, has few clara cells and exists as a pseudostratified mucociliary epithelium with a cell-type distribution similar to human nasal mucosa, again demonstrating the usefulness of this tissue for gene transfer studies. Therefore, in conclusion, the CF murine models do not display sponta neous or induced pathological signs of human CF lung disease. However, CF murine airways do display bioelectric abnormalities associated with human CF and correction of these parameters by gene transfer can be measured both in vitro and in vivo. Given these considerations, since most clinical trials have focused on studying gene transfer to the nasal mucosa, the CF mouse nose is considered a good model for studying these strategies. In addition, since the epithelial cell-type distribution in human nose is similar to that of the human trachea and bronchus the nasal epithelium would appear to be a good model for a large proportion of the human airway epithelium. B. Success and Limitations of Ad 1. Efficiency of Gene Transfer a. Cell Types The major cell types that support wild-type Ad infection in the lung are the epithelial cells of the respiratory mucosa lining the airway passages. The tropism of Ad to the respiratory epithelium established this vector as an obvious candidate for delivering transgenes to the lung. Indeed, Ad-mediated gene transfer to airway epithelial cells grown under standard culture conditions in vitro is highly efficient [43, 44], with cellular transduction efficiencies of 90-100% and when the transgene is CFTR, full correction of the spectrum of CF bioelectrical defects is obtained [1]. In contrast, observations from in vivo epithelial cell models derived from cartilaginous (upper airway) regions of the airways of rodents and nonhuman and human primates show that transgenes are expressed after in vivo dosing in less than 20% of the surface epithelial cells, an efficiency unlikely to benefit to the defective physiology of a CF airway [43, 45]. Although the efficiency of gene transfer can be enhanced by prolonging the contact time of Ad with the epithelium for 12-24 h, it is difficult to envision this strategy as being practical in a cfinical scenario [46, 47]. In the case of intralumenal delivery of Ad to the lower airways of rodents, gene transfer to 10-80% of the airway epithelial cells has been reported with apparently no cell-type-specific selectivity [48, 49], although, in a
detailed study of Ad administration to murine airways, only the nonciliated bronchiolar epithelial cells (i.e., Clara cells) were observed to express transgenes [50]. Clara cells are not thought to require correction in the CF lung and this observation casts a shadow on the use of murine airway epithelium as a model for Ad-mediated gene transfer to the human airway epithelium where Clara cells 572 R a y m o n d John Pickles are less common. Therefore, it appears that lumenal-facing well-differentiated airway epithelial cells in vivo^ at least in the upper airway regions, are resistant to efficient Ad-mediated gene transfer. How can we envision that the airway epithelial cells facing the lumen of the airway are not transduced by Ad given the large body of clinical data that shows that these cells are targeted in wild-type infections? In a series of studies using human tracheal epithelium ex vivo and murine trachea in vivo it was discovered that injury to the epithelium by physical abrasion of the columnar cells revealed epithelial cell types that are susceptible to efficient Ad-transduction, as depicted in Fig. 1 [43, 51, 52]. This cell-type-specific variable efficiency led to the finding that underlying basal cell-like cells were efficiently transduced by Ad. These cells, as precursors to columnar cells could, once transduced, over time proliferate and differentiate into transgene-expressing columnar epithelial cells. Since the epithelial basal cells are probably stimulated to proliferate and differentiate upon injury these susceptible cells were described as ''basal cell-like cells" or the poorly differentiated (PD) airway epithelial cells, i.e., injured or regenerating cells, and this cellular phenotype is similar to that displayed by airway epithelial cells grown on plastic that are also highly transducible by Ad [43, 44]. One consideration when comparing wild-type Ad infection to Ad vectors is that the latter rely on delivering many virus particles to a target tissue Figure 1 Increased susceptibility of injured epithelium to Ad-mediated gene transfer. Exposure of Ad vectors to intact pseudostratified columnar cells (CC) results in low gene transfer efficiency. Physical abrasion of columnar cells before Ad exposure results in efficient gene transfer to the underlying basal cells (BC). Upper figures show schematic of intact and injured pseudostratified columnar respiratory epithelium and lower figures are intact and abraded human tracheal epithelium exposed to AdLacZ ex vivo. Reprinted with permission from [20]. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 3 whereas wild-type Ad needs only access to a small number of cells from which Ad replication and spread can then occur. Therefore, wild-type Ad may be able to take advantage of regions of the airway in which epithelium integrity is compromised or injured. Initiation of wild-type infection in injured regions would then be able to spread as a "basal cellitus" effectively beneath the resistant superficial columnar cells. b. Receptors The differences in the gene transfer efficiencies for the two cellular phenotypes of airway epithelial cells, the PD and well-differentiated (WD) columnar cells, suggests that an early step in the virus-cell interaction is deficient for the WD cells. Adenovirus enters epithelial cells by a two-step process: (1) initial attachment of the viral fiber-knob protein to a high-affinity receptor, the human Coxsackie B and adenovirus 2 and 5 receptor (hCAR)) [53, 54]; and (2) translocation of the virus into the cell cytoplasm via clathrin-coated pit internalization processes, in part mediated by an interaction of the viral penton base with ayPs/s integrins [55]. Since quantitative studies of the interactions of Ad with the airway epithelium in vivo are difficult and prone to considerable variation, specialized cell culture models have been generated to aid characterization of the interac tion of Ad with both PD and WD cell types. These models have been shown by a number of groups to reproduce: (1) the well-differentiated (ciliated) and poorly differentiated cellular phenotypes and (2) the relative resistance of WD and permissiveness of PD cells to Ad-mediated gene transfer as observed in vivo [56., 57]. In addition, although these models were originally generated to ask specific questions regarding gene transfer strategies, they have subsequently become valuable in a whole series of studies where quantitative and qualitative measurement of events in the airway epithelium are difficult to perform in vivo [35, 36, 58-63]. Using these models of human airway epithelium, immunofluorescent and functional analyses of the interactions of Ad with human airway epithelial cells have shown that decreased gene transfer efficiency to WD compared to PD cultures is due to limited entry (penetration) of Ad across the apical membrane of WD cultures, which reflects a reduced specific Ad-attachment due to the absence of hCAR and ayPs/s integrins from the apical surface. Interestingly, columnar cells and basal cell-like cells express all the necessary receptors to efficiently allow Ad entry but for columnar cells these processes are segregated and limited to the basolateral membranes as depicted in Fig. 2. In these culture models systems. Ad has been shown to efficiently transduce epithelial cells when applied to the basolateral epithehal surfaces [56, 57, 64, 65]. It appears that the most significant Ad-cell interaction in determin ing efficiency is that of the Ad-hCAR interaction. Many cell types usually resistant to Ad infection have been shown to be efficiently transduced after heterologous expression of hCAR, although the status of integrin expression 574 R a y m o n d John Pickles Figure 2 Schematic of polarized epithelial cells displaying resistance of the lumenal surface to adenovirus attachment and entry. The receptors required for Ad entry are located on basolateral membranes and excluded from the apical membrane by the tight junctional complexes. Reprinted with permission from [144]. in these cell-types is not always clear [56, 66]. Earlier observations had sug gested that inefficient Ad-mediated gene transfer to a bronchial xenograft model of human in vivo-like ciliated airway epithelial cells reflected the absence of avP3/5 integrins from the lumenal membrane of the epithelium [65]. However, ayPs/i integrins may not alone account for decrements in gene transfer efficiency. In support of this hypothesis, Ad mutants lacking penton base RGD sequences (normally required for Ad-ayPs/j integrin interactions) are able to efficiently transduce human epithelial cells although the rate of internalization is reduced [67]. In addition, in a P5 integrin-knockout mouse model, airway epithelial cells were equally susceptible to Ad-mediated gene transfer as were wild-type airway cells [68], again suggesting that ayPs/s inte grins may be facilitative rather than necessary for efficient vector entry into the cell. These observations are important for the design of targeted vectors that attempt to increase gene transfer efficiency to normally unsusceptible cell types [69, 70]. Retargeted vectors attached via nonspecific interactions or to noninternalizing receptors will probably depend on nonspecific uptake pathways to enter cells and while this approach is useful for PD cells in vitro, increasing Ad-attachment to WD cultures that do not exhibit these pathways is unlikely to improve gene transfer efficiency [56]. c. The Innate Immune System of the Lung Despite the progress on the cell biological aspects of vector-cell interactions, surprisingly little atten tion has been devoted to another fundamental component of innate airway defense that will almost certainly impact on the efficiency of lumenally 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 5 delivered vectors, the barrier/shielding function of epithelial surfaces by the carbohydrate-rich cell surface glycocalyx. Expression of hCAR, engineered to be expressed at the apical surface of polarized epithelia by incorporation of a glycosylphosphatidylinositol-linker (GPI-CAR), identified glycocalyx com ponents as barriers for lumenally applied Ad, accessing these receptors as depicted in Fig. 3 [71]. Electron micrographs demonstrate a "fuzzy coat" on the cell surface [72, 73], termed the glycocalyx, and on epithelial cell apical surfaces it is composed of several families of carbohydrate-rich molecules, including glycoproteins (most notably the mucins), proteoglycans, and glycol- ipids. Glycoconjugates are variably modified by sialic acid and sulfate that impart a strong anionic charge to the cell surface. A major component of the airway glycocalyx w îll likely be the "tethered" mucins and the molecular biologic advances in the mucin field have revealed that the MUCl and MUC4 are highly expressed in airway epithelium and have transmembrane anchoring (tethering) domains [74-82]. With respect to airway gene transfer, sialogly- coconjugates (including MUCl) comprising the glycocalyx on MDCK cells, appear to inhibit Ad gene transfer, presumably due, in part, to their negative charge since neuraminidase treatment to selectively remove sialic acid can circumvent the glycocalyx barrier in these cell types [83, 84]. Although apical surface mucins expressed on WD cells are also restrictive to Ad, neuraminidase alone is not sufficient to allow Ad permeation through the glycocalyx, and Figure 3 Schematic of polarized epithelial cell expressing reengineered Ad receptors at the apical surface. These studies revealed that the apical surface glycocalyx was an effective barrier to Ad accessing receptors located on the apical surface. 5 7 6 Raymond John Pickles more stringent proteolytic treatments are required [116, 117]. Presumably, the mucins, including both tethered and secreted mucins, may also be present in the mucus layer in the airway and may act as false attachment sites for Ad, thus effectively reducing the amount of Ad that ultimately reaches the epithelial surface. The reported rheological properties of CF mucus producing a more viscous, more dehydrated and immobile barrier suggest that this obstacle to gene transfer v îll be even more pronounced in the CF lung. Other components of the innate immune system, not studied in specialized cell culture models, may also have barrier effects on gene transfer efficiency. Ordinarily, such barriers occur in the lung as primary defense mechanisms and may be aggravated in the CF lung w^here airway lumens are inflamed. For example, alveolar macrophages have been reported to sequester up to 70% of Ad genomes within 24 h following tracheal administration to mouse airways [85]. In a mouse nasal model of CF lung bacterial colonization, Pseudomonas infection (PAOl strain) was shown to inhibit Ad gene transfer by 10-fold relative to noninfected control nasal airways [86]. In conclusion, there appear to be numerous potential barriers to Ad gene transfer in the lung especially in the CF lung that exhibits an overactive inflammatory milieu, and strategies to circumvent these barriers will likely need to be designed. However, even if all of these barriers are circumvented the major cause of low efficiency gene transfer is the lack of entry of Ad into the target cells. Strategies to improve the transduction efficiency will therefore be crucial to proving that the concept of gene transfer into the airway may actually be a feasible one. In summary, human WD cultures are resistant to Ad-mediated gene transfer because of decreased specific attachment sites and reduced nonspecific entry paths that can internalize a fraction of a large vector load typical of CF gene therapy protocols using Ad. To circumvent the inefficiency of Ad-mediated gene transfer to the respiratory epithelium, either alterations of the host will be required, i.e., ability to access Ad receptors expressed on basolateral cell surfaces, or Ad will require retargeting to receptor types that are present in sufficient number on the airway epithelial lumenal surface which allow for efficient uptake of Ad into the cell. 2. Safety Initial attempts to improve efficiency of Ad gene transfer to the airway epithelium in vivo have mostly involved delivery of greater doses of Ad to the lung. These doses can represent a relatively large protein load and the subsequent gene expression (even in nonepithelial cells) can produce an unusually high level of transgene in an organ that is designed for monitoring invading pathogen assaults. It is therefore not surprising that inflammatory and immune responses are observed when Ad is delivered to the lung and numerous studies have reported Ad-induced lung inflammation. In general. Ad induces 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 7 7 an acute nonspecific mixed cellular inflammatory response and a late specific, dose-related, lymphocyte-predominant, cell-mediated immune response in all species so far studied [22, 23, 25-27, 29, 87-90]. The acute response is nonspecific and likely induced by cytokine production in response to the protein load. It has also been suggested that neurogenic inflammation results after administration of Ad in rat airways, an effect shown to be partially due to vector gene expression but also to the viral proteins of the capsid coat [91]. The
later, specific immune response to Ad is mediated by major histocompatibility complex (MHC) class I-restricted cytotoxic (CDS) T lymphocytes directed against viral gene products and transgene proteins in expressing cells. The subsequent destruction of these cells leads to loss of persistence of transgene expression and so reduces efficiency of gene transfer [28, 92, 93]. The use of second-generation and high-capacity "gutless" vectors aims to limit the amount of viral gene expression to decrease the effects of this late immune response and these approaches are the topics of other chapters [94, 95]. In addition to cellular immune responses. Ad also elicits humoral immune responses with the production of mucosal and neutralizing antibodies [25, 87, 90, 96-98]. These responses have been shown to be against the viral capsid proteins and are secondary to a helper (CD4~ )̂ T lymphocyte response. The production of such an antibody response results in neutralization of subsequent readministration of Ad, resulting in loss of gene transfer, assuming that the same Ad serotype is used (see below). Therefore, in addition to the innate immunity of the lung (receptor localization, glycocalyx, macrophages, mucus) reducing the efficiency of gene transfer, the cellular and humoral immune systems also respond to Ad delivery into the airway and as a result reduce the efficiency of gene transfer and the persistence of expression in the target epithelial cells. C. Overcoming the Limitations of Ad 1. Efficiency The localization of entry pathways for Ad to the basolateral surfaces of airway epithelial cells suggests that a delivery strategy to access these regions would be beneficial to improving gene transfer efficiency. This approach may also allow targeting of the epithelial stem cells (basal cells), resulting in transgene expression in the lung for the lifetime of the individual. This is an important consideration for gene transfer to the airway epithelium since fully differentiated lumenal facing cells (e.g., ciliated cells) have a relatively short lifetime, on the order of 40-100 days, and targeting these cell types specifically will require regular readministration of vectors. Access to basal cells/basolateral surfaces may possibly be achieved by intravenous administration of vectors if penetration of the blood vessel wall, the connective tissue, and the basal lamina of the basement membrane were 5 7 8 Raymond John Pickles achievable. Unfortunately, studies that have attempted intravenous delivery strategies have not been successful since vectors do not appear to gain access to sufficient lung epitheHal cells to make this approach feasible [99-102]. Barriers functions provided by the blood vessel endothelial cells and connective tissue surrounding the airv^ay passages seems unpenetratable by Ad. Indeed, the particle permeability of the basal lamina alone is thought to exclude inert particles of greater than 10 nm, which would certainly be restrictive to particles the size of Ad (100 nm). In an in vivo experimental mouse model where Ad was externally administered directly to the tracheal basement membrane, efficient gene transfer to the connective tissue fibroblasts adjacent to the basement membrane was observed without gene transfer to the epithelial cells of the juxtaposed epitheHum [51]. To date, two main strategies to improve intralumenal delivery of Ad vectors have been focused on. One approach is to access the basolateral surfaces of the epithelial cells by disruption of the epithelial "tight" junctions, and the other is to retarget Ad vectors to nonviral receptors that are present on the apical surface of lumenal epithelial cells that allow for entry of Ad into these cell types. Retargeting has so far been achieved by chemically, immunologically, or genetically modifying the Ad capsid coat by incorporating new receptor ligands that can target candidate receptors. a. Modification of the Host by Opening Tight Junctions Epithelial cell "tight" junctions (zonulae occludens) are collar-like structures composed of a diverse number of proteins that separate the apical and basolateral domains of the lumenal columnar epithelial cells. As well as functioning as a restrictive barrier to mixing of apical and basolateral membrane components, these intercellular junctions limit the transepithelial transport of solutes across the epithelium. A number of disease states have been shown to alter tight junction permeability (e.g., asthma) and reagents to increase the permeability of the junction are available. The key to successful disruption of tight junctions to allow Ad access to basolateral epithelial cell surfaces will be to use a reagent that opens tight junctions sufficiently for Ad to pass through but that is rapidly reversible to limit the passage of other lumenal contents (e.g., bacteria) or serosal fluid into the airway lumen. A property exploited for this purpose is the calcium ion dependency of the structural integrity of the junction. Walters et al.^ have successfully shown that treatment of the apical surface of human WD airway cells with the calcium chelator EGTA or hypotonic solutions (e.g., water) allow for improvements in Ad-mediated gene transfer presumably by allowing Ad access to basolateral receptors [64,103]. The slow reversibility of this effect, however, is problematic; tight junction reformation takes a least a couple of hours, a time period that would be unacceptable in a clinical setting. In vivo studies in mouse airways have confirmed that these treatments improve gene transfer efficiency although parameters of safety were not assessed fully [104, 105]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 7 9 More specific reagents are available for studying tight junction perme ability and the effect on Ad-gene transfer. Parsons et al. used a detergent, polidocanol, in murine airways in vivo to enhance Ad-mediated gene transfer, an effect shown to be due to the ability of this reagent to transiently open tight junctions 186]. The short-chain fatty acid sodium caprate, has also been used to increase Ad-mediated gene transfer to human WD cultures and results in full correction of CF cultures when AdCFTR is subsequently applied to the apical surface. This result is exciting since the effect is rapidly reversible effect and has previously been used clinically for enhancing pharmaceutics absorp tion across the GI tract, again presumably by an effect on tight junctional permeability. These studies although fraught with inherent safety issues are beginning to establish that this strategy for delivering transgenes to the lung may be a viable option. The possibility of targeting the basal stem cells by this procedure is reason enough to continue pursuing the usefulness of these strategies. b. Targeted Ad to Increase Gene Transfer Efficiency Targeted Ad directed against specific receptors have been used to successfully transduce cell types that are usually refractory to Ad infection. The epidermal growth factor receptor, stem cell factor receptor, fibroblast growth factor receptor, ay integrins, and T-cell receptors (CD 3), have all been used as surrogate recep tors for Ad entry in a variety of cell types [106-109]. Given the lack of Ad receptors at the apical surface of lumenal airway epithelial cells, a retargeting strategy to receptors known to present on the airway lumen may allow for gene transfer efficiency to be improved. However, a successful targeting strategy to the lung epithelium will require the identification of target molecules that allow for attachment and internalization of AdV across the apical membrane of columnar airway epithelial cells. The identification of target receptors to which to redirect Ad tropism on the lumen of airway epithelium is difficult because most receptors and entry mechanisms occur on the basolateral surfaces of the cells. Certain members of a specific seven-transmembrane-spanning G-protein-coupled receptor family (i.e., P2Y2-purinoceptors, B2-kinin receptors, and adenosine type 2b receptors) have been identified as putative utile target receptors for redirecting Ad tropism to the surface epithelium of the lung. These receptors have been shown to be present on the lumenal surface of human airway epithelium and internalized into clathrin-coated pits when activated by their respective agonists [110]. The utilization of clathrin-coated pit internalization pathways for native Ad receptors, suggests that the G-protein coupled receptors may provide an ideal surrogate entry pathway for Ad. The high potency of P2Y2 agonists (e.g., ATP, UTP) combined with the low affinity of these agonists for the receptor suggests that the P2Y2 purinoceptors are abundant in number on the lumenal surface of the human respiratory epithelium [111]. Since pharmacological 5 8 0 Raymond John Pickles activation of airway epithelial P2Y2 receptors do not result in untoward effects in human airways, this receptor is an ideal target receptor to redirect Ad tropism. However, since the only available ligands for this receptor are low affinity, small organic molecules, certain technical difficulties are associated with conjugating these molecules to Ad. Other receptor types suitable for Ad retargeting exist on the airway, although specific retargeting data for Ad is lacking. The urokinase plasminogen activator receptor, uPA-R and the SEC- 2 receptor have also been proposed as target receptors for Ad and AAV, respectively [112, 113]. /. Immunologically modified targeted vectors One immunological app roach for targeting gene transfer vectors is using bispecific antibodies linking Ad directly to non-Ad-receptor-types present on the cell surface [108,114]. For example, chemically conjugated antibodies, one of which is directed against an epitope-tagged Ad coat protein and the other against oty integrin membrane proteins have been reported to increase gene transfer efficiency by seven- to ninefold compared to that of nonmodified Ad, indicating that increased Ad-attachment results in increased gene transfer efficiency [114]. In a similar approach. Ad was retargeted to nonviral receptor types in conjunction with ablation of the natural Ad tropism using an anti-fiber-knob protein antibody conjugated to folate [115]. Folate-conjugated antibody was the ligand of choice since the folate receptor is reported to be upregulated on the surface of malignant cells, thus providing a targeted vector for a variety of cancers. Retargeting Ad to cells expressing folate-receptors was shown to be specific and successful with significant increases in gene transfer efficiency. As "proof of concept" studies, a hemaggluttin (HA)-epitope-tagged P2Y2 receptor expressed at the apical surface of human WD cultures and tar geted with bispecific antibodies consisting of antibodies to Ad fiber-knob protein/HA-tag has been shown to facilitate Ad entry into these cell types, shown schematically in Fig. 4 [116, 117]. This effect is enhanced by coad ministration of exogenous ATP to activate the receptor, an effect that can be reduced by desensitization of the P2Y2 receptors prior to addition of tar geted Ad. Importantly, the apical surfaces of the HA tagged-P2Y2 expressing cultures required a brief exposure to specific proteases before targeting was effective suggesting that the apical surface glycocalyx hindered access of the targeted vector to the target receptors [116]. This approach also relied on the expression of a HA-tagged receptor that may be overexpressed relative to the endogenously expressed P2Y2 receptors in the culture system. The number of target receptors and the affinity of the targeting ligand are both likely to be critical parameters for the success of such a targeting strategy. //. Chemically modified targeted vectors Since antibodies to the external domains of P2Y2 receptors are not currently available, a strategy to target Ad to the endogenous P2Y2 receptor was to chemically conjugate small molecule agonists (DTP) to the proteins of the Ad capsid coat. Using chemically reactive 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 581 Figure 4 Schematic of targeting strategy used to redirect Ad tropism to P2Y2 receptors on the apical surface of human airway epithelial ceils. Bispecific antibodies against the virus and the receptor were used as a targeting link and activation of the receptor results in receptor internalization and entry of Ad with subsequent gene transfer. biotin derivatives, biotin v^as coupled to the Ad capsid coat predominately via hexon protein. This strategy is reported to couple 2-300 biotins to a single Ad particle and does not significantly alter the fiber-knob-hCAR interac tion. By using commercially available biotin-linked UTP in combination v^ith streptavidin as a "bridge" linking biotin-Ad to biotin-UTP, these molecular conjugates v^ere shown to mediate gene transfer by an interaction specifically v^ith endogenous P2Y2 receptors on the apical surface of WD cultures [110]. Again, the effectiveness of this approach w âs reduced by the presence of apical surface glycocalyx since gene transfer was only observed in cultures pretreated with agents that degrade this barrier. Regardless, gene transfer efficiency using these conjugates was still inefficient, probably due to the clumsiness of the "streptavidin bridge" and the low affinity of UTP for this receptor. Future experiments using this targeting strategy will require the identification of receptor agonists with
higher affinity in addition to improved methods to directly couple the agonist ligands to the Ad capsid coat. 5 8 2 Raymond John Pickles Another method for chemically conjugating receptor ligands to Ad is by the use of polyethylene glycol (PEG) that can be covalently linked directly to the Ad capsid coat. A number of groups have now shown that PEG conjugated viruses can be used to target Ad [112, 118]. For example, Ad conjugated to a 12-amino-acid peptide, identified from phage display assays on the apical surfaces of human WD cultures, resulted in a 10-fold increase in gene transfer efficiency to these cell types [118]. Similarly, Ad conjugated via PEG to a peptide that binds to uPA-R has been shown to target Ad to this receptor type and enhance gene transfer to polarized airway epithelia [112]. An additional bonus of using PEG-conjugated Ad is that these vectors appear to be less immunogenic that non-PEG-conjugated Ad. This effect is due to the masking of antigenic Ad capsid proteins (mainly hexon) from neutralizing antibodies ([119], see below). ///. Genetically modified targeted vectors The ideal targeted vector would be one in which the target ligand could be incorporated into the capsid coat with minimal disruption of the physical and biological properties of Ad. For targeting strategies in which a peptide ligand is used, the most desirable method would be to generate an Ad vector genetically modified to express a functional peptide ligand on the viral surface. Such an approach for targeting vectors has been reported, where the Ad viral coat has been genetically modified to express multiple polylysine groups on the C-terminus of the Ad fiber-knob protein [70]. This redirects Ad tropism to heparan sulfate moieties that are present on the surfaces of most mammalian cells. With certain nonepithelial cell types, which lack hCAR, this modified vector has been shown to increase gene transfer efficiency 10- to 300-fold in comparison to nonmodified Ad. However, the modified vector will likely not be useful for gene transfer to the airway epithelium since heparan sulfate is not expressed at the apical surface of airway epithelial cells [120]. Targeted Ad in which the fiber-knob protein (responsible for Ad attachment to the hCAR) has been modified to express novel ligands that can interact with other receptor-types are being developed and the feasibility of this approach has now been reported by a number of groups [107, 121, 122]. A recent development in this type of approach was reported by Krasnykh et al. [123], who hypothesized that the HI loop region of the fiber-knob structure can withstand the insertion of heterologous peptide sequences without significantly compromising the tertiary structure of the fiber-knob protein or the production and infectivity of the modified Ad. These authors incorporated the FLAG octapeptide marker sequence into the HI loop region and were able to produce functional Ad. Importantly, they also showed that the sequence contained within intact virions was accessible to a FLAG-specific antibody, suggesting that sequences inserted into this region are capable of interacting with other target substrates such as cell-surface receptors. A significant technical advance in Ad targeting strategies evolved from studies that deduced the viral sequences in fiber-knob protein that interact 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 3 with hCAR. Genetic ablation of these sequences from Ad vectors led to the generation of Ad that no longer binds to hCAR and no longer transduces cells that are permissive for normal Ad transduction [124]. The broad cellular tropism of Ad vectors can nov^ be reduced, and by the addition of targeting moieties to these Ad vectors specific cell-type targeting is possible. Reduced Ad interactions with nontarget cells will lessen the potential for adverse effects with these vectors. In the lung however, the significance of natural tropism ablation is unclear since most of the epithelial cells targeted with delivery strategies do not express Ad receptors at the lumenal surface. However, the loss of transduction to other cell-types that may interact with Ad delivered to the lung (e.g., macrophages, dendritic cells) may benefit from the hCAR-binding ablation mutant. Recent developments in immunologically, chemically, and genetically modified targeted Ad suggests that "designer" gene transfer vectors will one day be available. Although Ad vectors, in their present form, may not be ideal for a number of gene transfer target tissues, notably the lung epithelium, this vector clearly remains at the forefront of gene therapy research since it is still one of the most efficacious gene transfer vectors available, and will continue to be useful at least in proof-of-concept studies. iv. Screening with other adenoviral subtypes Although over 51 different serotypes of wild-type Ad exist, the predominant serotypes used for gene transfer experiments are serotypes 2 and 5. The reason for this is largely historical since these two serotypes have been extensively studied over the past 30 years and understanding of the viral genome has allowed the manipulations necessary to evolve these viruses into gene transfer vectors. With regard to the airway epithelium, other serotypes have been suggested to be efficacious at delivering transgenes to human WD cultures. Serotypes 17 and 12 have been shown to bind/deliver transgenes 10-fold over Ad2 vectors [125]. However, as of yet no conclusive results have been presented that suggest that the improvements warrant future investigations with these vectors. One approach to determining if any of the other serotypes may be more efficacious in the lung epithelium could be envisioned using a recently reported system of generating an Ad5 capsid-expressing fiber proteins from the other serotypes [126]. This system was used to screen vascular endothelial and smooth muscle cells and the efficiency of gene transfer compared against the efficiency of gene transfer with Ad5. This screening procedure identified Ad5 with Adl6 fibers as being significantly more efficient at gene transfer than Ad5 in these particular cell types. It will be of interest to screen these serotypes on human WD cultures relative to Ad5 to determine whether other Ad serotypes may be of benefit to airway epithelial cell gene transfer. A serotype which may be of particular interest is Ad37, since it has been reported that Ad37 utilizes sialic acid residues that are present on the extracellular surfaces of most cells [127]. An abundance of sialic acid residues on the lumenal surface of airway epithelial 5 8 4 Raymond John Pickles cells as components of glycoconjugates may allow for improved gene transfer. Whether attachment of Ad37 to sialic acid residues located on the airway lumen leads to efficient entry and gene transfer awaits further study. V. Other methods to increase gene transfer efficiency Nonspecific meth ods to enhance Ad-mediated gene transfer to airway epithelial cells have been reported [128, 129]. Calcium phosphate coprecipitation has been used to pre cipitate aggregates of Ad and other vectors to increase gene transfer to airway epithelia both in vitro and in vivo. It has been suggested that in vivo these aggregates increase the rate of nonspecific endocytosis of Ad across the apical membrane of polarized epithelial cells. The possible effects of this technique on cellular and paracellular permeability have not been investigated. Another method to both improve both the delivery and efficiency of Ad to the lung epithelium in vivo is using the inert perfluorochemicals (PFCs). These compounds are liquid in nature but due to high oxygen saturation capacities can be instilled into the lung for periods of time with maintenance of passive oxygen diffusion. Several studies have now shown that administration of gene transfer vectors (including Ad) with PFC results in increased gene transfer to rodent and nonhuman primate lungs [130-132]. The improvements in gene transfer are predominately localized to the alveolar regions with only modest improvements in the efficiency of gene transfer to the respiratory epithelium. The exact mechanism by which PFCs produce these effects remains to be determined, but may be due to prolonged contact time for the vector on the cells and reduced ingestion of Ad by macrophages and/or due to some nonspecific effect on the paracellular permeability. Nonetheless, this method provides an example of a new strategy to deliver transgenes to the lung without the need for direct instillation or aerosolization, which are both inefficient methods for airway epithelium delivery. 2. Safety Strategies that improve gene transfer efficiency, as described above, will allow for lower doses of Ad to be administered to the lung. This achievement alone will be beneficial in reducing the inflammatory responses seen with Ad administration. However, attempts have also been made to reduce the inflammation produced by expression of viral genes that produce the cell- mediated immune responses described above. The identification of specific viral genes that initiate or amplify the immune response has led to the reengineering of Ad vectors to ablate the specific gene expression. For example, vectors deleted of E2a and E4 have been reported to display reduced immune responses and improve persistence of transgene expression [92, 93]. The ultimate vector is one that contains no viral genes and the high-capacity "gutless" vectors have been generated and appear to blunt the immune response considerably [133-135]. In contrast, several viral genes have been identified that have evolved to subvert the immune response and the inclusion of these genes into new vectors may be desirable (e.g., E3) [136]. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 8 5 Strategies to circumvent the humoral immune response have also been considered. Since this arm of the immune system results in the inability of readministration of specific Ad serotypes, serotype switching has been proposed as a method to allow repeat administration. Indeed, Ad5 administration but not Ad4 or Ad30 has been reported to prevent the gene transfer obtained with subsequent Ad5 administration the lung [97]. However, in addition to this being a somewhat limited procedure, it is not yet clear whether these different serotypes are as inefficient for gene transfer to the airway epithelium as Ad5. Transient immunosuppression has also been suggested to reduced the inhibitory effects of neutralizing antibodies. Intratracheal administration of immunosuppressive factors (IL-12, gamma interferon, antibodies to CD40, corticosteroids and cyclophosphamide) at the time of vector administration have all shown a reduction in generation of neutralizing antibodies [137-141]. The longer-term effects of administering these factors to lung have not been reported. Finally, covalent conjugation of PEG to the Ad capsid coat that permits addition of targeting moieties is also a strategy for the virus to elude neutralizing antibodies by masking capsid coat proteins, especially hexon protein. Although PEGylation of Ad leads to some loss of viral titer and aggregation the ability of this procedure to develop targeted vectors combined with reduction in immune response makes this a promising method for future study [119]. VI . Other Vectors The focus of this review has been on Ad vectors for use in CF lung disease. Flowever, a number of other vectors have been suggested as candidates for CF lung gene transfer vectors. Adeno-associated virus (AAV), retrovirus, lentivirus, and liposomal vectors have all shown promise in preclinical studies in the lung and some have been tested in clinical trials. The general observation is that all of these vectors, like Ad, do not appear to display the efficiency of gene transfer in WD airway epithelial cells as they do in nonpolarized cells, suggesting that these vectors confront similar barriers in the airways as do Ad vectors. Strategies to improve gene transfer efficiency for these other vectors have followed the progression of experiments with Ad, i.e., tight junction modulation, targeting, serotype switching, and immune response reduction, and all have been shown as for Ad to improve efficiency to some to degree. Whether efficiency can ever be improved to a point that shows efficacy in the lungs of CF patients remains to be determined. Meanwhile, other viruses (sendai virus [142] and lentiviruses pseudotyped with filovirus coat proteins [143]) may show promise for gene delivery to the airway and preliminary reports suggest that these viruses or components thereof may one day provide us with a method to deliver transgenes to the lung in an efficient and safe manner. 5 8 6 Raymond John Pickles VII. Conclusion It is clear that the evolution of gene therapy has been aided by many different aspects of basic biological and medical research efforts and the possibility of a gene therapy for CF lung disease will
only take time and a continuation of these efforts. These findings will not only be beneficial to the treatment of CF lung disease but also other disease states, which are continually being brought closer to a treatment and perhaps a cure by this new and exciting biomedical technology. Ackno>vledgments The author especially thanks Dr. Ashley Henderson of the UNC Pulmonary Division for useful discussions and critical review of the manuscript and Jennifer Nank for help w îth both manuscript and figure production. References 1. Johnson, L. G., Boyles, S. E., Wilson, J., and Boucher, R. C. (1995). Normalization of raised sodium absorption and raised calcium-mediated chloride secretion by adenovirus-mediated expression of cystic fibrosis transmembrane conductance regulator in primary human cystic fibrosis airway epithelial cells./. Clin. Invest. 95, 1377-1382. 2. Drumm, M. L., Pope, H. A., Cliff, W. H., Rommens, J. M., Marvin, S. A., Tsui, L. C , Collins, F. S., Frizzell, R. A., and Wilson, J. M. (1990). Correction of the cystic fibrosis defect in vitro by retrovirus- mediated gene transfer. Cell 62, 1227-1233. 3. Rommens, J. M., lannuzzi, M. C , Kerem, B., Drumm, M. L., Melmer, G., Dean, M., Rozmahel, R., Cole, J. L., Kennedy, D., Hidaka, N., et al. (1989). Identification of the cystic fibrosis gene: chromosome walking and jumping. Science 245, 1059-1065. 4. Stutts, M. J., Canessa, C. M., Olsen, J. C , Hamrick, M., Cohn, J. A., Rossier, B. C , and Boucher, R. C. (1995). CFTR as a cAMP-dependent regulator of sodium channels. Science 269, 847-850. 5. Boucher, R. C , Stutts, M. J., Knowles, M. R., Cantley, L., and Gatzy, J. T. (1986). Na-f transport in cystic fibrosis respiratory epitheha. Abnormal basal rate and response to adenylate cyclase activation./. Clin, Invest. 78, 1245-1252. 6. Rosenfeld, M. A., Yoshimura, K., Trapnell, B. C , Yoneyama, K., Rosenthal, E. R., Dale- mans, W., Fukayama, M., Bargon, J., Stier, L. E., Stratford-Perricaudet, L., et al. (1992). In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithefium. Cell 68, 143-155. 7. Zabner, J., Couture, L. A., Gregory, R. J., Graham, S. M., Smith, A. E., and Welsh, M. J. (1993). Adenovirus-mediated gene transfer transiently corrects the chloride transport defect in nasal epithelia of patients with cystic fibrosis. Cell 75, 207-216. 8. Boat, T., Welsh, MJ, and Beaudet, AL. (1989). Cystic fibrosis. In "The Metabolic Basis of Inherited Disease" (E. R. Scriver, A. L. Beaudet, W. S. Sly, and D. Valle, eds.), pp. 2649-2680. McGraw-Hill, New York. 9. Riordan, J. R., Rommens, J. M., Kerem, B., Alon, N., Rozmahel, R., Grzelczak, Z., Zielen- ski, J., Lok, S., Plavsic, N., Chou, J. L., et al. (1989). Identification of the cystic fibrosis gene: Cloning and characterization of complementary DNA. Science 14S, 1066-1073. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 7 10. Welsh, M. J., and Smith, A. E. (1993). Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis. Cell 73, 1251-1254. 11. Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G. A., O'Riordan, C. R., and Smith, A. E. (1990). Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell 63, 827-834. 12. Kalin, N., Claass, A., Sommer, M., Puchelle, E., and Tummler, B. (1999). DeltaF508 CFTR protein expression in tissues from patients with cystic fibrosis. / . Clin. Invest. 103, 1379-1389. 13. Quinton, P. M. (1990). Cystic fibrosis: A disease in electrolyte transport. FASEB J. 4, 2709-2717. 14. Johnson, L., and B. RC. (1997). Towards correction of the genetic defect in cystic fibrosis. In "Gene Therapy for Diseases of the Lung" (B. KL, Ed.) Vol. 104, pp. 239-265. Dekker, New York. 15. Crystal, R. G., McElvaney, N. G., Rosenfeld, M. A., Chu, C. S., Mastrangefi, A., Hay, J. G., Brody, S. L., Jaffe, H. A., Eissa, N. T., and Danel, C. (1994). Administration of an aden ovirus containing the human CFTR cDNA to the respiratory tract of individuals with cystic fibrosis. Nat. Genet. 8, 4 2 - 5 1 . 16. Knowles, M. R., Hohneker, K. W., Zhou, Z., Olsen, J. C , Noah, T. L., Hu, P. C , Leigh, M. W., Engelhardt, J. F., Edwards, L. J., Jones, K. R., et al. (1995). A controlled study of adenoviral-vector-mediated gene transfer in the nasal epithelium of patients with cystic fibrosis. N. Engl. J. Med. 333, 823-831. 17. Caplen, N. J., Kinrade, E., Sorgi, F., Gao, X., Gruenert, D., Geddes, D., Coutelle, C , Huang, L., Alton, E. W., and Williamson, R. (1995). In vitro liposome-mediated DNA transfection of epithelial cell lines using the cationic liposome DC-Chol/DOPE. Gene Ther. 2, 603-613. 18. Gill, D. R., Southern, K. W., Mofford, K. A., Seddon, T., Huang, L., Sorgi, F., Thomson, A., MacVinish, L. J., Ratcliff, R., Bilton, D., Lane, D. J., Littlewood, J. M., Webb, A. K., Mid- dleton, P. G., Colledge, W. H., Cuthbert, A. W., Evans, M. J., Higgins, C. F., and Hyde, S. C. (1997). A placebo-controlled study of liposome-mediated gene transfer to the nasal epithelium of patients with cystic fibrosis. Gene Ther. 4, 199-209. 19. Johnson, L. G., Olsen, J. C , Sarkadi, B., Moore, K. L., Swanstrom, R., and Boucher, R. C. (1992). Efficiency of gene transfer for restoration of normal airway epithelial function in cystic fibrosis. Nat. Genet. 2, 21-25 . 20. Boucher, R. C. (1996). Current status of CF gene therapy. Trends Genet. 12, 81-84. 21. Teramoto, S., Johnson, L. G., Huang, W., Leigh, M. W., and Boucher, R. C. (1995). Effect of adenoviral vector infection on cell proliferation in cultured primary human airway epithelial cells. Hum. Gene Ther. 6, 1045-1053. 22. Dong, J. Y., Wang, D., Van Ginkel, F. W., Pascual, D. W., and Frizzell, R. A. (1996). Sys tematic analysis of repeated gene delivery into animal lungs with a recombinant adenovirus vector. Hum. Gene Ther. 7, 319-331. 23. Ginsberg, H. S., Lundholm-Beauchamp, U., Horswood, R. L., Pernis, B., Wold, W. S., Chanock, R. M., and Prince, G. A. (1989). Role of early region 3 (E3) in pathogenesis of adenovirus disease. Proc. Natl. Acad. Sci. USA 86, 3823-3827. 24. Ginsberg, H. S., and Prince, G. A. (1994). The molecular basis of adenovirus pathogenesis. Infect. Agents Dis. 3, 1-8. 25. Kaplan, J. M., St George, J. A., Pennington, S. E., Keyes, L. D., Johnson, R. P., Wadsworth, S. C , and Smith, A. E. (1996). Humoral and cellular immune responses of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 117-127. 26. Look, D. C , and Brody, S. L. (1999). Engineering viral vectors to subvert the airway defense response. Am.]. Respir. CellMol. Biol. 20, 1103-1106. 27. St. George, J. A., Pennington, S. E., Kaplan, J. M., Peterson, P. A., Kleine, L. J., Smith, A. E., and Wadsworth, S. C. (1996). Biological response of nonhuman primates to long-term repeated lung exposure to Ad2/CFTR-2. Gene Ther. 3, 103-116. 5 8 8 Raymond John Pickles 28. Yang, Y., Nunes, F. A,, Berencsi, K., Gonczol, E., Engelhardt, J. F., and Wilson, J. M. (1994). Inactivation of E2a in recombinant adenoviruses improves the prospect for gene therapy in cystic fibrosis. Nat. Genet. 7, 362-369. 29. Yei, S., Mittereder, N., Wert, S., Whitsett, J. A., Wilmott, R. W., and Trapneli, B. C. (1994). In vivo evaluation of the safety of adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA to the lung. Hum. Gene Ther. 5, 731-744. 30. Jeffery, P. (1990). Form and function of airv^ay epithelium. In "Epithelia: Advances in Cell Physiology and Cell Culture" (C. J. Jones, Ed.), pp. 195-220. Kluw^er Academic, London. 31. Harkema, J., Mariassy, A., St. George, J., Hyde, D. M., and Plopper, C. G. (1994). Epithelial cells of the conducting airways: A species comparison. In "The Airv^ay Epithelium" (S. G. Farmer and D. W. P. Hay, Eds.), Vol. 55, pp. 3-39. Dekker, New York. 32. Mercer, R. R., Russell, M. L., Roggli, V. L., and Crapo,J. D. (1994). Cell number and distribution in human and rat airways. Am. ]. Respir. Cell Mol. Biol. 10, 613-624. 33. Randell, S. H. (1992). Progenitor-progeny relationships in airway epithelium. Chest 101, 11S-16S. 34. Leigh, M. W., Kylander, J. E., Yankaskas, J. R., and Boucher, R. C. (1995). Cell prolifera tion in bronchial epithelium and submucosal glands of cystic fibrosis patients. Am. ]. Respir. Cell Mol. Biol. 12,605-612. 35. Matsui, H., Randell, S. H., Peretti, S. W., Davis, C. W., and Boucher, R. C. (1998). Coordi nated clearance of pericifiary liquid and mucus from airway surfaces. / . Clin. Invest. 102, 1125-1131. 36. Matsui, H., Grubb, B. R., Tarran, R., Randell, S. H., Gatzy, J. T., Davis, C. W., and Boucher, R. C. (1998). Evidence for periciliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease. Cell 95, 1005-1015. 37. Cotton, C. U., Stutts, M. J., Knowles, M. R., Gatzy, J. T., and Boucher, R. C. (1987). Abnor mal apical cell membrane in cystic fibrosis respiratory epithelium. An in vitro electrophysio logic analysis./. Clin. Invest. 79, 80-85. 38. Engelhardt, J. F., Yankaskas, J. R., Ernst, S. A., Yang, Y., Marino, C. R., Boucher, R. C , Cohn, J. A., and Wilson, J. M. (1992). Submucosal glands are the predominant site of CFTR expression in the human bronchus. Nat. Genet. 2, 240-248. 39. Grubb, B., and Boucher, R. C. (1999). Pathophysiology of Gene-targeted mouse models for cystic fibrosis. Physiol. Rev. 79, S193-S214. 40. Clarke, L. L., Grubb, B. R., Yankaskas, J. R., Cotton, C. U., McKenzie, A., and Boucher, R. C. (1994). Relationship of a non-cystic fibrosis transmembrane conductance regulator- mediated chloride conductance to organ-level disease in Cftr(-/-) mice. Proc. Natl. Acad. Sci. USA 91, 479-483. 41. Grubb, B. R., Paradiso, A. M., and Boucher, R. C. (1994). Anomalies in ion transport in CF mouse tracheal epithelium. Am. J. Physiol. 267, C293-C300. 42. Grubb, B. R., Vick, R. N., and Boucher, R. C. (1994). Hyperabsorption of Na+ and raised Ca(2+)-mediated CI- secretion in nasal epithelia of CF mice. Am. } . Physiol. 266, C1478-C1483. 43. Grubb, B. R., Pickles, R. J., Ye, H., Yankaskas, J. R., Vick, R. N., Engelhardt, J. F., Wil son, J. M., Johnson, L. G., and Boucher, R. C. (1994). Inefficient gene transfer by adenovirus vector to cystic fibrosis airway epithelia of mice and humans. Nature 371, 802-806. 44. Mittereder, N., Yei, S., Bachurski, C , Cuppoletti, J., Whitsett, J. A., Tolstoshev, P., and Trapneli, B. C. (1994). Evaluation of the efficacy and safety of in vitro, adenovirus-mediated transfer of the human cystic fibrosis transmembrane conductance regulator cDNA. Hum. Gene Ther. 5, 717-729. 45. Engelhardt, J. F., Yang, Y., Stratford-Perricaudet, L. D., Allen, E. D., Kozarsky, K., Perri- caudet, M., Yankaskas, J. R., and Wilson, J. M. (1993). Direct gene transfer of human CFTR into human bronchial epithelia of xenografts with El-deleted adenoviruses. Nat. Genet. 4, 27-34. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 8 9 46. Jiang, C , Akita, G. Y., Colledge, W. H., Ratcliff, R. A., Evans, M. J., Hehir, K. M., St George, J. A., Wadsworth, S. C., and Cheng, S. H. (1997). Increased contact time improves adenovirus-mediated CFTR gene transfer to nasal epithelium of CF mice. Hum. GeneTher.S,671-6S0. 47. Zabner, J., Zeiher, B. G., Friedman, E., and Welsh, M. J. (1996). Adenovirus-mediated gene transfer to ciliated airway epithelia requires prolonged incubation time. / . Virol. 70, 6994-7003. 48. Mastrangeli, A., Danel, C., Rosenfeld, M. A., Stratford-Perricaudet, L., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1993). Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. / . Clin. Invest. 91, 225-234. 49. Hansen, S. H., Sandvig, K., and van Deurs, B. (1992). Internalization efficiency of the transferrin receptor. Exp. Cell Res. 199, 19-28. 50. St. George, J., Sacks, C. R., Lukason, M. J., Nichols, M., Peterson, P. A., Vaccaro, C , Bai ley, S., Johnson, J., Pratt, P., and Wadsworth, S. C. (1995). Efficacy of adenoviral vectors in airway epithelium. Pediatr. Pulmonol. (Suppl.) 12, 151. 51. Pickles, R. J., Barker, P. M., Ye, H., and Boucher, R. C. (1996). Efficient adenovirus- mediated gene transfer to basal but not columnar cells of cartilaginous airway epithelia. Hum. Gene Ther. 7, 921-931. 52. Dupuit, F., Zahm, J. M., Pierrot, D., Brezillon, S.,
Bonnet, N., Imler, J. L., Pavirani, A., and Puchelle, E. (1995). Regenerating cells in human airway surface epithelium represent preferential targets for recombinant adenovirus. Hum. Gene Ther. 6, 1185-1193. 53. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S,, Crowell, R. L., and Finberg, R. W. (1997). Isolation of a common receptor for Coxsackie B viruses and adenoviruses 2 and 5. Science 275, 1320-1323. 54. Tomko, R. P., Xu, R., and Philipson, L. (1997). HCAR and MCAR: The human and mouse cellular receptors for subgroup C adenoviruses and group B coxsackieviruses. Proc. Natl. Acad. Sci. USA 94, 3352-3356. 55. Wickham, T. J., Mathias, P., Cheresh, D. A., and Nemerow, G. R. (1993). Integrins alpha v beta 3 and alpha v beta 5 promote adenovirus internalization but not virus attachment. Cell 73, 309-319. 56. Pickles, R. J., McCarty, D., Matsui, H., Hart, P. J., Randell, S. H., and Boucher, R. C. (1998). Limited entry of adenovirus vectors into well-differentiated airway epithelium is responsible for inefficient gene transfer. / . Virol. 72, 6014-6023. 57. Zabner, J., Freimuth, P., Puga, A., Fabrega, A., and Welsh, M. J. (1997). Lack of high affinity fiber receptor activity explains the resistance of ciliated airway epithelia to adenovirus infection./. Clin. Invest. 100, 1144-1149. 58. Matsui, H., Davis, C. W., Tarran, R., and Boucher, R. C. (2000). Osmotic water perme abilities of cultured, well-differentiated normal and cystic fibrosis airway epithelia. / . Clin. Invest. 105, 1419-1427. 59. Walters, R. W., Yi, S., Keshavjee, S., Brown, K. E., Welsh, M. J., Chiorini, J. A., and Zab ner, J. (2001). Binding of Adeno-associated virus type 5 to 2,3-linked sialic acid is required for gene transfer. / . Biol. Chem. 21 , 21. 60. Jepsen, M., Graham, S., Karp, P. H., and Zabner, J. (2000). Effect of topical nasal pharma ceuticals on sodium and chloride transport by human airway epithelia. Am. J. Rhinol. 14, 405-409. 61. Zabner, J., Seller, M. P., Launspach, J. L., Karp, P. H., Kearney, W. R., Look, D. C , Smith, J. J., and Welsh, M. J. (2000). The osmolyte xylitol reduces the salt concentration of airway surface liquid and may enhance bacterial killing. Proc. Natl. Acad. Sci. USA 97, 11,614-11,619. 5 9 0 Raymond John Pickles 62. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia in vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 63. Wang, G., Davidson, B. L., Melchert, P., Slepushkin, V. A., van Es, H. H., Bodner, M., Jolly, D. J., and McCray, P. B., Jr. (1998). Influence of cell polarity on retrovirus-mediated gene transfer to differentiated human airw^ay epithelia. / . Virol. 72, 9818-9826. 64. Walters, R. W., Grunst, T., Bergelson, J. M., Finberg, R. W., Welsh, M. J., and Zabner, J. (1999). Basolateral localization of fiber receptors limits adenovirus infection from the apical surface of airway epithelia./. Biol. Chem. 274, 10,219-10,226. 65. Goldman, M. J., and Wilson, J. M. (1995). Expression of alpha v beta 5 integrin is necessary for efficient adenovirus-mediated gene transfer in the human airway./. Virol. 69,5951-595S. 66. Hidaka, C., Milano, E., Leopold, P. L., Bergelson, J. M., Hackett, N. R., Finberg, R. W., Wickham, T. J., Kovesdi, I., Roelvink, P., and Crystal, R. G. (1999). CAR-dependent and CAR-independent pathways of adenovirus vector-mediated gene transfer and expression in human fibroblasts./. Clin. Invest. 103, 579-587. 67. Freimuth, P. (1996). A human cell line selected for resistance to adenovirus infection has reduced levels of the virus receptor. / . Virol. 70, 4081-4085. 68. Griffiths, M., Huang, X. Z., Wu, J. F., Driscoll, R., and Sheppard, D. (1997). Inactivation of the beta5 integrin subunit gene does not prevent expression of adenovirus genes in mouse airway epithelium. Respir. Crit. Care Med. 155, A549. 69. Fasbender, A., Zabner, J., Chillon, M., Moninger, T. O., Puga, A. P., Davidson, B. L., and Welsh, M. J. (1997). Complexes of adenovirus with polycationic polymers and cationic lipids increase the efficiency of gene transfer in vitro and in vivo. / . Biol. Chem. 272, 6479-6489. 70. Wickham, T. J., Roelvink, P. W., Brough, D. E., and Kovesdi, I. (1996). Adenovirus targeted to heparan-containing receptors increases its gene delivery efficiency to multiple cell types. Nat. Biotechnol. 14, 1570-1573. 71. Pickles, R., Fahrner, J. Petrella, J., Boucher, R., and Bergelson, J. (2000). Retargeting the coxsackievirus and adenovirus receptor to the apical surface of polarised epithelial cells reveals the glycocalyx as a barrier to adenovirus mediated gene transfer. / . Virol. 74, 6050-6057. 72. Rambourg, A., Neutra, M., and Leblond, C. P. (1966). Presence of a "cell coat" rich in carbohydrate at the surface of cells in the rat. Anat. Rec. 154, 4 1 - 7 1 . 73. Bennett, H. S. (1963). Morphological aspects of extracellular polysaccharides./. Histochem. Cytochem. 11, 23. 74. Bernacki, S. H., Nelson, A. L., Abdullah, L., Sheehan, J. K., Harris, A., Davis, C. W., and Randell, S. H. (1999). Mucin gene expression during differentiation of human airway epithelia in vitro. Am. J. Respir. Cell Mol. Biol. 20, 595-604. 75. Buisine, M. P., Devisme, L., Copin, M. C , Durand-Reville, M., Gosselin, B., Aubert, J. P., and Porchet, N. (1999). Developmental mucin gene expression in the human respiratory tract. Am. J. Respir. Cell Mol. Biol. 20, 209-218. 76. Chambers, J. A., Hollingsworth, M. A., Trezise, A. E., and Harris, A. (1994). Developmental expression of mucin genes MUCl and MUC2. / . Cell Sci. 107(2), 413-424. 77. Braga, V. M., Pemberton, L. F., Duhig, T., and Gendler, S. J. (1992). Spatial and temporal expression of an epithelial mucin, Muc-1, during mouse development. Development 115, 427-437. 78. Pemberton, L., Taylor-Papadimitriou, J., and Gendler, S. J. (1992). Antibodies to the cyto plasmic domain of the MUCl mucin show conservation throughout mammals. Biochem. Biophys. Res. Commun. 185, 167-175. 79. Porchet, N., Nguyen, V. C , Dufosse, J., Audie, J. P., Guyonnet-Duperat, V., Gross, M. S., Denis, C , Degand, P., Bernheim, A., and Aubert, J. P. (1991). Molecular cloning and chro mosomal localization of a novel human tracheo-bronchial mucin cDNA containing tandemly repeated sequences of 48 base pairs. Biochem. Biophys. Res. Commun. 175, 414-422. 19. Utility of Ad Vectors in Animal Models 11: Genetic Disease 5 9 1 80. McNeer, R. R., Huang, D., Fregien, N. L., and Carraway, K. L. (1998). Sialomucin complex in the rat respiratory tract: A model for its role in epithelial protection. Biochem. J. 330(2), 737-744. 81. Sheng, Z., Wu, K., Carraway, K. L., and Fregien, N. (1992). Molecular cloning of the transmembrane component of the 13762 mammary adenocarcinoma sialomucin complex. A new member of the epidermal growth factor superfamily./. Biol. Chem. 267,16,341-16,346. 82. Wu, K., Fregien, N., and Carraway, K. L. (1994). Molecular cloning and sequencing of the mucin subunit of a heterodimeric, bifunctional cell surface glycoprotein complex of ascites rat mammary adenocarcinoma cells./. Biol. Chem. 269, 11,950-11,955. 83. Arcasoy, S. M., Latoche, J., Gondor, M., Watkins, S. C , Henderson, R. A., Hughey, R., Finn, O. J., and Pilewski, J. M. (1997). MUCl and other sialoglycoconjugates inhibit adenovirus-mediated gene transfer to epithelial cells. Am. J. Respir. Cell Mol. Biol. 17y 422-435. 84. Arcasoy, S. M., Latoche, J. D., Gondor, M., Pitt, B. R., and Pilewski, J. M. (1997). Polyca- tions increase the efficiency of adenovirus-mediated gene transfer to epithelial and endothelial cells in vitro. Gene Ther. 4, 32-38. 85. Worgall, S., Leopold, P. L., Wolff, G., Ferris, B., Van Roijen, N., and Crystal, R. G. (1997). Role of alveolar macrophages in rapid elimination of adenovirus vectors administered to the epithelial surface of the respiratory tract. Hum. Gene Ther. 8, 1675-1684. 86. Parsons, D. W., Grubb, B. R., Johnson, L. G., and Boucher, R. C. (1998). Enhanced in vivo airway gene transfer via transient modification of host barrier properties with a surface-active agent. Hum. Gene Ther. 9, 2661-2672. 87. Otake, K., Ennist, D. L., Harrod, K., and Trapnell, B. C. (1998). Nonspecific inflammation inhibits adenovirus-mediated pulmonary gene transfer and expression independent of specific acquired immune responses. Hum. Gene Ther. 9, 2207-2222. 88. Van Ginkel, F. W., Liu, C , Simecka, J. W., Dong, J. Y., Greenway, T., Frizzell, R. A., Kiyono, H., McGhee, J. R., and Pascual, D. W. (1995). Intratracheal gene delivery with adenoviral vector induces elevated systemic IgG and mucosal IgA antibodies to adenovirus and beta-galactosidase. Hum. Gene Ther. 6, 895-903. 89. Simon, R. H., Engelhardt, J. F., Yang, Y., Zepeda, M., Weber-Pendleton, S., Grossman, M., and Wilson, J. M. (1993). Adenovirus-mediated transfer of the CFTR gene to lung of nonhuman primates: Toxicity study. Hum. Gene Ther. 4, 771-780. 90. Yei, S., Mittereder, N., Tang, K., O'Sullivan, C , and Trapnell, B. C. (1994). Adenovirus- mediated gene transfer for cystic fibrosis: Quantitative evaluation of repeated in vivo vector administration to the lung. Gene Ther. 1, 192-200. 91. Piedimonte, G., Pickles, R. J., Lehmann, J. R., McCarty, D., Costa, D. L., and Boucher, R. C. (1997). Replication-deficient adenoviral vector for gene transfer potentiates airway neurogenic inflammation. Am. J. Respir. Cell Mol. Biol. 16, 250-258. 92. Goldman, M. J., Litzky, L. A., Engelhardt, J. F., and Wilson, J. M. (1995). Transfer of the CFTR gene to the lung of nonhuman primates with El-deleted, E2a-defective recombinant adenoviruses: a preclinical toxicology study. Hum. Gene Ther. 6, 839-851. 93. Engelhardt, J. F., Litzky, L., and Wilson, J. M. (1994). Prolonged transgene expression in cotton rat lung with recombinant adenoviruses defective in E2a. Hum. Gene Ther. 5, 1217-1229. 94. Lieber, A., He, C. Y., Kirillova, I., and Kay, M. A. (1996). Recombinant adenoviruses with large deletions generated by Cre-mediated excision exhibit different biological properties compared with first- generation vectors in vitro and in vivo. / . Virol. 70, 8944-8960. 95. Morsy, M. A., Gu, M., Motzel, S., Zhao, J., Lin, J., Su, Q., Allen, H., Franlin, L., Parks, R. J., Graham, F.L., Kochanek, S., Bett, A. J., and Caskey, C. T. (1998). An adenoviral vector deleted for all viral coding sequences results in enhanced safety and extended expression of a leptin transgene. Proc. Natl. Acad. Sci. USA 95, 7866-7871. 5 9 2 Raymond John Pickles 96. Mack, C. A., Song, W. R., Carpenter, H., Wickham, T. J., Kovesdi, I., Harvey, B. G., Magovern, C. J., Isom, O. W., Rosengart, T., Falck-Pedersen, E., Hackett, N. R., Crystal, R. G., and Mastrangeli, A. (1997). Circumvention of anti-adenovirus neutralizing immunity by administration of an adenoviral vector of an alternate serotype. Hum. Gene Ther. 8, 99-109. 97. Mastrangeli, A., Harvey, B. G., Yao, J., Wolff, G., Kovesdi, I., Crystal, R. G., and Falck- Pedersen, E. (1996). "Sero-switch" adenovirus-mediated in vivo gene transfer: Circum vention of anti-adenovirus humoral immune defenses against repeat adenovirus vector administration by changing the adenovirus serotype. Hum. Gene Ther. 7, 79-87. 98. Scaria, A., St. George, J. A., Gregory, R. J., Noelle, R. J., Wadsworth, S. C , Smith, A. E., and Kaplan, J. M. (1997). Antibody to CD40 ligand inhibits both humoral and cellular immune responses to adenoviral vectors and facilitates repeated administration to mouse airway. Gene Ther. 4, 611-617. 99. Griesenbach, U., Chonn, A., Cassady, R., Hannam, V., Ackerley, C , Post, M., Tansv^ell, A. K., Olek, K., O'Brodovich, H., and Tsui, L. C. (1998). Comparison between intratracheal and intravenous administration of liposome-DNA complexes for cystic fibrosis lung gene therapy. Gene Ther. 5, 181-188. 100. Liu, P., Qi, H., Huang, L., and Liu, D. (1997). Factors controlling the efficiency of cationic lipid-mediated transfection in vivo via intravenous administration. Gene Ther. 4, 517-523. 101. Lemarchand, P., Jaffe, H. A., Danel, C , Cid, M. C , Kleinman, H. K., Stratford-Perricaudet, L. D., Perricaudet, M., Pavirani, A., Lecocq, J. P., and Crystal, R. G. (1992). Adenovirus- mediated transfer of a recombinant human alpha 1-antitrypsin cDNA to human endothelial cells. Proc. Natl. Acad. Sci. USA 89, 6482-6486. 102. Lemarchand, P., Jones, M., Danel, C , Yamada, L, Mastrangeli, A., and Crystal, R. G. (1994). In vivo adenovirus-mediated gene transfer to lungs via pulmonary artery. / . Appl. Physiol. 76, 2840-2845. 103. Coyne, C. B., Kelly, M. M., Boucher, R. C , and Johnson, L. G. (2000). Enhanced epithehal gene transfer by modulation of tight junctions with sodium caprate. Am. J. Respir. Cell Mol. Biol. 23, 602-609. 104. Chu, Q.,
St. George, J. A., Lukason, M., Cheng, S. H., Scheule, R. K., and Eastman, S. J. (2001). Egta enhancement of adenovirus-mediated gene transfer to mouse tracheal epithelium in vivo. Hum. Gene Ther. 12, 455-467. 105. Wang, G., Zabner, J., Deering, C , Launspach, J., Shao, J., Bodner, M., Jolly, D. J., David son, B. L., and McCray, P. B., Jr. (2000). Increasing epithelial junction permeability enhances gene transfer to airway epithelia In vivo. Am. J. Respir. Cell Mol. Biol. 22, 129-138. 106. Watkins, S. J., Mesyanzhinov, V. V., Kurochkina, L. P., and Hawkins, R. E. (1997). The "adenobody" approach to viral targeting: Specific and enhanced adenoviral gene delivery. Gene Ther. 4, 1004-1012. 107. Wickham, T. J., Carrion, M. E., and Kovesdi, I. (1995). Targeting of adenovirus penton base to new receptors through replacement of its RGD motif with other receptor-specific peptide motifs. Gene Ther. 2, 750-756. 108. Wickham, T. J., Lee, G. M., Titus, J. A., Sconocchia, G., Bakacs, T., Kovesdi, I., and Segal, D. M. (1997). Targeted adenovirus-mediated gene delivery to T cells via CD3. / . Virol. 71, 7663-7669. 109. Hoganson, D. K., Sosnowski, B. A., Pierce, G. F., and Doukas, J. (2001). Uptake of adenovi ral vectors via fibroblast growth factor receptors involves intracellular pathways that differ from the targeting ligand. Mol. Ther. 3, 105-112. 110. Kreda, S. M., Pickles, R. J., Lazarowski, E. R., and Boucher, R. C. (2000). G-protein- coupled receptors as targets for gene transfer vectors using natural small-molecule ligands. Nat. Biotechnol. 18, 635-640. 19. Utility of Ad Vectors in Animal Models II: Genetic Disease 5 9 3 111. Mason, S. J., Paradiso, A. M., and Boucher, R. C. (1991), Regulation of transepithelial ion transport and intracellular calcium by extracellular ATP in human normal and cystic fibrosis airway epithehum. Br. J. Pharmacol. 103, 1649-1656. 112. Drapkin, P. T., O'Riordan, C. R., Yi, S. M., Chiorini, J. A., Cardella, J., Zabner, J., and Welsh, M. J. (2000). Targeting the urokinase plasminogen activator receptor enhances gene transfer to human airway epithelia. / . Clin. Invest. 105, 589-596. 113. Ziady, A., K. R., F. T., and Davies, P. (1999). Serpin enzyme complex receptor targeted DNA complexes deliver genes to airway epithelia. Fediatr. Pulmonol. 19, 233. 114. Wickham, T. J., Segal, D. M., Roelvink, P. W., Carrion, M. E., Lizonova, A., Lee, G. M., and Kovesdi, I. (1996). Targeted adenovirus gene transfer to endothelial and smooth muscle cells by using bispecific antibodies. / . Virol. 70, 6831-6838. 115. Douglas, J. T., Rogers, B. E., Rosenfeld, M. E., Michael, S. I., Feng, M., and Curiel, D. T. (1996). Targeted gene delivery by tropism-modified adenoviral vectors. Nat. Biotechnol. 14, 1574-1578. 116. Pickles, R., Johnson, L. G., Olsen, J. C., Gerard, R., Segal, D., and Boucher, R. C. (1999). Correction of the CF bioelectric defect in human CF well-differentiated airway epithelial cells by retargeting adenoviral vectors to luminal P2Y2 purinoceptors. Fediatr. Fulmonol. 19, 222. 117. Pickles, R., Kreda, S., Olsen, J., Johnson, L., Gerard, R., Segal, D., and Boucher, R. (1998). High efficiency gene transfer to polarised epithelial cells by retargeting adenoviral vectors to P2Y2 purinoceptors with bispecific antibodies. Fediatr. Fulmonol. 17, 261. 118. Romanczuk, H., Galer, C , Zabner, J., Barsomian, G., Wadsworth, S., and O'Riordan, C. (1999). Modification of an adenoviral vector with biologically selected peptides: A novel strategy for gene delivery to cells of choice. Hum. Gene Ther. 10, 2615-2626. 119. O'Riordan, C , Lachapelle, A., Delgado, C , Parkes, V., Wadsworth, S., Smith, A., and Fran cis, G. (1999). PEGylation of adenovirus with retention of infectivity and protection from neutralizing antibody in vitro and in vivo. Hum. Gene Ther. 10, 1349-1358. 120. Summerford, C , and Samulski, R. J. (1998). Membrane-associated heparan sulfate proteo glycan is a receptor for adeno-associated virus type 2 virions. / . Virol. 72, 1438-1445. 121. Krasnykh, V. N., Mikheeva, G. V., Douglas, J. T., and Curiel, D. T. (1996). Generation of recombinant adenovirus vectors with modified fibers for altering viral tropism. / . Virol. 70, 6839-6846. 122. Michael, S., Hong, J., Curiel, D., and Engler, J. (1995). Addition of a short peptide ligand to the adenovirus fibre protein. Gene Ther. 2, 660-668. 123. Krasnykh, V., Dmitriev, I., Mikheeva, G., Miller, C. R., Belousova, N., and Curiel, D. T. (1998). Characterization of an adenovirus vector containing a heterologous peptide epitope in the HI loop of the fiber knob. / . Virol. 72, 1844-1852. 124. Roelvink, P. W., Mi Lee, G., Einfeld, D. A., Kovesdi, L, and Wickham, T. J. (1999). Iden tification of a conserved receptor-binding site on the fiber proteins of CAR-recognizing adenoviridae. Science 286, 1568-1571. 125. Zabner, J., Chillon, M., Grunst, T., Moninger, T. O., Davidson, B. L., Gregory, R., and Armentano, D. (1999). A chimeric type 2 adenovirus vector with a type 17 fiber enhances gene transfer to human airway epithelia. / . Virol. 73, 8689-8695. 126. Havenga, M. J., Lemckert, A. A., Grimbergen, J. M., Vogels, R., Huisman, L. G., Vale- rio, D., Bout, A., and Quax, P. H. (2001). Improved adenovirus vectors for infection of cardiovascular tissues./. Virol. 75, 3335-3342. 127. Arnberg, N., Edlund, K., Kidd, A. H., and Wadell, G. (2000). Adenovirus type 37 uses sialic acid as a cellular receptor. / . Virol. 74, 42-48 . 128. Fasbender, A., Lee, J. H., Walters, R. W., Moninger, T. O., Zabner, J., and Welsh, M. J. (1998). Incorporation of adenovirus in calcium phosphate precipitates enhances gene transfer to airway epitheUa in vitro and in vivo. / . Clin. Invest. 102, 184-193. 5 9 4 Raymond John Pickles 129. Lee, J. H., Zabner, J., and Welsh, M. J. (1999). Delivery of an adenovirus vector in a calcium phosphate coprecipitate enhances the therapeutic index of gene transfer to airway epithelia. Hum. Gene Ther. 10, 603-613. 130. Weiss, D.J., Strandjord, T. P., Liggitt, D., and Clark,]. G. (1999). Perflubron enhances adenovirus-mediated gene expression in lungs of transgenic mice with chronic alveolar filling. Hum. Gene Ther. 10, 2287-2293. 131. Weiss, D.J., Strandjord, T. P., Jackson, J. C , Clark, J. G., and Liggitt, D. (1999). Perflu orochemical liquid-enhanced adenoviral vector distribution and expression in lungs of spontaneously breathing rodents. Exp. Lung Res. 25, 317-333. 132. Weiss, D. J., Bonneau, L., Allen,]. M., Miller, A. D., and Halbert, C. L. (2000). Perfluo rochemical liquid enhances adeno-associated virus-mediated transgene expression in lungs. Mol. Ther. 2, 624-630. 133. Kochanek, S., Clemens, P. R., Mitani, K., Chen, H. H., Chan, S., and Caskey, C. T. (1996). A new adenoviral vector: Replacement of all viral coding sequences with 28 kb of DNA independently expressing both full-length dystrophin and beta-galactosidase. Proc. Natl. Acad. Sci. VSA 93, 5731-5736. 134. Mitani, K., Graham, F. L., Caskey, C. T., and Kochanek, S. (1995). Rescue, propagation, and partial purification of a helper virus- dependent adenovirus vector. Troc. Natl. Acad. Sci. USA 92, 3854-3858. 135. Clemens, P. R., Kochanek, S., Sunada, Y., Chan, S., Chen, H. H., Campbell, K. P., and Caskey, C. T. (1996). In vivo muscle gene transfer of full-length dystrophin with an aden oviral vector that lacks all viral genes. Gene Ther. 3, 965-972. 136. Bruder, J. T., Jie, T., McVey, D. L., and Kovesdi, L (1997). Expression of gpl9 K increases the persistence of transgene expression from an adenovirus vector in the mouse lung and liver./. Virol. 71, 7623-7628. 137. Wilson, C. B., Embree, L. J., Schowalter, D., Albert, R., Aruffo, A., HoUenbaugh, D., Lins- ley. P., and Kay, M. A. (1998). Transient inhibition of CD28 and CD40 ligand interactions prolongs adenovirus-mediated transgene expression in the lung and faciUtates expression after secondary vector administration./. Virol. 72, 7542-7550. 138. Yang, Y., Su, Q., Grewal, L S., Schilz, R., Flavell, R. A., and Wilson, J. M. (1996). Transient subversion of CD40 ligand function diminishes immune responses to adenovirus vectors in mouse liver and lung tissues./. Virol. 70, 6370-6377. 139. Jooss, K., Yang, Y., and Wilson, J. M. (1996). Cyclophosphamide diminishes inflammation and prolongs transgene expression following delivery of adenoviral vectors to mouse liver and lung. Hum. Gene Ther. 7, 1555-1566. 140. Yang, Y., Greenough, K., and Wilson, J. M. (1996). Transient immune blockade prevents formation of neutralizing antibody to recombinant adenovirus and allows repeated gene transfer to mouse liver. Gene Ther. 3, 412-420. 141. Yang, Y., Trinchieri, G., and Wilson, J. M. (1995). Recombinant IL-12 prevents formation of blocking IgA antibodies to recombinant adenovirus and allows repeated gene therapy to mouse lung. Nat. Med. 1, 890-893. 142. Yonemitsu, Y., Kitson, C , Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P. K., Kato, A., Hasan, M. K., Nagai, Y., Masaki, L, Fukumura, M., Hasegawa, M., Geddes, D. M., and Alton, E. W. (2000). Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18, 970-973. 143. Kobinger, G. P., Weiner, D. J., Yu, Q. C , and Wilson, J. M. (2001). Filovirus-pseudotyped lentiviral vector can efficiently and stably transduce airway epithelia in vivo. Nat. Biotechnol. 19,225-230. 144. Boucher, R. C. (1999). Status of gene therapy for cystic fibrosis lung disease./. Clin. Invest. 103,441-445. C H A P T E R Utility of Adenoviral Vectors in Animal Models of Human Disease III: Acquired Diseases Erik Lubberts University Medical Center St. Radboud Niimegen Center for Molecular Life Science Nijmegen, The Netherlands Jay K. Kolls^ Department of Medicine and Pediatrics Louisiana State University Health Sciences Center New Orleans, Louisiana I. Adenoviral Vectors for Infectious Disease Recombinant adenoviral vectors for infectious diseases can generally be categorized into three general approaches. The first is the use of a vector-based vaccine where the vector encodes for proteins to achieve an immune response. In fact, adenoviruses have been used in the U.S. military for vaccines [1]. The second approach is to use adenoviral vectors, which encode immunostimula- tory genes to achieve in vivo immunotherapy. Last, these vectors can be used to provide critical accessory molecules for T- or B-cell activation for patients that are deficient in these molecules or theoretically direct anti-infectious genes such as anti-bacterial peptides. These general paradigms hold true for most gene-therapy approaches with adenoviral-based vector systems regardless if the targets are infectious disease, an inherited immune deficiency sate, or cancer. In this chapter we focus on these paradigms in the context of specific disease enti ties that may be candidates for treatment with adenovirus-based vector systems. ^ Corresponding author. ADENOVIRAL VECTORS FOR GENE THERAPY 5 9 5 Copyright 2002, Elsevier Science (USA). All rights reserved. 5 9 6 Lubberts and Kolls A. Tuberculosis Mycobacterium tuberculosis the etiologic agent of tuberculosis (TB), is a facultative intracellular pathogen which remains the foremost cause of death from a single infectious agent among adults [2]. It has been estimated that approximately one-third of the world's population in 1990 (1.7 billion individuals) were infected with M. tuberculosis^ affecting mostly people living in developing countries, and that with the global control measures in place at that time, 30 million people were expected to die due to tuberculosis by the year 2000 [2]. The most effective vaccine against tuberculosis in man is the BCG vaccine, an attenuated substrain of Mycobacterium bovis^ which has been used for more than 50 years worldwide. However, this vaccine is very erratic in conferring protection, varying as much as 0 -80% in separate clinical trials [3]. In countries with a lower incidence of tuberculosis, such as the United States, the emergence of multidrug-resistant strains threatens control measures with anti-mycobacterial drugs. It is apparent that current immunotherapeutic and chemotherapeutic approaches for the control of tuberculosis need to be improved. After inhalation, the organism replicates within the lung macrophage. The protective response to infection with intracellular bacteria is cell-mediated [4]. Protective immunity in the mouse model of tuberculosis is mediated by T lymphocytes that secrete gamma interferon (IFNy), which activates infected macrophages to control intracellular bacilli in a manner believed to be similar to the protective response in man. Several subpopulations of T lymphocytes contribute to the protective response in the lungs of infected mice [5]. Most of this protection is conferred by a short-lived population of rapidly dividing, IFNy-secreting CD4+ T lymphocytes [6] which peak within 3 weeks of infec tion, a time which correlates with the control of further mycobacterial growth in the host [7]. The pivotal role of IFNy in protective immunity to M. tuberculosis was unequivocally demonstrated using IFNy knockout (KO) mice. The
single gene encoding IFNy was disrupted, and these mice were originally shown to: (a) be incapable of IFNy production, (b) poorly express class II MHC, (c) be deficient in the production of reactive oxygen and reactive nitrogen radicals, and (d) be very susceptible to M. bovis BCG [8]. IFNy KO mice succumbed to infection with M. tuberculosis fairly rapidly whether the virulent bacilli were delivered intravenously at moderate [9] to high doses [10] or via a low-dose aerosol [9]. There is also an absolute requirement for interleukin (IL)-12 in the protective response against TB. This has been demonstrated using IL-12p40 KO mice. These mice do not produce the heavy chain of the IL-12 heterodimer and therefore do not make the bioactive p70 form of IL-12, which results in a poor cell-mediated response to antigen [11]. Recently, it was shown that IL- 12p40 KO succumbed to an intravenous infection with M. tuberculosis within 50 days [12]. Whereas wild-type controls contained the infection and strongly 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 597 expressed genes encoding IFNy, tumor necrosis factor (TNF), and inducible nitric oxide synthase (iNOS) in infected tissues, these KO mice produced no IFNy message and delayed TNF and iNOS message. As protective cytokines, which play a pivotal role in protection against tuberculosis, IFNy and IL-12 represent attractive targets for cytokine-based therapy approaches designed to enhance protective cell-mediated immu nity [13]. Recently, a replication-deficient adenoviral vector designed to deliver IFNy (AdIFN) vv̂ as delivered intratracheally into the lungs of BALB/c mice, v^hich w êre subsequently challenged, v^ith a sublethal aerosol of M. tubercu losis. Prior pharmacokinetic analyses of adenoviral-mediated expression of IFNy in BALB/c mice had indicated that transfected mice expressed increased IFNy in the lungs for as long as 21 days follov^ing delivery of the vector. Other mice w êre transfected with a control virus expressing lacZ (AdLacZ) shortly before the low-dose aerosol exposure to M. tuberculosis. AdIFN-treated mice initially contained the infection in the lungs much better than the control nontransfected mice or AdLacZ-treated mice (Fig. 1). The protective effect in the lungs paralleled the local production of IFNy by the vector and, thus, was relatively short-lived, such that the load of viable bacilli in AdIFNy-treated lungs reached levels similar to the controls by 30 days of infection. There was no protective effect on the control of mycobacterial dissemination or growth in other primary target organs. Similar AdIFNy-mediated control of bacterial growth in the lungs was not seen in mice, which already had established chronic M. tuberculosis infection. Based on these preclinical data, several clinical trial have been initiated for both multidrug-resistant M. tuberculosis and persistent mycobacteria avium CSU46 AdIFN AdLacZ p < 0.05 Figure 1 AdIFN reduces growth of Mycobacterium tuberculosis in the lung. Mice were pretreated with AdIFN, AdLacZ, or vehicle and then challenged with CSU 46, a clinical isolate of M. tuberculosis, and lung organism burden was quantified by quantitative organ culture serially after aerosol challenge (data provided by Dr. Elizabeth Rhoades and Dr. Ian Orme, Colorado State University). 5 9 8 Lubberts and Kolls complex (MAC) infection in non-HIV-infected hosts. Williams and colleagues, from our group, recently reported on a Phase I trial of aerosolized IFNy to patients with persistent MAC infection [14]. All patients tolerated the aerosol well and three of eight had sputum acid-fast bacilli (AFB) smears convert to negative. Condos and colleagues have recently reported on five patients in New York City with multidrug-resistant tuberculosis who received 500 \|JLg of IFNy aerosolized three times a week for 1 month [15]. Again the aerosol form of the drug was well-tolerated and all patients had sputum smears for AFB convert to negative and the time to positive culture increased (from 17 to 24 days, not significant), suggesting a reduction in organism burden. Moreover, patient weight increased or stabilized, and there were objective decreases in the size of cavitary lesions in all patients 2 months after treatment had ended. It is important to note that data to date suggest that IFN, whether in protein or vector form needs to be provided for a relatively long time to control M. tuberculosis growth. Thus it is possible that newer generations of adenoviral-based or other vector systems may achieve longer-term control of infection. B. Pneumonia Pneumonia and influenza infection remain the sixth leading cause of death in the United States [16]. Drug-resistant organisms are increasingly isolated from infected patients, presumably due to the broad use of antibiotics. As mentioned above, several biological response modifiers such as granulocyte colony stimulating factor (G-CSF) and IFNy have been investigated in patients as protein-based therapies. However, due to pharmacological advantages of adenovirus and other gene-based vector systems, gene therapy may provide an alternative approach for in vivo immunomodulation. Adenoviral-mediated gene transfer of the murine IFN gene (AdIFN) results in dose-dependent increases in IFN in bronchoalveolar lavage fluid (HALF) in both mice and rats [17]. Recombinant protein expression occurs up to 28 days in Sprague-Dawley rats and up to 21 days in Balb/c mice [17]. Expression of IFN has a biological effect for at least 14 days in the lung as class II MHC is significantly upregulated in lavaged alveolar macrophages over this time [17]. Moreover, although AdIFN does not result in spontaneous release of TNF in the lung, a subsequent challenge with intratracheal endotoxin results in a greater than fivefold increase in peak TNF levels in BALF in AdlFN- transduced animals compared to control animals (Fig. 2). This enhanced TNF response is associated with increased neutrophil recruitment [17] and increased clearance of Pseudomonas aeruginosa up to 14 days after gene transfer [17]. Although the high levels of both IFN and TNF in the BALF were quite high, these cytokines were confined to the lung and remained essentially undetectable in the plasma (data not shown). Thus, these compartmentalized 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 599 n PBS B 10(7)AdlFN • 10(8)AdlFN • 10(9)AdlFN n 10(9)AdCMVLuc p < 0.05 Figure 2 Dose-dependent increase of LPS-induced lung TNF production by AdIFN. Six- to 8-week-old BALB/c mice were pretreated with AdIFN, AdCMVLuc, or PBS 3 days prior to admin istration of intratracheal LPS. TNF was measure in bronchoalveolar lavage (BAL) fluid 3 h after LPS administration by ELISA and corrected for macrophage cell number in the BAL fluid. ND, none detected. effects may offer cytokine gene transfer and advantage over systemically delivered protein-based therapies. Alcohol abuse is a risk factor for bacterial pneumonia [18] as well as acute lung injury [19]. Alcohol intoxication increases the risk of aspiration and suppresses macrophage free-radical protection and bacterial killing [20, 21]. Moreover, alcohol can suppress the elaboration of alarm cytokines such as TNF [22, 23]. Alcohol-induced suppression of TNF production by macrophages can be reversed by IFN in vitro. To investigate whether IFN gene therapy could augment TNF and bacterial host defense in vivo., we administered AdIFN intratracheally to rats, followed 3 days later with an acutely intoxicating dose of ethanol {S.5 g/kg intraperitoneal). Thirty minutes later animals were chal lenged intratracheally with endotoxin (LPS) or live Klebsiella pneumoniae to measure LPS-induced TNF responses and lung neutrophil recruitment or bacterial clearance of K. pneumoniae., respectively. This dose of alcohol has previously been shown by our group to suppress LPS-induced lung macrophage production of TNF. AdIFN pretreatment prevented alcohol-induced TNF sup pression as well as lung neutrophil recruitment (Figs. 3A and 3B). Moreover, we observed a significant increase in lung bacterial clearance of K. pneumoniae (Fig. 3C) [24]. Standiford and colleagues have shown that adenoviral gene transfer of functional IL-12 [25] produces the p70 heterodimer of IL-12 in the lung lavage fluid in a dose-dependent fashion for up to 7 days [26]. Mice pretreated with this vector, then challenged with 3 x 10^ K. pneumoniae., had signif icantly improved survival, compared to AdCMVLacZ-treated or untreated 600 Lubberts and Kolls 45-1 "* 40- • • L P S 1 S 35- 1 J ETOH-LPS1 ^ on 2 30- 1 25- * p < 0.05 a 20- 1 15- 1—1 1 10- 0- AdIFN AdLUC AdIFN AdLUC * p < 0.001 I 1 600 E PBS c 500 o ETOH E 3 400 0c) a. 300 J) 200 X3 (0 100 * p < 0.05 '> AdIFN AdLUC Figure 3 Enhancement of pulmonary host defense in an acute model of ethanol (ETOH) intox ication. Male Sprague-Dawley rats were treated with 10^ pfu of AdIFN or AdLUC as a control. Three days later, rats were treated with intratracheal LPS or live K. pneumoniae. Animals receiving LPS were sacrificed 3 hours later to determine cell migration into or TNF concentration in the BAL fluid. Rats receiving K. pneumoniae were sacrificed immediately or 4 h after bacterial inoculation to determine bacterial clearance. (A) AdIFN reverses ETOH-induced suppression of lung neutrophil migration after LPS. (B) AdIFN enhances lung TNF release into BAL fluid after LPS in control and ETOH-treated animals. (C) AdIFN improves lung clearance of K. pneumoniae in a ETOH-treated rat model. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 1 controls [26]. The beneficial effect of IL-12 overexpression was mediated by both tumor necrosis factor alpha (TNFa) and IFNy, as survival in Ad5IL- 12-treated mice w âs attenuated by concomitant neutralization of endogenous TNFa or IFNy [26]. This same group demonstrated the feasibility of using TNFa, a critical proinflammatory cytokine in lung host defenses (27, 28), for in vivo immunomodulation of pulmonary host defense. To overexpress TNF compartmentally in the lung a recombinant adenovirus expressing TNF (AdmTNF) has been reported [29]. Concomitant bacterial challenge with X. pneumoniae and low-dose AdmTNF (10^ pfu) resulted in improved host defenses against the organism. However, a higher dose of vector (5 x 10^ pfu) was not beneficial in terms of bacterial clearance. Thus, understanding dose-response relationships in gene-based immunotherapies will be critical for this form of treatment to have an impact in clinical infections. Crystal and colleagues have used an adenoviral vector encoding CD40 ligand (AdCD40L) in a vaccine approach to protect against P. aeruginosa (PA) lung infection [30]. CD40L is expressed on activated T cells and allows dendritic cells (DCs) which are specialized antigen-presenting cells, to interact directly with either CD8+ cytotoxic T cells [31, 32] and B cells [33]. By transfecting DC, with AdCD40L, Kikuchi and colleagues demonstrated that gene-modified DCs pulsed with PA could stimulate naive B cells to produce anti- PA antibodies. Moreover, if these pulsed, gene-modified DCs were administered in vivo^ an in vivo anti-PA responses was achieved which protected the vaccinated mice against a subsequent challenge with PA [30]. To support the fact that B cells were critical to this response, passive transfer of either serum or B cells from vaccinated mice conferred protection to naive mice subsequently challenged with PA. C. Opportunistic Infections In addition to its known effects on upregulating macrophage function and innate host defenses, IFNy is also the prototypic THl cytokine that facilitates THO CD4+ T-cell differentiation into THl-expressing CD4+ T cells [34]. Moreover, IFN can also modulate the cytokine expression of CD 8+ T cells to a Tel phenotype [35, 36]. As IFN is produced by activated CD4+ T cells, a lack of IFN secretion could partly explain the pulmonary host defense defect associated with HIV infection. Among HIV-associated opportunistic infections, Pneumocystis carinii pneumonia remains a persistent complication of HIV infection. There is an inverse relationship between CD4+ T-cell count and acquisition of this infection. Furthermore, IFNy, in the form of recombinant protein given as an aerosol, has been shown to reduce the intensity of P. carinii infection in a mouse model [37]. Based on these data, our laboratory investigated whether adenoviral-mediated gene transfer of IFNy to the lung would have a therapeutic effect in a mouse model of P. carinii pneumonia. To 602 Lubberts a n d Kolls p < 0.05 * p < 0.05 A d L U C AdIFN Figure 4 IFN-mediated clearance of Pneumocystis carinii in CD4 T-cell depleted mice. (A) Pretreat- ment with AdIFN resulted in significant clearance of P. carinii by 28 weeks. (B) Specific modulation of CDS phenotype by AdIFN. Lung CDS cells from AdIFN-treated mice show a significant higher precursor frequency of IFN-producing clones, as measure by Elispot, than AdLUC controls. test this concept with gene deHvery, we used the AdIFN model,
which results in prolonged expression of IFN in the lungs of mice depleted of CD4+ T cells [38]. AdIFN-transduced or control (AdLuc) animals were challenged with 2 X 10^ P. carinii cysts and sacrificed at serial time points. There was similar growth of P. carinii in both AdIFN and control animals for the first 2 weeks of the infection. However, after this time point AdIFN-treated mice showed resolution of the infection over 4 - 6 weeks in spite of continued depletion of CD4+ T cells (Fig. 4A). AdIFN-treated mice recruited greater numbers of T cells, which were largely CD8^ [38]. There was also a significant increase in recruited natural killer (NK) cells in the AdIFN-treated mice [38]. AdIFN was ineffective in improving P. carinii infection in both scid mice (which have intact macrophages and NK cells) or in mice depleted of both CD4+ and CD8+ T cells, suggesting that CD8"^ T cells are required for the clearance effect imparted by AdIFN treatment. In further support of CD 8+ T cells having effector function is the fact that there is a greater precursor frequency of IFN- producing CD8+ T cell clones in AdIFN-treated mice as measured by Elispot (Fig. 4B). Understanding effector function of CD8+ T cells in the context of 20. Utility of Ad Vectors in Animal Models III: Acquired Diseases 6 0 3 P. carinii infection may have a significant impact in future therapies designed to support HIV-infected individuals against opportunistic infections. D. Viral Hepatitis Both hepatitis B and hepatitis C are important causes of chronic hepatitis and hepatitis B has been linked to hepatocellular cancer. Hepatitis C virus (HCV) is a positive-strand RNA virus and is the major infectious agent responsible for causing chronic hepatitis. Presently, there is no vaccine for HCV infection. There have been recent advances in drug therapy for this disease using a combination of Ribavirin v^ith IFNa [39]; hov\^ever, there is still need for improved sustained therapy. Lieber and colleagues have demonstrated that adenoviral-mediated gene transfer of hammerhead ribozymes directed against a conserved region of the plus strand and minus strand of the HCV genome v^ere efficient at reducing or eliminating the respective plus- or minus-strand HCV RNAs expressed in cultured cells and from primary human hepatocytes obtained from chronic HCV-infected patients. Another therapeutic approach has been to locally upregulate innate anti viral immunity. Tov^ard this end Aurisicchio and colleagues demonstrated that adenoviral-mediated gene transfer of the IFNa2 under the control of a liver- specific promoter protected mice from a challenge w îth mouse hepatitis virus type 3 [40]. Lastly, another approach has been to construct dominant negative core mutants of hepatitis B and when these are expressed in hepatocytes cell lines in the context of a recombinant adenoviral vector, these molecules w êre capable of significantly suppressing viral replication [41]. II. Chronic Inflammatory Diseases A. Inflammatory Bowel Disease The gut has been proposed as a target for gene delivery for a variety of diseases including both metabolic diseases and primary diseases affect ing the intestine, including the inflammatory bowel diseases, Chron's disease and ulcerative colitis [42, 43]. Toward this end Hogaboam and colleagues have shown that intraperitoneal delivery of adenovirus encoding interleukin-4 (AdIL-4), a prototypic TH2 cytokine, attenuates colitis induced by trinitroben- zene sulfonic acid (TNB) [44]. TNB-induced colitis is associated with an acute phase followed by an immunologically mediated phase, which is thought to be hapten-induced [45]. The attenuation as a result of AdIL-4 in colitis was associated with a reduction in colonic IFN levels and less induction of inducible nitric oxide synthase [44]. The same group has shown similar data for another TH2 cytokine, interleukin-10 in a similar model of colitis [46]. 6 0 4 Lubberts and Kolls Adenovirus IL-10 treatment was again done by the intraperitoneal route and associated with a significant reduction in colonic myeloperoxidase activity and leukotriene levels, both markers of acute inflammation. What remains unclear from these studies is whether T-cell activation is modified and whether there is protection against a second bout of colitis. Last, the intraperitoneal approach is essentially a systemic form of therapy since IL-4 and IL-10 can be detected in the serum of these mice. Since the gut can be transduced directly with adenovirus vectors, this raises the possibility that local administration of vectors to inflamed intestine could be used to compartmentally upregulate an immunomodulatory gene that would prevent or attenuate existing colitis. Toward this end, Wirtz and colleagues have investigated adenovirus- mediated gene transfer to the inflamed colon using intrarectal administration of Ad5-based vectors. These investigators observed significant gene transfer to colonic epithelium, whereas no colonic gene transfer was observed when the vector was given systemically (intravenous or intraperitoneally). Moreover, gene transfer was enhanced in the setting of TNB-induced inflammation. Last, the investigators investigated an Ad5-based vector with a lysine repeat engineered in the fiber gene, the protein responsible for initial interactions with the Coxsackie-adenovirus receptor. With this genetically modified vector, the investigators observed enhanced gene transfer to cells in the lamina propria and spleen, suggesting that antigen-specific T cells could be modified with this vector approach. B. Arthritis Like inflammatory bowel disease, rheumatoid arthritis (RA) is thought to be dominated by THl-like inflammation (Fig. 5) [47, 48]. Among chronic inflammatory diseases, more has been published on gene therapy for arthritis than any other disease. This is likely due to the fact that (1) it is a common disease entity, (2) current treatment, although effective in many cases, can be improved upon, (3) there is a readily accessible site for gene transfer, (4) there are relevant clinical models of the disease, particularly RA, and (5) gene transfer can be accomplished locally to the synovial lining cells using adenovirus-based vectors [49]. The pathogenesis of RA is complex but data to date suggest that there exist alloreactive T cells that secrete TH-1-like cytokines such as TNFa, TNFp, IL-2, and IFN, which drives inflammation. Accessory cells can also secrete TNF, IL-ip, and IL-18, which are also proinflammatory and can drive THl inflammation. This leads to an inflammatory synovial pannus, which mediates destruction of cartilage and joint erosion, which results in loss of joint function over time. A novel T-cell-derived cytokine, IL-17, has also been implicated in the pathogenesis of RA [50]. Since TH-1 inflammation can be downregulated by TH-2 cytokines, such as IL-4 or IL-10, these cytokines have been investigated as candidate genes 20 . Utility of Ad Vectors in Animal Models III: Acquired Diseases 605 Rheumatoid factors Immune Complexes, Bacterial products, IL-l,TNFa, etc. synoviocytes chondrocytes Collagenase and other proteases Figure 5 Schematic diagram of the pathogenesis of RA. to modify RA inflammation. Woods and colleagues investigated adenoviral- mediated gene transfer of the human IL-4 gene into synovial explants from RA patients and demonstrated a significant reduction in IL-ip, TNFa, and IL-8 elaboration in the explant cultures treated w îth AdIL-4 [51]. In follov^-up to this work, the same group demonstrated in vivo efficacy of intraarticular AdIL-4 treatment in adjuvant-induced arthritis in a rat model [52]. Of note v^as that AdIL-4 w âs effective in both a pretreatment and a posttreatment paradigm [52]. Similar to the in vitro findings in human explants, the in vivo treatment with AdIL-4 in the rat model was associated with lower TNFa and IL-ip levels [52]. Lubberts and colleagues have also shown efficacy of AdIL-4 in a murine model of collagen-induced arthritis (CIA) [53, 54]. Interestingly, in these studies IL-4 had less effect on the joint inflammation than it appeared to have on preservation of cartilage and in preventing bone erosion [53]. These later effects were associated with a reduction of mRNAs for IL-17, TNF, and IL-ip, as well as a decrease in metalloproteinase activity [53, 54]. These investigators also demonstrated that IL-4 can increase type I procollagen 606 Lubberts a n d Kolls synthesis and thus this may explain the joint-sparing/repair effect of IL-4 [53]. Last, Kim and colleagues demonstrated that both periarticular and systemic AdIL-4 were effective in a model of CIA [55]. Whalen and colleagues have investigated another TH2 cytokine, viral IL-10, encoded by an adenoviral vector (AdvIL-10) given by periarticular injection in the same model of CIA and found significant benefit in terms of development of arthritis and arthritis score. Moreover, the investigators show^ed that the injection of AdvIL-10 into one joint prevented arthritis in a second joint [56]. This may be due to in vivo T-cell immunomodulation by viral IL-10. In further support of a role for TH2 cytokine gene therapy in RA, Woods and colleagues have recently demonstrated that adenovirus-mediated gene transfer of interleukin-13, another TH2 cytokine, also suppresses TNF and IL-ip production in RA explant cultures [57]. In addition to the TH2 cytokine approach, the other approach of aden oviral gene transfer for arthritis has largely focused on the proinflammatory cytokines TNFa and IL-ip. Tow^ard this end, our laboratory has created sol uble type-1 receptors for both IL-1 [58] and TNFa [59] (Fig. 6). Both these molecules are dimerized by the addition of murine IgG Fc fragment and in the case of the TNF inhibitor, this molecule has been found to be more potent in TNF inhibition than monoclonal antibodies that only bind to one epitope [60]. Moreover, the proteins have longer half-lives in vivo than the monomeric soluble receptors [59]. Adenoviral-mediated gene transfer of either one of these constructs into the joint space in a rabbit model of arthritis show^ed less v^hite blood cell infiltration as w êll as less joint sv^elling. How^ever, the IL-1 inhibitor show^ed a better effect in preventing a reduction in cartilage matrix hu TNFR- EDor murine type IIL- 1RED Thrombin cleavage site mu IgG Hinge + Fc Figure 6 Schematic diagram of TNF and IL-1 receptor fusion proteins utilized in arthritis gene therapy. 20. Utility of Ad Vectors in Animal Models ill: Acquired Diseases 6 0 7 degradation. Moreover, the two vectors together appeared to have an additive effect on white blood cell infiltration into the joint space. There was also an effect observed on contralateral joints in this study 158]. Le and colleagues also demonstrated efficacy of the TNF inhibitor gene in a rat model of CIA [61]. Interestingly, Quattrocchi have reported in a mouse model of CIA that there is an acute beneficial effect of the TNF inhibitor fusion protein; however, there is a subsequent rebound with enhanced inflammation despite continued circulat ing levels of the TNF inhibitor. The investigators speculated that this may be due to antibody formation against the extracellular domain of the receptor that the cross-linked endogenous TNF receptors in the joint [62]. It is important to note that these studies were performed with a chimeric fusion protein (mouse Fc/human p55 TNF receptor) and thus whether the exacerbation of arthritis would be seen with the mouse p55 TNF receptor remains to be seen. Last, Zhang and colleagues have shown that adenoviral-mediated gene transfer of a dominant negative form of inhibitory kappa-B, which facilitates nuclear translocation of nuclear factor-kappa-B, enhanced TNF-mediated apoptosis in synovial tissue [63]. C. Fibrotic Lung Disease Idiopathic pulmonary fibrosis (IFF) is an insidious disorder that results in the deposition of collagen and fibrous tissue in the lung. The etiology of this disorder is unknown but several groups have reported decreased fibrinolytic activity [64, 65] and elevated tissue growth factor-beta-1 expression [66^ 67] in the lungs of patients with IFF. Moreover, IFNy has been shown in a pilot study to improve lung function in patients with IFF and this impairment was associated with decreased levels of messenger RNA for transforming growth factor-beta-1 and connective-tissue growth factor, the main growth factor product of transforming growth factor-beta stimulation [67]. To date this is the first compound to show improvement in lung function. Many trials have been performed with corticosteroids (prednisone) alone or in combination with cyclophosphamide [68]. However, these agents have not been shown to be effective in preserving lung function in randomized clinical trials, and moreover, their use is associated with significant side effects. Since IFF is associated with dysregulated growth factor gene expression, and a lack of definitive therapy, there is a rationale for gene therapy. Simon and colleagues recently reported on enhancing fibrinolytic activ ity in the lung in an effort to ameliorate lung fibrotic injury in response to bleomycin, a chemotherapeutic agent that can cause lung fibrosis [69]. These investigators constructed a recombinant adenovirus encoding urokinase-